Symbol Name Con Simva Atorva ANOVA Simvastatin - Downregulated Simvastatin - Upregulated
|
|
|
- Randall Walters
- 5 years ago
- Views:
Transcription
1 Symbol Name Con Simva Atorva ANOVA Simvastatin - Downregulated Asb13 ankyrin repeat and SOCS box-containing protein / / / Ascc3 activating signal cointegrator 1 complex subunit / / / Cav2 caveolin / / / Cyp26b1 cytochrome P450, family 26, subfamily b, polypeptide / / / Cyp7b1 cytochrome P450, family 7, subfamily b, polypeptide / / / Dr1 down-regulator of transcription / / / Eaf1 ELL associated factor / / / Gmppa GDP-mannose pyrophosphorylase A 308 +/ / / Grm5 glutamate receptor, metabotropic / / / Mcart1 mitochondrial carrier triple repeat / / / Mpp5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily / / / Phyhip phytanoyl-coa hydroxylase interacting protein / / / Rbbp4 retinoblastoma binding protein / / / Slc35f4 solute carrier family 35, member F / / / Smek2 SMEK homolog 2, suppressor of mek1 (Dictyostelium) / / / Suv39h2 suppressor of variegation 3-9 homolog 2 (Drosophila) 178 +/ / / Topbp1 topoisomerase (DNA) II binding protein / / / Tpo1 developmentally regulated protein TPO / / / Ugt8a UDP galactosyltransferase 8A / / / Uhrf1 ubiquitin-like, containing PHD and RING finger domains, / / / Zmym4 zinc finger, MYM-type / / / Simvastatin - Upregulated Acss2 acyl-coa synthetase short-chain family member / / / Capn7 calpain / / / Ccdc72 coiled-coil domain containing / / /
2 Cck cholecystokinin / / / Clca3 chloride channel calcium activated / / / Cnpy3 canopy 3 homolog (zebrafish) 229 +/ / / Cyp51 cytochrome P450, subfamily / / / Egfl7 EGF-like domain / / / Enoph1 enolase-phosphatase / / / Gpkow G patch domain and KOW motifs 148 +/ / / Hadha hydroxyacyl-coenzyme A dehydrogenase/3-ketoacyl-coenzy / / / Hmgcs1 3-hydroxy-3-methylglutaryl-Coenzyme A synthase / / / Klhl22 kelch-like 22 (Drosophila) 364 +/ / / Mboat5 membrane bound O-acyltransferase domain containing / / / Mvd mevalonate (diphospho) decarboxylase 290 +/ / / Nppa natriuretic peptide precursor type A 233 +/ / / E-06 Psmc5 protease (prosome, macropain) 26S subunit, ATPase / / / PVR poliovirus receptor 58 +/ / / Qsox1 quiescin Q6 sulfhydryl oxidase / / / Rps6ka1 ribosomal protein S6 kinase polypeptide / / / Rrm2 ribonucleotide reductase M2 11 +/ / / Sc4mol sterol-c4-methyl oxidase-like / / / Thoc1 THO complex / / / Thrsp thyroid hormone responsive 636 +/ / / Tm7sf2 transmembrane 7 superfamily member / / / Tmem49 transmembrane protein / / / Tox4 TOX high mobility group box family member / / / Twf1 twinfilin, actin-binding protein, homolog 1 (Drosophila) / / / Wbp1 WW domain binding protein / / / Wbscr28 Williams-Beuren syndrome chromosome region 28 (human) 120 +/ / / Xpnpep1 X-prolyl aminopeptidase (aminopeptidase P) 1, soluble 888 +/ / / Atorvastatin - Upregulated
3 Abca8b ATP-binding cassette, sub-family A (ABC1), member 8b 319 +/ / / Actg2 actin, gamma 2, smooth muscle, enteric 13 +/ / / Atp13a2 ATPase type 13A / / / Bre brain and reproductive organ-expressed protein 662 +/ / / Cacna1c calcium channel, voltage-dependent, L type, alpha 1C subun 542 +/ / / Ccdc125 coiled-coil domain containing / / / Cpsf3l cleavage and polyadenylation specific factor 3-like 348 +/ / / Fance Fanconi anemia, complementation group E 75 +/ / / Hnrnpr heterogeneous nuclear ribonucleoprotein R / / / Lhpp phospholysine phosphohistidine inorganic pyrophosphate p 861 +/ / / Mboat2 membrane bound O-acyltransferase domain containing / / / Mrpl38 mitochondrial ribosomal protein L / / / Nhlrc3 NHL repeat containing / / / Nle1 notchless homolog 1 (Drosophila) 182 +/ / / Pop5 processing of precursor 5, ribonuclease P/MRP family (S. cer 482 +/ / / Prokr2 prokineticin receptor / / / Rp2h retinitis pigmentosa 2 homolog (human) 197 +/ / / Scamp4 secretory carrier membrane protein / / / Sfrs14 splicing factor, arginine/serine-rich / / / Shq1 SHQ1 homolog (S. cerevisiae) 67 +/ / / Srebf1 sterol regulatory element binding transcription factor / / / E-05 St6galnac3 ST6 (alpha-n-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-n-a 468 +/ / / Tbl1xr1 transducin (beta)-like 1X-linked receptor / / / Tyms thymidylate synthase 103 +/ / / Wdr36 WD repeat domain / / / Atorvastatin - Downregulated Adcy2 adenylate cyclase / / / Adnp2 ADNP homeobox / / / Ahcyl1 S-adenosylhomocysteine hydrolase-like / / /
4 Akap13 A kinase (PRKA) anchor protein / / / E-05 Epm2aip1 EPM2A (laforin) interacting protein / / / Fgf10 fibroblast growth factor / / / Hdac4 histone deacetylase / / / Il13ra1 interleukin 13 receptor, alpha / / / Il6ra interleukin 6 receptor, alpha 279 +/ / / Lce1c late cornified envelope 1C 29 +/ / / Mgl1 macrophage galactose N-acetyl-galactosamine specific lectin 108 +/ / / Mrpl51 mitochondrial ribosomal protein L / / / Msi2 Musashi homolog 2 (Drosophila) 364 +/ / / Nek9 NIMA (never in mitosis gene a)- related kinase / / / Nudcd1 NudC domain containing / / / Phf7 PHD finger protein / / / Ptp4a2 protein tyrosine phosphatase 4a / / / Stat5b signal transducer and activator of transcription 5B 97 +/ / / Synpo2 synaptopodin / / / Tial1 Tia1 cytotoxic granule-associated RNA binding protein-like / / / Zfp629 zinc finger protein / / / Simvastatin & Atorvastatin - Upregulated Acp1 acid phosphatase 1, soluble / / / Afg3l2 AFG3(ATPase family gene 3)-like 2 (yeast) 593 +/ / / Atg4b autophagy-related 4B (yeast) 586 +/ / / Ccdc91 coiled-coil domain containing / / / Cse1l chromosome segregation 1-like (S. cerevisiae) / / / Dhrs7b dehydrogenase/reductase (SDR family) member 7B 601 +/ / / Dusp14 dual specificity phosphatase / / / Fbxo16 F-box protein / / / Hells helicase, lymphoid specific 46 +/ / / Hrpap20 hormone-regulated proliferation associated protein / / /
5 Kcnip3 Kv channel interacting protein 3, calsenilin 168 +/ / / Ms4a2 membrane-spanning 4-domains, subfamily A, member / / / Ndufa7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B 532 +/ / / Nob1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 684 +/ / / Rassf7 Ras association (RalGDS/AF-6) domain family (N-terminal) m 124 +/ / / Rufy3 RUN and FYVE domain containing / / / Scfd1 sec1 family domain containing / / / Sdccag10 serologically defined colon cancer antigen / / / Slc25a46 solute carrier family 25, member / / / Tmem9 transmembrane protein / / / Uxs1 UDP-glucuronate decarboxylase / / / Zfp414 zinc finger protein / / / Zfp524 zinc finger protein / / / Simvastatin & Atorvastatin - Downregulated Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit / / / Cbl Casitas B-lineage lymphoma 370 +/ / / Cdk2ap2 CDK2-associated protein / / / Ift52 intraflagellar transport 52 homolog (Chlamydomonas) 774 +/ / / Ihpk1 inositol hexaphosphate kinase / / / Itsn1 intersectin 1 (SH3 domain protein 1A) 474 +/ / / Limk2 LIM motif-containing protein kinase / / / Map2k6 mitogen-activated protein kinase kinase / / / Med1 mediator complex subunit / / / E-05 Mpg N-methylpurine-DNA glycosylase 178 +/ / / Nfe2l1 nuclear factor, erythroid derived 2,-like / / / Phf5a PHD finger protein 5A 785 +/ / / Slc26a1 solute carrier family 26 (sulfate transporter), member / / / Syt7 synaptotagmin VII 168 +/ / / Trim41 tripartite motif-containing / / /
6 Wdr40b WD repeat domain 40B / / / Zfp219 zinc finger protein / / /
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
Supplementary Materials Modeling cholesterol metabolism by gene expression profiling in the hippocampus
Supplementary Materials Modeling cholesterol metabolism by gene expression profiling in the hippocampus Christopher M. Valdez 1, Clyde F. Phelix 1, Mark A. Smith 3, George Perry 1,2, and Fidel Santamaria
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12864 Supplementary Table 1 1 2 3 4 5 6 7 Peak Gene code Screen Function or Read analysis AMP reads camp annotation reads minor Tb927.2.1810 AMP ISWI Confirmed
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
PCB 3023 Exam 4 - Form A First and Last Name
PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this
Chapter 15: Signal transduction
Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,
BIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
FATTY ACID SYNTHESIS
FATTY ACID SYNTHESIS Malonyl- CoA inhibits Carni1ne Palmitoyl Transferase I. Malonyl- CoA is a precursor for fa=y acid synthesis. Malonyl- CoA is produced from acetyl- CoA by the enzyme Acetyl- CoA Carboxylase.
BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.
BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which
SDR families. SDR10E Fatty acyl-coa reductase FACR1_HUMAN 544 x x SDR11E 3 beta-hydroxysteroid dehydrogenase 3BHS1_HUMAN 254 x x
SDR1E UDP-glucose 4-epimerase GALE_HUMAN 5305 x x x x SDR2E dtdp-d-glucose 4,6-dehydratase TGDS_HUMAN 4194 x x x x SDR3E GDP-mannose 4,6 dehydratase GMDS_HUMAN 2314 x x x x SDR4E GDP-L-fucose synthetase
Lecture #27 Lecturer A. N. Koval
Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates
Receptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
Lecture: 26 OXIDATION OF FATTY ACIDS
Lecture: 26 OXIDATION OF FATTY ACIDS Fatty acids obtained by hydrolysis of fats undergo different oxidative pathways designated as alpha ( ), beta ( ) and omega ( ) pathways. -oxidation -Oxidation of fatty
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
f(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31.
14 12 f(x) = 1.633186874x - 21.46732234 R² =.995616541 RPKM (M8.MXA) 1 8 6 4 2 2 4 6 8 1 12 14 RPKM (M8.MXB) 14 12 f(x) =.821767782x - 4.192595677497E-14 R² = 1 RPKM (M31.XA) 1 8 6 4 2 2 4 6 8 1 12 14
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
Chemical Classification of Hormones
Steroid Hormones Chemical Classification of Hormones Hormones are chemical messengers that transport signals from one cell to another There are 4 major chemical classes of hormones steroid hormones - i.e.
Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F
Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A Expression of representative subunits of the mitochondrial respiratory chain was analyzed by real time
Lecture 15. Signal Transduction Pathways - Introduction
Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals
Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire
Signal Transduction: Information Metabolism Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Introduction Information Metabolism How cells receive, process and respond
MCB*4010 Midterm Exam / Winter 2008
MCB*4010 Midterm Exam / Winter 2008 Name: ID: Instructions: Answer all 4 questions. The number of marks for each question indicates how many points you need to provide. Write your answers in point form,
Post-translational modifications of proteins in gene regulation under hypoxic conditions
203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
Signal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
LIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
Biomarkers for Hypothesis Testing
Biomarkers for Hypothesis Testing Definition for Drug Development: Biomarker = Any Measure of a Drug Action Proximal to a Clinical Effect Biochemical (PET, MRS & CSF* for CNS drugs) Physiological EEG,
Maturity-onset diabetes of the young (MODY) is a heterogeneous group
Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the
number Done by Corrected by Doctor Nayef Karadsheh
number 11 Done by حسام أبو عوض Corrected by Moayyad Al-Shafei Doctor Nayef Karadsheh 1 P a g e General Regulatory Aspects in Metabolism: We can divide all pathways in metabolism to catabolicand anabolic.
Revision. camp pathway
االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition
Determination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
Electron transport chain chapter 6 (page 73) BCH 340 lecture 6
Electron transport chain chapter 6 (page 73) BCH 340 lecture 6 The Metabolic Pathway of Cellular Respiration All of the reactions involved in cellular respiration can be grouped into three main stages
BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION
BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
PSMD6_MOUSE 26S proteasome non-atpase regulatory subunit 6 D b AMMAKAEYL RT06_MOUSE 28S ribosomal protein S6, mitochondrial D b
PSMD6_MOUSE 26S proteasome non-atpase regulatory subunit 6 D b AMMAKAEYL 19 99 0.0245 RT06_MOUSE 28S ribosomal protein S6, mitochondrial D b SAVENILEHL 32 91-0.0019 RS29_MOUSE 40S ribosomal protein S29
Leen Osama, Lujain Hamdan, Osama Mohd, Razi Kittaneh... Faisal Mohammad
23 Leen Osama, Lujain Hamdan, Osama Mohd, Razi Kittaneh... Faisal Mohammad Revision of previous lectures G-proteins coupled receptors mechanism: When a hormone binds to G-protein coupled receptor, GTP
Principles of cell signaling Lecture 4
Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway
Cellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
Supplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
Electron Transport Chain and Oxidative phosphorylation
Electron Transport Chain and Oxidative phosphorylation So far we have discussed the catabolism involving oxidation of 6 carbons of glucose to CO 2 via glycolysis and CAC without any oxygen molecule directly
Chapter 10. 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation)
Chapter 10 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation) 1 Fueling Processes Respiration 1 Most respiration involves use of an electron transport chain As electrons pass through the electron
Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B
Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
Functional Cell-Based Assays
2017 Page 1/8 Axxam S.p.A. (Italy) offers functional cell-based assays for protein targets of relevance to drug discovery research, including challenging targets such as multi subunit ion channels and
Mitochondria and ATP Synthesis
Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis 1. Mitochondria are sites of ATP synthesis in cells. 2. ATP is used to do work; i.e. ATP is an energy source. 3. ATP hydrolysis releases energy
Table 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
Introduction! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 2
Chem 452 - Lecture 10 Signal Transduction & Sensory Systems Part 2 Questions of the Day: How does the hormone insulin trigger the uptake of glucose in the cells that it targets. Introduction! Signal transduction
2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
Diagnostic test Suggested website label Description Hospitals available
Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular
Proteasomes. When Death Comes a Knock n. Warren Gallagher Chem412, Spring 2001
Proteasomes When Death Comes a Knock n Warren Gallagher Chem412, Spring 2001 I. Introduction Introduction The central dogma Genetic information is used to make proteins. DNA RNA Proteins Proteins are the
Receptors Functions and Signal Transduction- L4- L5
Receptors Functions and Signal Transduction- L4- L5 Faisal I. Mohammed, MD, PhD University of Jordan 1 PKC Phosphorylates many substrates, can activate kinase pathway, gene regulation PLC- signaling pathway
Supporting Information
Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng
HORMONES (Biomedical Importance)
hormones HORMONES (Biomedical Importance) Hormones are the chemical messengers of the body. They are defined as organic substances secreted into blood stream to control the metabolic and biological activities.
Chapter 8 Mitochondria and Cellular Respiration
Chapter 8 Mitochondria and Cellular Respiration Cellular respiration is the process of oxidizing food molecules, like glucose, to carbon dioxide and water. The energy released is trapped in the form of
CELL BIOLOGY - CLUTCH CH AEROBIC RESPIRATION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF AEROBIC RESPIRATION Cellular respiration is a series of reactions involving electron transfers to breakdown molecules for (ATP) 1. Glycolytic pathway: Glycolysis
Membrane associated receptor transfers the information. Second messengers relay information
Membrane associated receptor transfers the information Most signals are polar and large Few of the signals are nonpolar Receptors are intrinsic membrane proteins Extracellular and intracellular domains
Under aerobic conditions, pyruvate enters the mitochondria where it is converted into acetyl CoA.
Under aerobic conditions, pyruvate enters the mitochondria where it is converted into acetyl CoA. Acetyl CoA is the fuel for the citric acid cycle, which processes the two carbon acetyl unit to two molecules
Tuesday, Sept. 14, Is an enzyme a rigid system?
Tuesday, Sept. 14, Is an enzyme a rigid system? Early researchers thought of enzymes as rigid entities, recognizing their substrates the way a lock would recognize a key. Today's researchers, however,
Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system
Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds
Sarah Jaar Marah Al-Darawsheh
22 Sarah Jaar Marah Al-Darawsheh Faisal Mohammad Receptors can be membrane proteins (for water-soluble hormones/ligands) or intracellular (found in the cytosol or nucleus and bind to DNA, for lipid-soluble
RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
Transcription and chromatin. General Transcription Factors + Promoter-specific factors + Co-activators
Transcription and chromatin General Transcription Factors + Promoter-specific factors + Co-activators Cofactor or Coactivator 1. work with DNA specific transcription factors to make them more effective
Chem Lecture 10 Signal Transduction
Chem 452 - Lecture 10 Signal Transduction 111130 Here we look at the movement of a signal from the outside of a cell to its inside, where it elicits changes within the cell. These changes are usually mediated
G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
Chapter 9 Signal Transduction and Cell Growth
Part II Principles of Individual Cell Function Chapter 9 One characteristic of organisms is that they exhibit various behaviors in response to changes in their environment (i.e., the outside world). Cells
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
Bacterial cellulose synthesis mechanism of facultative
1 2 3 4 Bacterial cellulose synthesis mechanism of facultative anaerobe Kaihua Ji 1 +, Wei Wang 2, 3 +, Bing Zeng 1, Sibin Chen 1, Qianqian Zhao 4, Yueqing Chen 1, Guoqiang Li 1* and Ting Ma 1* 5 6 7 Figure
Fatty acid breakdown
Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of
BCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,
Endoplasmic Reticulum
Endoplasmic Reticulum What s ER? How is ER? Why is ER? definition description functions Nissl s bodies neurons Berg s bodies hepatocytes Organelle structure histocytochemical evidences Ergastoplasm pancreatic
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
Computational Biology I LSM5191
Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture 6 Notes: Control Systems in Gene Expression Pulling it all together: coordinated control of transcriptional regulatory molecules Simple Control:
Chemistry 5.07 Problem Set
Chemistry 5.07 Problem Set 8 2013 Problem 1. All oxidation steps in the pathway from glucose to CO 2 result in the production of NADH, except the succinate dehydrogenase (SDH) step in the TCA cycle, which
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 1. The endocrine system consists of glands that secrete chemical signals, called hormones, into the blood. In addition, other organs and cells
WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA
A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure
INTERACTION DRUG BODY
INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase
Supplementary Tables 1
Supplementary Tables 1 Supplementary Table 1: The 11 genes in the geneset for Case Study 1 At1g62570 At1g09350 At1g60470 At2g47180 At4g17090 At5g20830 At2g16890 At3g51240 At3g55120 At4g27560 At5g08640
Chapter 9. Cellular Signaling
Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The
number Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
Effects of Second Messengers
Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many
Biochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
Cell Signaling (part 1)
15 Cell Signaling (part 1) Introduction Bacteria and unicellular eukaryotes respond to environmental signals and to signaling molecules secreted by other cells for mating and other communication. In multicellular
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
Cell communication. S Cellbiosystems Olli-Pekka Koistinen
Cell communication S-114.2500 Cellbiosystems Olli-Pekka Koistinen 28.11.2007 Cell communication Cellbiosystems? What does it mean? Large groups of cells interacting with each other? Complex cell communication