A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. 1kb. pa 1 pa 2 wildtype allele 11kb. S/pA. loxp.

Transcription

1 1 Nture Pulishing Group A mouse Mep2-null muttion uses neurologil symptoms tht mimi Rett synrome Jky Guy 1, rin Henrih 1, Megn Holmes 2, Jonne E. Mrtin 3 & Arin ir 1 1 Nture Pulishing Group genomi lous trgeting vetor trgete lous reomine lous 1.2k 3 proe k rin kiney liver Rett synrome (RTT) is n inherite neuroevelopmentl isorer of femles tht ours one in 1, 1, irths 1,2. Affete femles evelop normlly for 6 18 months, ut then lose voluntry movements, inluing speeh n hn skills. Most RTT ptients re heterozygous for muttions in the X- linke gene MECP2 (refs. 3 12), enoing protein tht ins to methylte sites in genomi DNA n filittes gene silening Previous work with Mep2-null emryoni stem ells inite tht MeCP2 is essentil for mouse emryogenesis 18. Here we generte mie lking Mep2 using Cre- tehnology. oth Mep2-null mie n mie in whih Mep2 ws elete in rin showe severe neurologil symptoms t pproximtely six weeks of ge. Compenstion for sene of MeCP2 in other tissues y MeCP1 (refs. 19,) ws not pprent in geneti or iohemil tests. After severl months, heterozygous femle mie lso showe ehviorl symptoms. The overlpping ely efore symptom onset in humns n mie, espite their profounly ifferent rtes of evelopment, rises the possiility tht stility of rin funtion, not rin evelopment per se, is ompromise y the sene of MeCP2. Previous ttempts to rete Mep2-null mie 1k pa 1 pa 2 wiltype llele 11k S/pA S/pA N N pa 1 pa 2 floxe llele 8.2k 4 pa 2 A elete llele 1.2k 83 kd using Mep2 ES ells were unsuessful 18. To irumvent the prolem of emryoni lethlity, we reple exons 3 n 4 of Mep2 in ES ells with the sme exons flnke y sites 21 (Fig. 1). Mie homozygous or hemizygous for the replement were vile n fertile. Northern lots showe the expete mture trnsript from the Mep2 lox lous (2. k) plus trnsript in whih the β-gloin intron ws unsplie (3.3 k; Fig. 1). Erly emryoni eletion of the gene ws hieve y rossing Mep2 lox/lox femles with eleter mie, whih express Cre uiquitously 22. Southern lots showe tht reomintion etween sites h ourre in ll femle offspring rrying the eleter trnsgene n the Mep2 lox llele (Fig. 1), leing to eletion of ll ut the mino-terminl eight mino is of MeCP2. When Mep2 femles were mte with wil-type C7L/6 mles, equl numers of wil-type n f f f m m m e wil type 11k floxe 8.2k elete 1.2k C D S26 m m f f f m m m Fig. 1 Disruption of mouse Mep2 using Cre- tehnology., Mps of the genomi lous, trgeting vetor, trgete lous n reomine lous fter exposure to Cre., Northern-lot nlysis of RNA from rin, kiney n liver of wiltype mle (), floxe mle (), Mep2-null mle (), wil-type femle () n femle heterozygous for the null llele () proe with 3.2-k NoI frgment inluing exons 3 n 4 of Mep2. ns A (1 k) n D (2 k) re seen in wil-type tissue, wheres ns (3.3 k) n C (2. k) re ue to trnsription of the floxe Mep2 llele. No Mep2 mrna is etete in the null mles. Equl loing of RNA is emonstrte y hyriiztion of the sme lot to n S26 riosoml protein mrna proe., Western lots of rin protein from wil-type, floxe n null mie. No MeCP2 protein is etete in Mep2-null rin., Southern lots of DNA from tils of single litter erive from ross etween Mep2 lox/lox femle n mle rrying the X-linke eleter trnsgene. Femles, ut not mles, hve elete the floxe llele in til ells s expete. e, Southern-lot nlysis of til DNA from mie orn to ross etween n Mep2 femle n wil-type mle. Hlf of mles re expete to e Mep2. 1 Wellome Centre for Cell iology, Institute of Cell n Moleulr iology, University of Einurgh, The King s uilings, Einurgh, UK. 2 Deprtment of Clinil Neurosienes, Moleulr Meiine Centre, University of Einurgh, Western Generl Hospitl, Einurgh, UK. 3 St rtholomews n the Royl Lonon Shool of Meiine n Dentistry, Queen Mry n Westfiel College, The Institute of Pthology, The Royl Lonon Hospitl, Whitehpel, Lonon, UK. Corresponene shoul e resse to A.. (e-mil:.ir@e..uk). 322 nture genetis volume 27 mrh 1

2 1 Nture Pulishing Group 1 Nture Pulishing Group nimls (%) # # # # KO Mep2 mles were orn (Fig. 1e). No Mep2 mrna or protein ws etete in tissues from Mep2 mie (Fig. 1,). We otine Mep2 / femles y rossing Mep2, eleter femles with Mep2 mles (t not shown). The viility of Mep2-null nimls proves tht sene of MeCP2 oes not use emryoni lethlity in mie, ontrry to previous onlusion 18. The inviility of himeri emryos ontining Mep2-null ES ells seen previously my e ue to verse effets of the inserte lz trnsgene on linke genes, or to epigeneti hnges tht reue pluripoteny rising uring ES prolifertion in the sene of MeCP2. Mep2-null mle n femle mie showe no initil phenotype, ut oth evelope stiff, unoorinte git n reue spontneous movement etween three n eight weeks of ge (Fig. 2). Most nimls susequently evelope hinlim lsping (Fig. 2) n irregulr rething. Uneven wering of the teeth n mislignment of the jws ws lso frequent. Testes of Mep2-null mles were lwys internl. Neither motor efets nor sensory efets were etete, ut some ffete nimls file to respon to soun. Pthologil nlysis of symptomti nimls revele no ovious histologil normlities in rnge of orgns. In prtiulr, the rin showe no unusul fetures of ortil lmintion, etopis or other normlities (Fig. 2). Vrile progression of symptoms le ultimtely to rpi weight loss n eth t pproximtely 4 ys (Fig. 2). A istint feture of the phenotype ws vrying oy weight, whih ws epenent on geneti kgroun. The Mep2-null muttion on C7L/6 kgroun gve rise to nimls tht were sustntilly unerweight from four weeks with full penetrne (Fig. 3 ). After rossing to 129 strin, however, F1 nimls showe reverse effet. Inste of losing weight, Mep2 mie were the sme weight s wil-type littermtes until eight weeks, when survivors eme signifintly hevier thn silings (Fig. 3) with n ovious inrese in eposite ft. Other spets of the phenotype, inluing ehviorl efets, were not ffete y ltere geneti kgroun. These t inite the presene of one or more moifier genes tht meite the effets of MeCP2 on oy weight. ko symptom free, n=22 wt symptom free, n=12 ko survivl, n=3 wt survivl,, n=12 # ( / ) femle 6/129 mle WT ffete nimls (%) (63) (63) (63) (9) mle mle mle (4) (46) (41) (28) () (13) (1) ge (months) Fig. 2 Phenotypes of mie with the Mep2-null muttion., Cumultive plot showing perentge of wil-type (open symols) n hemizygous or homozygous Mep2-null nimls (fille symols) tht survive (tringles) or remine free of ovious neurologil symptoms (irles) with inresing time. Most t onerns Mep2 mles on C7L/6 kgroun, ut the timings for Mep2 mles rosse with 129 mie () n for Mep2 / femles (#) re highlighte., Delye onset hin lim lsping in Mep2 mles. The left n mile pnels show norml spreing of hinlims in wil-type n six-week mutnt mles, respetively. Right, lim-lsping phenotype in mutnt mle ge 7 weeks., Setions showing histology of ererl ortex of 1-week Mep2 mouse with pronoune neurologil symptoms (KO) n n ge-mthe wil-type ontrol (WT) stine with hemtoxylin n eosin. Sle r, µm., Histogrm showing frtion of femle mie heterozygous for the Mep2-null muttion tht exhiit neurologil symptoms in ifferent ge groups (numer in group shown in rkets). Mep2 is expresse in mny mouse tissues, ut the phenotype of Mep2-null mie suggests neurologil efets. To test whether the effets of MeCP2 loss re speifi to rin, the muttion ws omine with the nestin-cre trnsgene 23, whih is highly expresse in neuronl n glil ells. Southern lots onfirme tht Mep2 lox ws pproximtely 6% elete in rin (8% in ereellum), ut 1% elete or less in other somti tissues (Fig. 3e). The phenotype of mie with extensive eletion of Mep2 in rin ws inisinguishle from tht of Mep2-null mie. The low frequeny of Mep2 eletion in non-rin tissues is unlikely to ontriute to the phenotype, s Mep2 femles re mosi for Mep2 expression ue to X-hromosome intivtion, yet show no phenotype t this ge. These t inite tht the mjor fetures of the Mep2-null phenotype, inluing reue movement, norml git, lim lsping, low weight (Fig. 3f), internl testes, uneven wering of teeth n lethlity, re proly ue to sene of MeCP2 in neuronl n/or glil ells. The rin-speifi effets of Mep2 eletion my e ue to ompenstion for lk of MeCP2 in other tissues y ifferent methyl-cpg ining repressor. M2 is omponent of the MeCP1 histone eetylse omplex, whih lso represses trnsription. As M2 / mie re vile n fertile 24, we teste for possile intertion etween MeCP2 n M2 y omining the Mep2-null n M2-null muttions. Doule-mutnt nimls showe the sme onset of symptoms n mortlity s single-mutnt Mep2-null mie, proviing no eviene for geneti intertion etween Mep2 n M2 (Fig. 4). We further nlyse repression of methylte reporter genes in til firolst ell lines from wil-type mie n mie lking Mep2, M2, or oth. Repression ws only mrginlly reue in Mep2 ells ( % of the non-methylte ontrol) ompre with wil-type ells ( 2%; Fig. 4). M2 / ells, in ontrst, represse methylte reporter genes ineffiiently ( 3% of non-methylte ontrol 24 ), ut this inomplete repression ws unltere in oule-mutnt M2 /, Mep2 ells. y these ssys, therefore, methyl-cpg epenent repression in til firolsts is ue to M2, n MeCP2 hs miniml role. Expression of exogenous MeCP2 i, however, restore full repression to M2 / ells, emonstrting tht nture genetis volume 27 mrh 1 323

3 1 Nture Pulishing Group 1 Nture Pulishing Group e wil type knokout not genotype MeCP2 n t s methyl-cpg epenent repressor in this system (Fig. 4). The omine geneti n iohemil results inite tht M2 n MeCP2 funtion in inepenent pthwys. It remins possile tht nother methyl-cpg ining repressor (for exmple, M1; refs.,26) might ompenste for sene of MeCP2. Although Mep2 femle mie initilly showe no symptoms n rise norml litters, they quire the inerti n hinlim lsping phenotypes t ges greter thn three months (Fig. 2). y nine months of ge, out one-hlf of the heterozygous mie showe unmiguous symptoms, often inluing rething irregulrities, ut some remine symptomti t one yer. The r Ce Th He Lu Li Sp Ki Sv Te Sk T het 67 8 <2 6 3 <2 <2 1 <2 () wt 11k lox 8.2k ko 1.2k % re f / nestin re (6) Fig. 3 Effets of Mep2 eletion on oy weight., oy weight from irth of iniviul mles from single litter. Mep2- null mles re signifintly smller thn wil-type littermtes from roun wening ( 3 weeks of ge).,, oy weight from wening of two ifferent litters on C7L/6 (6) kgroun, showing reue weight of Mep2-null nimls (open symols) ompre with wil-type littermtes (fille symols)., oy weight of Mep2 (open symols) n wil-type (fille symols) littermtes on C7L/6 129 F1 kgroun. The two mutnt nimls (of 4 in the litter) surviving eyon 7 weeks gine weight reltive to littermtes. e, Southernlot nlysis of tissue DNA from mle mouse ontining the nestin-cre trnsgene n the floxe llele of Mep2. The proportion of reomintion in eh tissue is lirte y omprison with n intensities in DNA from heterozygote for the wiltype n null lleles (het), where the rtio is known to e 1:1. The tissues teste re rin (minus ereellum) (r), ereellum (Ce), thymus (Th), hert (He), lung (Lu), liver (Li), spleen (Sp), kiney (Ki), seminl vesiles (Sv), testis (Te), skeletl musle (Sk) n til (T). Perentge of hromosomes elete is shown elow eh lne. f, oy weight from wening of C7L/6 Mep2 mles (open symols) rrying nestin-cre trnsgene tht uses eletion of Mep2 preominntly in rin (e) ompre with wil-type littermtes (fille symols). Reue weight like tht seen for Mep2 mles is pprent, initing neurologil origin for this omponent of the phenotype. f, Animls ying nturlly () n those srifie for experimentl resons () re inite. overlpping ely seen in mie n humns efore onset of the effets of Mep2 muttion is unexpete given the ifferent timing of their evelopmentl progrmmes. The moility of ffete nimls ws quntifie using n open fiel test 27. Symptomti heterozygotes visite fewer squres, spent more time eing immoile n rere less thn ge-mthe wil-type ontrols (Tle 1). This ws not ue to heightene nxiety, s fel olus ounts, grooming times n time spent in ifferent zones of the fiel were similr to those of ontrols. Unlike Mep2-null nimls, heterozygotes i not unergo rpi eteriortion, rising the possiility tht the Mep2 onition n, like RTT, exhiit long-term stility. Fig. 4 Asene of ovious geneti or iohemil intertions etween 3 MeCP2 n the methyl-cpg ining 1 Wt repressor M2., Cumultive plot Mep2 ko survivl (n =1) ompring perentge of Mep2 3 M2/Mep2 ko survivl (n =18) Mep2 ko 8 (open symols) n Mep2 Mep2 ko symptom free (n =8), M2 ko M2 / M2/Mep2 ko symptom free (n =9) oule-mutnt nimls M2/Mep2 ko (fille symols) tht survive (tringles) 6 or remine free of neurologi- l symptoms (irles) with 4 inresing time. The profiles for the 1 two genotypes were etermine in prllel using littermtes on C7L/6 129 kgroun (6/129) n re inepenent of the t 1 shown in Fig. 2., Repression of methylte reporter onstrut ontining the pgl2 promoter reltive MeCP2 to the sme reporter unmethylte, is only slightly less effiient in Mep2 ells thn in wil-type ells. Reltive repression is signifintly less effiient in M2 / ells n this effiieny is not reue in oule-mutnt Mep2, M2 / ells. Co-trnsfetion with n MeCP2 expression onstrut (right) restores repression of the methylte reporter gene. nimls (%) reltive expression (%) 324 nture genetis volume 27 mrh 1

4 1 Nture Pulishing Group 1 Nture Pulishing Group The results of this n the ompnying pper 28 show tht mie with the Mep2-null muttion re vli moel for humn RTT, s elye onset of neurologil risis ffeting git, posture, rething n spontneous movement is seen in oth onitions. These t support the view tht RTT is primrily neurologil isese, ut in other respets they hllenge urrent pereptions of this onition. First, it hs een thought tht RTT is use y muttions tht impir the funtion of MeCP2, ut o not intivte it. Avne mouse evelopment in the sene of MeCP2, plus eviene tht ertin humn MECP2 muttions pprently olish the funtion of the protein 29,3, rgue tht mny RTT ptients my e heterozygous for wht re effetively null muttions in MECP2. A seon unexpete fining is tht the solute time of onset of symptoms overlps in humn n mouse MECP2 heterozygotes. This pproximte orresponene in rel time, not evelopmentl time, rgues ginst evelopmentl efet ue to MeCP2 efiieny, s this woul rise muh erlier in rpily eveloping mie. An lterntive hypothesis is tht neurogenesis n e omplishe in the sene of MeCP2, ut tht the resulting rin ells, whether humn or mouse, re funtionlly unstle. rin funtion in MECP2-null mles of either speies my therefore eline steeply, leing to erly symptoms n eth. Heterozygous femles, on the other hn, hve mny rin ells tht express wil-type MeCP2 n woul therefore tke longer to reh the level of rin ell ysfuntion t whih neurologil symptoms pper. Methos Conitionl gene trgeting onstrut. The trgeting vetor ws esigne to flnk the oing sequenes in exons 3 n 4 (ll ut the first 8 of the protein) with sites, lso ing n itionl intron n polyenyltion signl from the humn β-gloin gene n neomyin resistne gene for seletion of trnsfete ES ells. The trgeting vetor ws onstrute using 7.2-k mhi genomi frgment sulone in psiiks+ from 4-k 129 mouse osmi. The 3 mhi site is present in the mouse genome, with the site oming from the osmi polylinker. The site n ignosti restrition sites were inserte into n NoI site in intron 2 using oligonuleoties. A seon NoI site in the 3 UTR ws use to insert 2.8- k mhi-xi frgment ontining intron 2 n the polyenyltion signl of humn β-gloin, followe y 1.2 k TK-neo ssette flnke y sites ( floxe ; gift from A. Smith). This resulte in trgeting vetor with 2.8 k of homology, 1.2 k of 3 homology n 3.2-k floxe segment. The vetor ws linerize for trnsfetion t the 3 en using XhoI. ES ell ulture n gene trgeting. We rrie out gene trgeting in the ES ell line E14 TG2 (A. Smith) whih is erive from the mouse sustrin 129/Ol. Cells were grown on geltinize ishes without feeer ells in the presene of reominnt humn LIF ( gift from A. Smith) in Glsgow MEM (Life Tehnologies) supplemente with 1% fetl ovine serum (Gloephrm), 1 MEM non-essentil mino is, soium pyruvte (1 mm), β-merptoethnol ( µm; ll Life Tehnologies). ES ells ( 1 7 ells) were trnsfete with the linerize trgeting vetor ( µg DNA in.8 ml HEPES uffere sline) y eletroportion (8 V, 3 µf, ior Gene Pulser) n plte in 1-m ishes t 1 6 ells per ish. Corretly trgete lones were ientifie y Southern-lot nlysis. For trgeting t the 3 en, ES-ell DNA ws igeste with mhi n the lots proe with 1.2-k NoI mhi frgment. The 11-k wil-type n ws reple in trgete lones y 8.2-k n from the floxe llele. To hek Tle 1 Performne of wil-type n Mep2 femles in open fiel testing Wil type Heterozygote P= Numer of nimls 7 11 Totl no. squres visite 139 (16) 73 (14).87 % Squres visite outer 8.8 (2.7) 8.4 (4.3) NS mile 14.6 (2.3) 1.4 (4.1) NS inner 4. (.8) 4.3 (1.4) NS Numer of rers 1.9 (4.4) 4.3 (1.3).78 Numer of fel oli 2.7 (.8) 3.6 (.) NS Time spent grooming (s) 14. (2.8) 9.2 (1.9) NS Time spent immoile (s) 27.9 (.2) 9.3 (18.2).172 Men vlues re shown followe y the stnr error of the men in rkets. Vlues for wil-type n heterozygous femles were ompre using n unpire t-test. Where signifint ifferene ws foun t the 9% onfiene level, the P vlue is shown. NS inites 'not signifint'. The squres of the open fiel pprtus were lssifie s outer, mile or inner. for the presene of the site, the sme mhi-igeste DNA ws proe with.9-k XI-NoI frgment. The wil-type llele gve n 11-k n, the trgete gene without site, 1-k n, n the trgete gene with site, 6.8-k n. Genertion n reeing of himeri mie. Corretly trgete ES ell lones for injetion into lstoysts were pssge the y efore injetion n injete into lstoysts from nturlly mte C7L/6 femles t 3. ys post oitum. Injetions were performe in M2 meium (Sigm) with 1 1 ES ells eing injete into eh lstoyst efore trnsfer to pseuopregnnt reipient femles (6 12 lstoysts per reipient). Chimeri pups were ientifie y their gouti ot olor n, on mturity, were mte with C7L/6 mie. As Mep2 is X-linke, ll gouti F1 femles were heterozygous for the floxe llele, n this ws onfirme y Southern lot. We rosse heterozygous femles with wil-type C7L/6 mles (F2 genertion). Resulting hemizygous mles were rosse to heterozygous femles to generte homozygous femles (F3) n the line ws then mintine in the homo/hemizygous stte. Cre-expressing mie n eletion of Mep2. We otine eleter mie 22, whih rry uiquitously expresse Cre trnsgene on the X hromosome. Mle eleter mie were rosse with homozygous floxe femles. All femle pups were Mep2 n hemizygous for re. All mle pups were hemizygous for the Mep2 lox llele. Mep2 femles were rosse with wil-type C7L/6 mles to give Mep2 or Mep2 femles n Mep2 or Mep2 mles. The three Mep2 lleles were ientifie y Southern-lot nlysis y igesting with mhi n proing with the 1.2- k NoI-mHI 3 proe (Mep2 +, 11 k; Mep2 lox, 8.2 k; Mep2, 1.2 k). Heterozygous nestin-cre mles 23 were rosse with Mep2 lox/lox femles to generte mles tht h Mep2 elete in neurl n glil ells. Animls rrying the nestin-cre trnsgene were ientifie y PCR on til genomi DNA (forwr primer CreF, GACCGTACACCAAAATTTGCCTG 3 ; reverse primer CreR, TTACGTATATCCTGGCAGCGATC 3 ; min t 94 C, 3 yles of 3 s t 94 C, 3 s t 64 C, 4 s t 72 C, followe y min t 72 C. The 46-p prout ws visulize y running on 1.% TAE grose gel. Vrious tissues were use to mke genomi DNA, whih ws igeste with mhi, Southern lotte n proe with the NoI- mhi 3 Mep2 proe. The extent of eletion in eh tissue ws quntifie using ImgeQunt softwre (Moleulr Dynmis), orreting for kgroun n higher intensity signl from the smller, elete llele. Southern-, northern- n western-lot nlysis. Genomi DNA ws prepre from ES ell lones n til tips y stnr proeures. RNA ws prepre from mouse tissues using TriRegent (Sigm) following homogeniztion in n UltrTurrx homogenizer. RNA ws me from the lystes oring to the mnufturer s protool. Southern n northern lots were prepre y stnr proeures. Riotive proe ws etete using PhosphoImger (Moleulr Dynmis) n quntitte using ImgeQunt softwre. We rrie out western-lot nlysis on totl rin extrts from wil-type, floxe n mutnt mie. rins were ollete in ol PS n trnsfere to ol Lemmli smple uffer without SDS (6 mm Tris Cl, ph 6.8, 1 mm DTT, 1% glyerol). The tissue ws then homogenize using n UltrTurrx on high spee for 1 s efore ing SDS to 2%. Lystes were sonite riefly, oile for min n entrifuge for 1 min t 13, r.p.m. Super- nture genetis volume 27 mrh 1 3

5 1 Nture Pulishing Group 1 Nture Pulishing Group ntnt liquots were run on 12.% SDS PAGE gels with 1 µg protein per lne. Western lots with nti-mecp2 rit polylonl ntioy (Upstte ioteh) were rrie out oring to the mnufturer s instrutions n visulize on Hyperfilm using the ECL system (Amershm). Trnsient trnsfetion ssys. We use til firolsts with the following four genotypes: Mep2,M2 ; Mep2,M2 ; Mep2,M2 / ; n Mep2,M2 /. M2 / ells were otine s esrie 24. Mep2 ells were otine y immortlizing til firolsts from Mep2 mles on either n M2 or M2 / kgroun n susequently trnsfeting with CMVre trnsgene. Cell lones tht h elete Mep2 were then selete. Cells were grown to pproximtely % onfluene n trnsfete using Lipofetmine oring to the mnufturer's instrutions (Life Tehnologies). Eh well of 6-well plte ws trnsfete with 2 µg of either M.SssI methylte or unmethylte pgl2-promoter plsmi plus prl-sv4 ontrol plsmi ( ng; Promeg). Where neessry, CMV-Mep2 expression onstrut (1 ng) ws o-trnsfete. Luiferse levels were mesure fter 4 h using the Dul Luiferse Assy kit oring to mnufturer's instrutions (Promeg). Smple vlues were otine oring to the following formul: (luiferse smple luiferse ontrol)/(renill smple renill ontrol) where ontrol vlues re otine from untrnsfete ells. Reltive luiferse vlues re efine s the smple vlue otine using methylte pgl-promoter plsmi ivie y the smple vlue otine using the unmethylte pgl- Promoter plsmi. Phenotypi testing n pthologil nlysis. Mie were nlyse using the SHIRPA primry sreen test series 31 tht ws evelope for rpi phenotype testing in muttion sreens. Motor efets were teste y ssying grip strength, wire mneuver n lim tone n sensory efets y visul pling, toe pinh, ornel n pinn reflexes. Hering ws teste y the lik ox test. For pthologil nlysis, orgns were exmine mrosopilly n soli orgns were weighe. All orgns smple for histologil nlysis were emee in prffin wx, setione (4 µm) n stine with hemtoxylin n eosin. rin n spinl or were itionlly stine with Luxol fst lue resyl violet stins. Tissues exmine inlue hert, lrynx, lung, liver, pnres, tongue, esophgus, stomh, intestine, thymus, spleen, kiney, renl gln, testes, skeletl musle, rin n spinl or. The open fiel pprtus onsiste of retngulr ox m in size, ivie into 48 (8 6) equl squres. The ehviorl prmeters registere uring min session were s follows: (i) the totl numer of entries into squres (suivie into movement in outer, mile n inner zones); (ii) the numer of rers (stning on hin legs with forelegs in ir or ginst the wll); (iii) efetion; (iv) time spent grooming; n (v) time spent immoile. Aknowlegments We thnk D. Mleo for monitoring erly mouse litters; F. Tronhe n G. Shütz for nestin-cre mie; J. Mnson for eleter mie; A.J.H. Smith for ES ells; L. Vizor n J. Nole for phenotypi testing; J. Anthony n I. Dvis for photogrphing mie; A. Greig n J. Dvison for tehnil ssisne; stff of the Anne Wlker uiling for niml husnry; A. Ms for instrution on mouse lstoyst injetion; n J. Sekl, W. Skrnes, S. rown, C. Aott, S. Kriuionis n J. Selfrige for vie. This work ws fune y The Wellome Trust. Reeive Novemer ; epte 2 Ferury Rett, V.A. Uer ein eigenrtiges hirntrophishes Synrom ei Hypermmonmie im Kineslter. Weiner Meizinishe Wohenshrift 37, (1966). 2. Hgerg,., Airi, J., Dis, K. & Rmos, O. A progressive synrome of utism, ementi, txi, n loss of purposeful hn use in girls: Rett's synrome: report of 3 ses. Ann. Neurol. 14, (1983). 3. Amir, R.E. et l. Rett synrome is use y muttions in X-linke MECP2, enoing methyl-cpg-ining protein 2. Nture Genet. 23, (1999). 4. Amir, R.E. et l. Influene of muttion type n X hromosome intivtion on Rett synrome phenotypes. Ann. Neurol. 47, ().. Wn, M. et l. Rett synrome n eyon: reurrent spontneous n fmilil MECP2 muttions t CpG hotspots. Am. J. Hum. Genet. 6, (1999). 6. ienvenu, T. et l. MECP2 muttions ount for most ses of typil forms of Rett synrome. Hum. Mol. Genet. 9, (). 7. Chele, J.P. et l. Long-re sequene nlysis of the MECP2 gene in Rett synrome ptients: orreltion of isese severity with muttion type n lotion. Hum. Mol. Genet. 9, (). 8. Hmpson, K., Woos, C.G., Ltip, F. & We, T. Muttions in the MECP2 gene in ohort of girls with Rett synrome. J. Me. Genet. 37, (). 9. Huppke, P., Lone, F., Krmer, N., Engel, W. & Hnefel, F. Rett synrome: nlysis of MECP2 n linil hrteriztion of 31 ptients. Hum. Mol. Genet. 9, (). 1. Ot, K. et l. Muttion nlysis of the methyl-cpg-ining protein 2 gene (MECP2) in ptients with Rett synrome. J. Me. Genet. 37, (). 11. Xing, F. et l. Muttion sreening in Rett synrome ptients. J. Me. Genet. 37, (). 12. uyse, I.M. et l. Dignosti testing for Rett synrome y DHPLC n iret sequening nlysis of the MECP2 gene: ientifition of severl novel muttions n polymorphisms. Am. J. Hum. Genet. 67, (). 13. Lewis, J.D. et l. Purifition, sequene n ellulr loliztion of novel hromosoml protein tht ins to methylte DNA. Cell 69, (1992). 14. Nn, X., Tte, P., Li, E. & ir, A.P. DNA methyltion speifies hromosoml loliztion of MeCP2. Mol. Cell. iol. 16, (1996). 1. Nn, X., Cmpoy, J. & ir, A. MeCP2 is trnsriptionl repressor with unnt ining sites in genomi hromtin. Cell 88, (1997). 16. Nn, X. et l. Trnsriptionl repression y the methyl-cpg-ining protein MeCP2 involves histone eetylse omplex. Nture 393, (1998). 17. Jones, P.L. et l. Methylte DNA n MeCP2 reruit histone eetylse to repress trnsription. Nture Genet. 19, (1998). 18. Tte, P., Skrnes, W. & ir, A. The methyl-cpg ining protein MeCP2 is essentil for emryoni evelopment in the mouse. Nture Genet. 12, 8 (1996). 19. Meehn, R.R., Lewis, J.D., MKy, S., Kleiner, E.L. & ir, A.P. Ientifition of mmmlin protein tht ins speifilly to DNA ontining methylte CpGs. Cell 8, (1989).. Ng, H.-H. et l. MD2 is trnsriptionl repressor elonging to the MeCP1 histone eetylse omplex. Nture Genet. 23, 8 61 (1999). 21. Suer,. & Henerson, N. Site-speifi DNA reomintion in mmmlin ells y the Cre reominse of teriophge P1. Pro. Ntl. A. Si. USA 86, (1988). 22. Shwenk, F., ron, U. & Rjewsky, K.A. re-trnsgeni mouse strin for the uiquitous eletion of -flnke gene segments inluing eletion in germ ells. Nulei Ais Res. 23, 8 81 (199). 23. Tronhe, F. et l. Disruption of the gluoortioi reeptor gene in the nervous system results in reue nxiety. Nture Genet. 23, (1999). 24. Henrih,., Guy, J., Rmshoye,., Wilson, V.A. & ir, A. Closely relte proteins MD2 n MD3 ply istintive ut interting roles in mouse evelopment. Genes Dev. (in press).. Fujit, N. et l. Methyltion-meite trnsriptionl silening in euhromtin y methyl-cpg ining protein MD1 isoforms. Mol. Cell. iol. 19, (1999). 26. Ng, H.-H., Jeppesen, P. & ir, A. Ative repression of methylte genes y the hromosoml protein MD1. Mol. Cell. iol., (). 27. Crwley, J.N. et l. ehviourl phenotypes of inre mouse strins: implitions n reommentions for moleulr stuies. Psyhophrmology 132, (1997). 28. Chen, R., Akrin, S., Tuor, M. & Jenish, R. Defiieny of methyl-cpg ining protein-2 in CNS neurons results in Rett-like phenotype in mie. Nture Genet. 27, (1). 29. Yusufzi, T.M. & Wolffe, A.P. Funtionl onsequenes of Rett synrome muttions on humn MeCP2. Nulei Ais Res. 28, (). 3. Free, A. et l. DNA reognition y the methyl-cpg ining omin of MeCP2. J. iol. Chem. (in press). 31. Rogers, D.C. et l. ehviorl n funtionl nlysis of mouse phenotype: SHIRPA, propose protool for omprehensive phenotype ssessment. Mmm. Genome 8, (1997). 326 nture genetis volume 27 mrh 1