Supplementary Materials for

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Materials for"

Transcription

1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway Pedro Vizán, Daniel S. J. Miller, Ilaria Gori, Debipriya Das, Bernhard Schmierer,* Caroline S. Hill* *Corresponding author. (C.S.H.); (B.S.) Published 10 December 2013, Sci. Signal. 6, ra106 (2013) DOI: /scisignal The PDF file includes: Texts S1 to S3 Fig. S1. The refractory period is not unique to HaCaT cells. Fig. S2. Kinetics of Smad2 phosphorylation. Fig. S3. Blocking and depletion of ligand. Fig. S4. Specificity of the TβRII antibody in Western blotting. Fig. S5. Recovery from the refractory state. Fig. S6. Biotinylation of surface receptors in HaCaT cells at different time points. Fig. S7. Data fitting with previous data sets. Fig. S8. Comparison between simulations and experimental data in Figs. 1 and 2. Fig. S9. Comparison between simulations and experimental data in Fig. 3. Fig. S10. Restimulation of naïve cancer cell lines with medium from the D3 line. Table S1. Model parameters. Table S2. List of model species. Table S3. Ordinary differential equations and initial conditions. References (36, 37)

2 Supplementary Text S1. Model conception: the receptor module To model the findings of signal attenuation and the existence of a refractory period, the Smad model (4) was expanded to include a mathematical description of receptor biology that involved receptor maturation, receptor trafficking to the plasma membrane, ligand binding, receptor internalization, and receptor turnover. As described in the main text, binding of TGF-β is sufficient for signal attenuation, which does not require actively signaling receptors, but does require a functional proteasome. Because we excluded degradation of PSmad2 as the cause for attenuation, we concluded that degradation of a subpool of receptors that is enhanced by TGF-β binding attenuates the signal, which is consistent with previous experimental evidence (22, 23) and previous models (24, 36). The model has to account for signal attenuation and has to capture the refractory state. Although receptor turnover (synthesis and degradation) could, in principle, account for the observed refractory period, the measured half-lives of ALK5 and TβRII (~4 h and ~2 h, respectively; Fig. 3C) indicate that receptor turnover alone is too fast to account for the slow recovery from the refractory period (12 24 hours, Fig. 2C). These slow recovery kinetics point to at least one additional slow step distinct from receptor synthesis, such as posttranslational modification or trafficking of nascent receptors to the plasma membrane. As shown in Fig. 3D and fig. S6A, it is TβRII, rather than ALK5, that is rapidly depleted from the cell surface and thus responsible for loss of responsiveness. We used this finding to simplify the model, which contains only a single receptor species with the measured turnover rate for TβRII. TGF-β binds to competent surface receptors. We 1

3 know this step is fast, because a short time of TGF-β treatment is sufficient to induce a maximum response at 1 h (Fig. 2A). In contrast, the Smad2 phosphorylation time course data (fig. S7) exhibit a delay between TGF-β addition and the appearance of phosphorylated R-Smads. These findings suggest that receptor activation in response to ligand occurs in two steps: a fast TGF-β-binding step, which rapidly occupies the pool of available surface-exposed receptors, and a slower receptor activation step, which further converts TGF-β-bound receptors into fully active, signaling receptors. In the model, receptors mature from a precursor form () to a fully processed form ( ). has an intracellular form ( ) and a surface-exposed form ( ), which are in equilibrium. This equilibrium assumption holds if trafficking to and from the plasma membrane are fast compared with receptor maturation, which is likely, given the slow maturation rate. In the absence of TGF-β, the system is fully described by and. There is good evidence that the fraction of total cellular receptors that are competent and exposed on the cell surface is very small, and we set this fraction 0.05, that is 5% of total receptors are assumed to be at the surface in the absence of signal (6). We define the maturation efficiency α as the ratio of the maturation rate constant and the receptor degradation rate constant, and scale the system such that, in the absence of a signal, the total amount of receptors 1. We can now describe the system in the absence of signal by two ordinary differential equations (ODEs) and the three parameters,, and : The fractions of in the cytoplasm and the cell surface, respectively, are given by 2

4 1 1 1 Where is the equilibrium constant of receptor trafficking to and from the membrane. The steady state of this system defines the initial conditions prior to the addition of TGF-β: S2. Model parameterization The model is expressed in dimensionless form with the total number of receptors, as well as total Smad2 and total Smad4, set to unity. In the model, 2 ng/ml TGF-β corresponds to a concentration of 4 (that is, there are 4 molecules of TGF-β for every molecule of receptor). This value was estimated by simulating the dose dependency of the response (fig. S2) and corresponds to a total number of roughly 15,000 receptor molecules per cell. TGF-β is depleted from the medium through active signaling and also by a constitutive, cell-dependent but signaling-independent TGF-β clearance (k cc ). Parameter values were either taken from previous work (4) or estimated from the data sets presented here. Three parameters, the receptor activation rate k act, the Smad2 phosphorylation rate k p, and the dissociation constant of the receptor inhibitor SB , K SBI, were optimized by curve fitting to the data shown in Fig. 2D of (4) (fig. S7). The fact that these data are derived from GFP-Smad2 overexpressing HaCaT cells 3

5 rather than the parental cell line used in this study does not cause significant differences and does not affect the fitting results. In summary, the comprehensive model presented here is not only consistent with the data sets shown in this manuscript, but also reproduces the data sets shown in (4). S3. Modeling autocrine signaling To simulate TGF-β-dependent autocrine TGF-β production, Equation 5 (table S3) was replaced by 1 24 Where is a small background synthesis rate ( 0.001), and is the rate of TGF-β-dependent synthesis, both expressed relative to k d. The model is available in the Biomodels database ( under the ID MODEL

6 Fig. S1. The refractory period is not unique to HaCaT cells. The mouse fibroblast cell line NIH-3T3, the transformed mouse mammary cell line EpRas, and the human breast cancer cell line MDA-MB-231 were treated for 1 h (b) or 8 h (c) with TGF-β (Tβ), after which cells were re-induced with fresh TGF-β for 1 h (e). Medium was also taken from cells after 8 h of ligand exposure and used to induce naïve cells for 1 h (d). Lysates were assayed by Western blot using antibodies recognizing PSmad2 and Smad2, with Tubulin or MCM6 as a loading control. In the experimental scheme shown, green arrows indicate addition of TGF-β; curved arrow, induction of naïve cells with conditioned media. Quantifications are the normalized average and ranges of two independent experiments. In all cases the amount of PSmad2 after a 1-h TGF-β stimulation was set to 1. 5

7 Fig. S2. Kinetics of Smad2 phosphorylation. Top panels: HaCaT cells were treated with 2 ng/ml or 0.1 ng/ml TGF-β for 60 min, harvesting samples every 10 minutes. PSmad2 was assayed by Western blot. Tubulin was used as a loading control. Representative panels of at least three independent experiments are shown. Bottom panel: Simulation of the amount of PSmad2 in cells treated with 2 ng/ml versus 0.1 ng/ml TGF-β. 6

8 Fig. S3. Blocking and depletion of ligand. (A) The ligand-neutralizing TGF-β antibody can be washed out. HaCaT cells were treated with ligand-neutralizing TGFβ antibody (block) or control antibody for 20 min. Cells were incubated with or without TGF-β for 1 h following washing, as indicated. PSmad2 was assayed by Western blot, using Tubulin as a loading control. (B) Time course of TGF-β depletion by the cells. HaCaT cells were treated with either 0.5 ng/ml or 2 ng/ml TGF-β for the times indicated. At each time point samples of media were taken and assayed in triplicate for TGF-β by ELISA. The values were normalized to the amount of TGF-β in the medium at the zero time point. Quantifications are the averages and standard deviations of triplicates. (C) Cell-dependent depletion of TGF-β. TGF-β was added to tissue culture plates with (+) or without (-) plated HaCaT cells and kept under normal culture conditions for 10 or 30 h (pre-incubation). The conditioned media was then used to induce naïve cells for 1 h. Induction capacity, as measured by ability to induce PSmad2, was assayed by Western blot as shown. Tubulin was used as a loading control. In A and C, representative blots of at least three independent experiments are shown. 7

9 Fig. S4. Specificity of the TβRII antibody in Western blotting. Whole-cell extracts were prepared from HaCaT cells or from T47D cells, which are negative for TβRII (37), and were assayed by Western blotting using antibodies recognizing TβRII and MCM7 as a loading control. Extracts were treated ± PNGase F to remove N-linked sugars. Representative blots of three independent experiments are shown. 8

10 Fig. S5. Recovery from the refractory state. HaCaT cells were either unstimulated (a) or stimulated with TGF-β for 1 h, 24 h, 30 h, 36 h or 48 h (b, c, e, g, i). At the latter four time points, cells were also restimulated with 2 ng/ml TGF-β for 1 h (d, f, h, j). Whole-cell extracts were assayed for PSmad2 and MCM7 by Western blotting. Quantifications are the normalized (relative to loading control) average and standard deviations of three replicates. The amount of PSmad2 after a 1-h TGF-β stimulation was set to 1. 9

11 Fig. S6. Biotinylation of surface receptors in HaCaT cells at different time points. (A) The experiment design was exactly as in Fig. 3D, except that cells were stimulated at time points between 0 and 8 h, or between 0 and 60 min. Quantifications are the normalized average and standard deviations of three independent experiments. (B) The experiment design was exactly as in Fig. 3D, except that cells were stimulated at time points between 0 and 48 h. Quantifications are the normalized average and standard deviations of three independent experiments. (C) Biotinylation of surface receptors in MDA-MB-231 cells. The experiment design was exactly as in Fig. 3D. Quantifications are the normalized average and ranges of two independent experiments. For each experiment, the amount of surface receptor in unstimulated cells was set to 1. 10

12 Fig. S7. Data fitting with previous data sets. The parameter set for the extended model described here fits the set of data used in (4). Nuclear accumulation of Smad2 upon TGF-β stimulation and its clearance from the nucleus upon SB addition is shown, as are the amounts of PSmad2 during a 45-min stimulation with TGF-β. 11

13 Fig. S8. Comparison between simulations and experimental data in Figs. 1 and 2. Lines represent time course simulations, points and bars represent the experimentally determined values +/- their standard deviations or ranges. For a detailed description refer to the corresponding figures (indicated at the top of each graph) in the main text. 12

14 Fig. S9. Comparison between simulations and experimental data in Fig. 3. (A) Time course simulation in cells treated with TGF-β ± cycloheximide (CHX) ± MG-132 or MG-132 followed by SB Left panel, replotting of the simulation shown in Fig. 5E. Right panel, experimental data from Figs 3A and B. (B) Time course of receptor degradation in cells treated with CHX ± TGF-β. Left panel, replotting of parts of the simulation shown in Fig. 5F. Right panel, experimental data for TβRII from Fig. 3C. 13

15 Fig. S10. Restimulation of naïve cancer cell lines with medium from the D3 line. Medium from D3 cells, the cancer cell line with the most autocrine TGF-β production, was added to naïve cancer cell lines and PSmad2 was detected by Western Blot after 1 h. Quantifications are the normalized (relative to the cell line, CN5) average and standard deviations of three independent experiments. 14

16 Table S1. Model parameters. Parameters of the receptor module Value Source receptor degradation 0.32 h -1 estimate from Fig. 3C competent surface receptors in the absence of a signal 0.05 Ref (6) receptor synthesis rate, defined such that in the absence of TGF-β, h -1 1 maturation efficiency 0.08 estimate from Fig. 2C ligand-induced to constitutive degradation ratio 4 estimate from Fig. 1A equilibrium constant for receptor trafficking, defined such that in the absence of TGF-β, TGF-β binding relative to 100 estimate from Fig. 2A receptor activation relative to optimized by data fitting dissociation constant of SB optimized by data fitting Molecules of TGF-β per receptor if TGF-β = 1 ng/ml 2 estimate from fig. S2 constitutive TGF-β clearance relative to 0.35 Parameters of the Smad module Value Source estimate from Fig. 2D and fig. S4B Smad2 phosphorylation rate constant h -1 optimized by data fitting Smad2 dephosphorylation rate constant 23.6 h -1 Ref (4) nuclear import of Smad2 and Smad h -1 Ref (4) nuclear export of Smad2 20 h -1 Ref (4) nuclear export of Smad h -1 Ref (4) on-rate of Smad complex association 350 h -1 Ref (4) off-rate of Smad complex dissociation 60 h -1 Ref (4) % % of Smad2 phosphorylated at t = 0.75 h 0.31 Ref (4) Complex import factor 5.7 Ref (4) cytonucleoplasmic volume ratio 2.27 Ref (4) 15

17 Table S2. List of model species. See table S3 for the equations. Ligand and Receptors Compartment Definition Nascent receptors Cytoplasm Eq. 1 Competent receptors Cytoplasm Eq. 2 1 Competent, intracellular receptors Cytoplasm 1 Competent surface receptors Cytoplasm 1 TGF-β bound receptors, not yet active Cytoplasm Eq. 3 Actively signaling receptors Cytoplasm Eq. 4 TGF-β Cytoplasm Eq. 5 Unphosphorylated Smad2 Compartment Definition 2 Cytoplasmic unphosphorylated Smad2 Cytoplasm Eq. 6 2 Nuclear unphosphorylated Smad2 Nucleus Smad4; sum of free and complexed Compartment Definition 4 Total cytoplasmic Smad4 Cytoplasm Eq. 7 4 Total nuclear Smad4 Nucleus psmad2; sum of free and complexed Compartment Definition 2 Total cellular psmad2 Cell Eq. 8 2 Total cytoplasmic psmad2 Cytoplasm Eq. 9 2 Total nuclear psmad2 Nucleus Smad complexes Compartment Definition 24 Total cellular heteromeric complexes Cell Eq Cytoplasmic heteromeric complexes Cytoplasm Eq Nuclear heteromeric complexes Nucleus Total cellular homomeric complexes Cell Eq Cytoplasmic homomeric complexes Cytoplasm Eq Nuclear homomeric complexes Nucleus Free, monomeric forms of psmad2 and Smad4 Compartment Definition 2 Cytoplasmic monomeric psmad2 Cytoplasm Nuclear monomeric psmad2 Nucleus Cytoplasmic monomeric Smad4 Cytoplasm Nuclear monomeric Smad4 Nucleus

18 Table S3. Ordinary differential equations and initial conditions. Receptor Module Eq. 1 1 Eq. 2 Initial condition Eq Eq Eq. 5./ Smad Module Eq. 6 Initial condition Eq Eq Eq Eq Eq Eq Eq

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/418/ra27/dc1 Supplementary Materials for The adhesion molecule PECAM-1 enhances the TGF- mediated inhibition of T cell function Debra K. Newman,* Guoping Fu,

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation?

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation? Control of Cell Proliferation by Peptide Growth Factors Autocrine Growth Factor Production Causes Malignant Transformation? Transforming Activities From Condition Media from a Tumor Cell Line Condition

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Life Science 1A Final Exam. January 19, 2006

Life Science 1A Final Exam. January 19, 2006 ame: TF: Section Time Life Science 1A Final Exam January 19, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use non-erasable

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,

More information

MCB130 Midterm. GSI s Name:

MCB130 Midterm. GSI s Name: 1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal

More information

Supplementary Material. Contents include:

Supplementary Material. Contents include: Supplementary Material Contents include: 1. Supplementary Figures (p. 2-7) 2. Supplementary Figure Legends (p. 8-9) 3. Supplementary Tables (p. 10-12) 4. Supplementary Table Legends (p. 13) 1 Wellen_FigS1

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information

ab NFĸB p65 (ps536) + Total NFĸB p65 SimpleStep ELISA Kit

ab NFĸB p65 (ps536) + Total NFĸB p65 SimpleStep ELISA Kit ab176663 NFĸB p65 (ps536) + Total NFĸB p65 SimpleStep ELISA Kit Instructions for Use For the semi-quantitative measurement of NFĸB p65 (ps536) and NFĸB p65 (Total) in Human and mouse cell lysates. This

More information

Lecture #15. Energy of transformation of one molecule is ~ktln(p e /S e ) ktln(p e /10S e ) = =ktln10=2.3kt

Lecture #15. Energy of transformation of one molecule is ~ktln(p e /S e ) ktln(p e /10S e ) = =ktln10=2.3kt Lecture #14 Problems 1. If the K d for the actin subunit-subunit interactions along a strand is 0.1 mm and the K d for subunits at the ends of two-stranded filaments is 0.03 mm, then what is the K d for

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Concentration of drug [A]

Concentration of drug [A] Pharmacology Semester 1 page 1 of 5 PHARMACODYNAMICS 1 Receptor occupancy - mass action The interaction of a drug with a receptor is reversible due to interactions via weak bonds (not covalent). [A] +

More information

1. Immediate 2. Delayed 3. Cumulative

1. Immediate 2. Delayed 3. Cumulative 1 Pharmacodynamic Principles and the Time Course of Delayed Drug Effects Nick Holford Dept Pharmacology & Clinical Pharmacology University of Auckland, New Zealand The time course of drug action combines

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of rat TNF-alpha concentrations in cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

The Need for a PARP in vivo Pharmacodynamic Assay

The Need for a PARP in vivo Pharmacodynamic Assay The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D. Chief Scientific Officer Trevigen, Inc. Gaithersburg, MD Poly(ADP-ribose) polymerases are promising therapeutic targets. In response

More information

STAT1 (ps727) (Human/Mouse) ELISA Kit

STAT1 (ps727) (Human/Mouse) ELISA Kit STAT1 (ps727) (Human/Mouse) ELISA Kit Catalog Number KA2171 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT1 (ps727) (Human/Mouse) ELISA (Enzyme-Linked Immunosorbent

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...

More information

The Adaptive Immune Responses

The Adaptive Immune Responses The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start

More information

HORMONES (Biomedical Importance)

HORMONES (Biomedical Importance) hormones HORMONES (Biomedical Importance) Hormones are the chemical messengers of the body. They are defined as organic substances secreted into blood stream to control the metabolic and biological activities.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Chapter 11: Cell Communication

Chapter 11: Cell Communication Name Period Chapter 11: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication

More information

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The

More information

Pharmacodynamics. Dr. Alia Shatanawi

Pharmacodynamics. Dr. Alia Shatanawi Pharmacodynamics Dr. Alia Shatanawi Drug Receptor Interactions Sep-17 Dose response relationships Graduate dose-response relations As the dose administrated to single subject or isolated tissue is increased,

More information

Enzymes. Enzymes : are protein catalysts that increase the rate of reactions without being changed in the overall process.

Enzymes. Enzymes : are protein catalysts that increase the rate of reactions without being changed in the overall process. Enzymes Enzymes Enzymes : are protein catalysts that increase the rate of reactions without being changed in the overall process. All reactions in the body are mediated by enzymes A + B E C A, B: substrate

More information

Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics

Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics Introduction: Prostate-specific antigen (PSA) is a serine protease produced in the prostate and secreted into ejaculate and blood.

More information

Exo-Glow TM Exosome Labeling Kits

Exo-Glow TM Exosome Labeling Kits Exo-Glow TM Exosome Labeling Kits Cat# EXOR100A-1 Cat# EXOG200A-1 Cat# EXOC300A-1 User Manual Store kit at -20 o C on receipt Version 8 3/10/2017 A limited-use label license covers this product. By use

More information

Exam 3 Fall 2015 Dr. Stone 8:00. V max = k cat x E t. ΔG = -RT lnk eq K m + [S]

Exam 3 Fall 2015 Dr. Stone 8:00. V max = k cat x E t. ΔG = -RT lnk eq K m + [S] Exam 3 Fall 2015 Dr. Stone 8:00 Name There are 106 possible points (6 bonus points) on this exam. There are 8 pages. v o = V max x [S] k cat = kt e - ΔG /RT V max = k cat x E t ΔG = -RT lnk eq K m + [S]

More information

It is all in the enzymes

It is all in the enzymes Enzyme regulation 1 It is all in the enzymes Enzymes can enhance the rates of metabolic (or other) reactions by many orders of magnitude. A rate enhancement of 10 17 means that what would occur in 1 second

More information

Cell-mediated Immunity

Cell-mediated Immunity Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

PHARMACOKINETICS OF DRUG ABSORPTION

PHARMACOKINETICS OF DRUG ABSORPTION Print Close Window Note: Large images and tables on this page may necessitate printing in landscape mode. Applied Biopharmaceutics & Pharmacokinetics > Chapter 7. Pharmacokinetics of Oral Absorption >

More information

Systems theory of Smad signalling

Systems theory of Smad signalling This paper is a preprint of a paper accepted by IEE Proceedings, Systems Biology and is subject to IEE Copyright. When the final version is published, the copy of record will be available at IEE Digital

More information

Summary of Endomembrane-system

Summary of Endomembrane-system Summary of Endomembrane-system 1. Endomembrane System: The structural and functional relationship organelles including ER,Golgi complex, lysosome, endosomes, secretory vesicles. 2. Membrane-bound structures

More information

The MOLECULES of LIFE

The MOLECULES of LIFE The MOLECULES of LIFE Physical and Chemical Principles Solutions Manual Prepared by James Fraser and Samuel Leachman Chapter 16 Principles of Enzyme Catalysis Problems True/False and Multiple Choice 1.

More information

Delayed Drug Effects. Distribution to Effect Site. Physiological Intermediate

Delayed Drug Effects. Distribution to Effect Site. Physiological Intermediate 1 Pharmacodynamics Delayed Drug Effects In reality all drug effects are delayed in relation to plasma drug concentrations. Some drug actions e.g. anti-thrombin III binding and inhibition of Factor Xa by

More information

Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS

Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS In Physiology Today Cell Communication Homeostatic mechanisms maintain a normal balance of the body s internal environment

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit]

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit] MANUAL IL-1alpha (mouse) ELISA Kit [Interleukin-1 alpha (mouse) ELISA Kit] For research use only. Not for diagnostic use Version 1 (March-5-2013) Cat. No. AG-45B-0003-KI01 www.adipogen.com Table of Contents

More information

Quantitative modeling and analysis of the transforming growth factor β signaling pathway

Quantitative modeling and analysis of the transforming growth factor β signaling pathway Quantitatie modeling and analysis of the transforming growth factor β signaling pathway Seung-Wook hung, Fayth L. Miles, arlton R. ooper, Mary. Farach-arson, and Babatunde A. Ogunnaike Uniersity of Delaware,

More information

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit 2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as

More information

Applications of Freezing Point Osmometry

Applications of Freezing Point Osmometry Applications of Freezing Point Osmometry Table of Contents Chapter 1 Introduction and Basic Principles 1 Chapter 2 Biological Applications 3 2.1 Range of, and reason for, abnormal serum values 5 2.2 Osmolality

More information

REGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25

REGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25 REGULATION OF ENZYME ACTIVITY Medical Biochemistry, Lecture 25 Lecture 25, Outline General properties of enzyme regulation Regulation of enzyme concentrations Allosteric enzymes and feedback inhibition

More information

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked

More information

MODELING GLUCOSE-INSULIN METABOLIC SYSTEM AND INSULIN SECRETORY ULTRADIAN OSCILLATIONS WITH EXPLICIT TIME DELAYS. Yang Kuang

MODELING GLUCOSE-INSULIN METABOLIC SYSTEM AND INSULIN SECRETORY ULTRADIAN OSCILLATIONS WITH EXPLICIT TIME DELAYS. Yang Kuang MODELING GLUCOSE-INSULIN METABOLIC SYSTEM AND INSULIN SECRETORY ULTRADIAN OSCILLATIONS WITH EXPLICIT TIME DELAYS Yang Kuang (joint work with Jiaxu Li and Clinton C. Mason) Department of Mathematics and

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Biol220 Cell Signalling Cyclic AMP the classical secondary messenger

Biol220 Cell Signalling Cyclic AMP the classical secondary messenger Biol220 Cell Signalling Cyclic AMP the classical secondary messenger The classical secondary messenger model of intracellular signalling A cell surface receptor binds the signal molecule (the primary

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20

More information

Total Thyroxine ELISA (T4)

Total Thyroxine ELISA (T4) Design Verification Total Thyroxine ELISA (T4) Contents 1 Assay Principle... 2 2 Imprecision... 2 Within-run Imprecision... 2 Between run Imprecision... 2 3 Comparison of Methods, Accuracy... 2 4 Linearity...

More information

C OBJECTIVES. Basic Pharmacokinetics LESSON. After completing Lesson 2, you should be able to:

C OBJECTIVES. Basic Pharmacokinetics LESSON. After completing Lesson 2, you should be able to: LESSON 2 Basic Pharmacokinetics C OBJECTIVES After completing Lesson 2, you should be able to: 1. Define the concept of apparent volume of distribution and use an appropriate mathematical equation to calculate

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

LH (Bovine) ELISA Kit

LH (Bovine) ELISA Kit LH (Bovine) ELISA Kit Catalog Number KA2280 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...

More information

One-Compartment Open Model: Intravenous Bolus Administration:

One-Compartment Open Model: Intravenous Bolus Administration: One-Compartment Open Model: Intravenous Bolus Administration: Introduction The most common and most desirable route of drug administration is orally by mouth using tablets, capsules, or oral solutions.

More information

Distinct mechanisms of TGF-b1 mediated epithelial-to-mesenchymal transition and metastasis during skin carcinogenesis

Distinct mechanisms of TGF-b1 mediated epithelial-to-mesenchymal transition and metastasis during skin carcinogenesis Distinct mechanisms of TGF-b1 mediated epithelial-to-mesenchymal transition and metastasis during skin carcinogenesis Gangwen Han,, Molly Kulesz-Martin, Xiao-Jing Wang J Clin Invest. 2005;115(7):1714-1723.

More information

ISSN Article

ISSN Article Metabolites 2015, 5, 766-793; doi:10.3390/metabo5040766 OPEN ACCESS metabolites ISSN 2218-1989 www.mdpi.com/journal/metabolites Article Quasi-Steady-State Analysis based on Structural Modules and Timed

More information

Extended Mammosphere Culture of Human Breast Cancer Cells

Extended Mammosphere Culture of Human Breast Cancer Cells Extended Mammosphere Culture of Human Breast Cancer Cells Application Note The PromoCell 3D Tumorsphere Medium XF The PromoCell 3D Tumorsphere Medium XF has been designed to meet your requirements for

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

EXOCET Exosome Quantitation Assay

EXOCET Exosome Quantitation Assay EXOCET Exosome Quantitation Assay EXOCET96A-1 User Manual Check Package Contents for Storage Temperatures Version 3 5/30/2017 A limited-use label license covers this product. By use of this product, you

More information

decarboxylation. Further work with the enzyme systems involved has shown

decarboxylation. Further work with the enzyme systems involved has shown THE BACTERIAL OXIDATION OF AROMATIC COMPOUNDS IV. STITDIES ON THE MECHANISM OF ENZYMATC DEGRADATION OF PROTOCATECHuiC ACID' R. Y. STANIER Department of Bacteriology, University of California, Berkeley,

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

R/G editing in GluA2R flop modulates the functional difference between GluA1 flip and flop variants in GluA1/2R heteromeric channels

R/G editing in GluA2R flop modulates the functional difference between GluA1 flip and flop variants in GluA1/2R heteromeric channels www.nature.com/scientificreports Received: 25 April 2017 Accepted: 20 September 2017 Published: xx xx xxxx OPEN R/G editing in GluA2R flop modulates the functional difference between GluA1 flip and flop

More information

Chapter 15 Homework Assignment

Chapter 15 Homework Assignment Chapter 15 Homework Assignment The following problems will be due once we finish the chapter: 3, 5, 6, 8, 9 Chapter 15 1 Regulation of Metabolic Pathways Dynamic Steady State Fuels, such as glucose, enter

More information

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and Supplementary Materials Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS Daryl A. Bosco, Gerardo Morfini, Murat Karabacak, Yuyu Song, Francois Gros-Louis,

More information

An Insulin Model. James K. Peterson. June 14, Department of Biological Sciences and Department of Mathematical Sciences Clemson University

An Insulin Model. James K. Peterson. June 14, Department of Biological Sciences and Department of Mathematical Sciences Clemson University An Insulin Model James K. Peterson Department of Biological Sciences and Department of Mathematical Sciences Clemson University June 14, 2017 Outline 1 The Background for the Diabetes Model 2 The Diabetes

More information

Alternative Splicing and Genomic Stability

Alternative Splicing and Genomic Stability Alternative Splicing and Genomic Stability Kevin Cahill cahill@unm.edu http://dna.phys.unm.edu/ Abstract In a cell that uses alternative splicing, the total length of all the exons is far less than in

More information

Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator

Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator INCUCYTE LIVE-CELL ANALYSIS SYSTEM Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator See what your cells are doing and when they

More information

Pharmacokinetics of drug infusions

Pharmacokinetics of drug infusions SA Hill MA PhD FRCA Key points The i.v. route provides the most predictable plasma concentrations. Pharmacodynamic effects of a drug are related to plasma concentration. Both plasma and effect compartments

More information

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,

More information

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay

More information

IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015

IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015 IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015 IL-2 Production in mouse splenocytes INTRODUCTION Interleukin-2, or IL-2, is a potent cytokine produced by T-cells, stimulating their proliferation. As

More information

Chapter 13: Cytokines

Chapter 13: Cytokines Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or

More information

RayBio Human ENA-78 ELISA Kit

RayBio Human ENA-78 ELISA Kit RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

The DNA -> RNA -> Protein Pathway

The DNA -> RNA -> Protein Pathway The DNA -> RNA -> Protein Pathway RNA Polymerase = enzyme that makes mrna from the DNA gene template http://www.bioteach.ubc.ca/molecularbiology/amonksflourishinggarden/ Plus-strand RNA Viruses Plus-strand

More information

Mitosis Notes AP Biology Mrs. Laux

Mitosis Notes AP Biology Mrs. Laux I. Cell Cycle-includes interphase and mitosis (IPPMAT) A. Interphase 1. accounts for 90% of the cycle 2. cell grows and copies its chromosomes in preparation for cell division 3. produces proteins and

More information

ab Human GFAP SimpleStep ELISA Kit

ab Human GFAP SimpleStep ELISA Kit Version 1 Last updated 14 August 2017 ab223867 Human GFAP SimpleStep ELISA Kit For the quantitative measurement of GFAP in tissue extracts and cell extracts This product is for research use only and is

More information