A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. 1kb. pa 1 pa 2 wildtype allele 11kb. S/pA. loxp.
|
|
- Sharyl Willis
- 6 years ago
- Views:
Transcription
1 1 Nture Pulishing Group A mouse Mep2-null muttion uses neurologil symptoms tht mimi Rett synrome Jky Guy 1, rin Henrih 1, Megn Holmes 2, Jonne E. Mrtin 3 & Arin ir 1 1 Nture Pulishing Group genomi lous trgeting vetor trgete lous reomine lous 1.2k 3 proe k rin kiney liver Rett synrome (RTT) is n inherite neuroevelopmentl isorer of femles tht ours one in 1, 1, irths 1,2. Affete femles evelop normlly for 6 18 months, ut then lose voluntry movements, inluing speeh n hn skills. Most RTT ptients re heterozygous for muttions in the X- linke gene MECP2 (refs. 3 12), enoing protein tht ins to methylte sites in genomi DNA n filittes gene silening Previous work with Mep2-null emryoni stem ells inite tht MeCP2 is essentil for mouse emryogenesis 18. Here we generte mie lking Mep2 using Cre- tehnology. oth Mep2-null mie n mie in whih Mep2 ws elete in rin showe severe neurologil symptoms t pproximtely six weeks of ge. Compenstion for sene of MeCP2 in other tissues y MeCP1 (refs. 19,) ws not pprent in geneti or iohemil tests. After severl months, heterozygous femle mie lso showe ehviorl symptoms. The overlpping ely efore symptom onset in humns n mie, espite their profounly ifferent rtes of evelopment, rises the possiility tht stility of rin funtion, not rin evelopment per se, is ompromise y the sene of MeCP2. Previous ttempts to rete Mep2-null mie 1k pa 1 pa 2 wiltype llele 11k S/pA S/pA N N pa 1 pa 2 floxe llele 8.2k 4 pa 2 A elete llele 1.2k 83 kd using Mep2 ES ells were unsuessful 18. To irumvent the prolem of emryoni lethlity, we reple exons 3 n 4 of Mep2 in ES ells with the sme exons flnke y sites 21 (Fig. 1). Mie homozygous or hemizygous for the replement were vile n fertile. Northern lots showe the expete mture trnsript from the Mep2 lox lous (2. k) plus trnsript in whih the β-gloin intron ws unsplie (3.3 k; Fig. 1). Erly emryoni eletion of the gene ws hieve y rossing Mep2 lox/lox femles with eleter mie, whih express Cre uiquitously 22. Southern lots showe tht reomintion etween sites h ourre in ll femle offspring rrying the eleter trnsgene n the Mep2 lox llele (Fig. 1), leing to eletion of ll ut the mino-terminl eight mino is of MeCP2. When Mep2 femles were mte with wil-type C7L/6 mles, equl numers of wil-type n f f f m m m e wil type 11k floxe 8.2k elete 1.2k C D S26 m m f f f m m m Fig. 1 Disruption of mouse Mep2 using Cre- tehnology., Mps of the genomi lous, trgeting vetor, trgete lous n reomine lous fter exposure to Cre., Northern-lot nlysis of RNA from rin, kiney n liver of wiltype mle (), floxe mle (), Mep2-null mle (), wil-type femle () n femle heterozygous for the null llele () proe with 3.2-k NoI frgment inluing exons 3 n 4 of Mep2. ns A (1 k) n D (2 k) re seen in wil-type tissue, wheres ns (3.3 k) n C (2. k) re ue to trnsription of the floxe Mep2 llele. No Mep2 mrna is etete in the null mles. Equl loing of RNA is emonstrte y hyriiztion of the sme lot to n S26 riosoml protein mrna proe., Western lots of rin protein from wil-type, floxe n null mie. No MeCP2 protein is etete in Mep2-null rin., Southern lots of DNA from tils of single litter erive from ross etween Mep2 lox/lox femle n mle rrying the X-linke eleter trnsgene. Femles, ut not mles, hve elete the floxe llele in til ells s expete. e, Southern-lot nlysis of til DNA from mie orn to ross etween n Mep2 femle n wil-type mle. Hlf of mles re expete to e Mep2. 1 Wellome Centre for Cell iology, Institute of Cell n Moleulr iology, University of Einurgh, The King s uilings, Einurgh, UK. 2 Deprtment of Clinil Neurosienes, Moleulr Meiine Centre, University of Einurgh, Western Generl Hospitl, Einurgh, UK. 3 St rtholomews n the Royl Lonon Shool of Meiine n Dentistry, Queen Mry n Westfiel College, The Institute of Pthology, The Royl Lonon Hospitl, Whitehpel, Lonon, UK. Corresponene shoul e resse to A.. (e-mil:.ir@e..uk). 322 nture genetis volume 27 mrh 1
2 1 Nture Pulishing Group 1 Nture Pulishing Group nimls (%) # # # # KO Mep2 mles were orn (Fig. 1e). No Mep2 mrna or protein ws etete in tissues from Mep2 mie (Fig. 1,). We otine Mep2 / femles y rossing Mep2, eleter femles with Mep2 mles (t not shown). The viility of Mep2-null nimls proves tht sene of MeCP2 oes not use emryoni lethlity in mie, ontrry to previous onlusion 18. The inviility of himeri emryos ontining Mep2-null ES ells seen previously my e ue to verse effets of the inserte lz trnsgene on linke genes, or to epigeneti hnges tht reue pluripoteny rising uring ES prolifertion in the sene of MeCP2. Mep2-null mle n femle mie showe no initil phenotype, ut oth evelope stiff, unoorinte git n reue spontneous movement etween three n eight weeks of ge (Fig. 2). Most nimls susequently evelope hinlim lsping (Fig. 2) n irregulr rething. Uneven wering of the teeth n mislignment of the jws ws lso frequent. Testes of Mep2-null mles were lwys internl. Neither motor efets nor sensory efets were etete, ut some ffete nimls file to respon to soun. Pthologil nlysis of symptomti nimls revele no ovious histologil normlities in rnge of orgns. In prtiulr, the rin showe no unusul fetures of ortil lmintion, etopis or other normlities (Fig. 2). Vrile progression of symptoms le ultimtely to rpi weight loss n eth t pproximtely 4 ys (Fig. 2). A istint feture of the phenotype ws vrying oy weight, whih ws epenent on geneti kgroun. The Mep2-null muttion on C7L/6 kgroun gve rise to nimls tht were sustntilly unerweight from four weeks with full penetrne (Fig. 3 ). After rossing to 129 strin, however, F1 nimls showe reverse effet. Inste of losing weight, Mep2 mie were the sme weight s wil-type littermtes until eight weeks, when survivors eme signifintly hevier thn silings (Fig. 3) with n ovious inrese in eposite ft. Other spets of the phenotype, inluing ehviorl efets, were not ffete y ltere geneti kgroun. These t inite the presene of one or more moifier genes tht meite the effets of MeCP2 on oy weight. ko symptom free, n=22 wt symptom free, n=12 ko survivl, n=3 wt survivl,, n=12 # ( / ) femle 6/129 mle WT ffete nimls (%) (63) (63) (63) (9) mle mle mle (4) (46) (41) (28) () (13) (1) ge (months) Fig. 2 Phenotypes of mie with the Mep2-null muttion., Cumultive plot showing perentge of wil-type (open symols) n hemizygous or homozygous Mep2-null nimls (fille symols) tht survive (tringles) or remine free of ovious neurologil symptoms (irles) with inresing time. Most t onerns Mep2 mles on C7L/6 kgroun, ut the timings for Mep2 mles rosse with 129 mie () n for Mep2 / femles (#) re highlighte., Delye onset hin lim lsping in Mep2 mles. The left n mile pnels show norml spreing of hinlims in wil-type n six-week mutnt mles, respetively. Right, lim-lsping phenotype in mutnt mle ge 7 weeks., Setions showing histology of ererl ortex of 1-week Mep2 mouse with pronoune neurologil symptoms (KO) n n ge-mthe wil-type ontrol (WT) stine with hemtoxylin n eosin. Sle r, µm., Histogrm showing frtion of femle mie heterozygous for the Mep2-null muttion tht exhiit neurologil symptoms in ifferent ge groups (numer in group shown in rkets). Mep2 is expresse in mny mouse tissues, ut the phenotype of Mep2-null mie suggests neurologil efets. To test whether the effets of MeCP2 loss re speifi to rin, the muttion ws omine with the nestin-cre trnsgene 23, whih is highly expresse in neuronl n glil ells. Southern lots onfirme tht Mep2 lox ws pproximtely 6% elete in rin (8% in ereellum), ut 1% elete or less in other somti tissues (Fig. 3e). The phenotype of mie with extensive eletion of Mep2 in rin ws inisinguishle from tht of Mep2-null mie. The low frequeny of Mep2 eletion in non-rin tissues is unlikely to ontriute to the phenotype, s Mep2 femles re mosi for Mep2 expression ue to X-hromosome intivtion, yet show no phenotype t this ge. These t inite tht the mjor fetures of the Mep2-null phenotype, inluing reue movement, norml git, lim lsping, low weight (Fig. 3f), internl testes, uneven wering of teeth n lethlity, re proly ue to sene of MeCP2 in neuronl n/or glil ells. The rin-speifi effets of Mep2 eletion my e ue to ompenstion for lk of MeCP2 in other tissues y ifferent methyl-cpg ining repressor. M2 is omponent of the MeCP1 histone eetylse omplex, whih lso represses trnsription. As M2 / mie re vile n fertile 24, we teste for possile intertion etween MeCP2 n M2 y omining the Mep2-null n M2-null muttions. Doule-mutnt nimls showe the sme onset of symptoms n mortlity s single-mutnt Mep2-null mie, proviing no eviene for geneti intertion etween Mep2 n M2 (Fig. 4). We further nlyse repression of methylte reporter genes in til firolst ell lines from wil-type mie n mie lking Mep2, M2, or oth. Repression ws only mrginlly reue in Mep2 ells ( % of the non-methylte ontrol) ompre with wil-type ells ( 2%; Fig. 4). M2 / ells, in ontrst, represse methylte reporter genes ineffiiently ( 3% of non-methylte ontrol 24 ), ut this inomplete repression ws unltere in oule-mutnt M2 /, Mep2 ells. y these ssys, therefore, methyl-cpg epenent repression in til firolsts is ue to M2, n MeCP2 hs miniml role. Expression of exogenous MeCP2 i, however, restore full repression to M2 / ells, emonstrting tht nture genetis volume 27 mrh 1 323
3 1 Nture Pulishing Group 1 Nture Pulishing Group e wil type knokout not genotype MeCP2 n t s methyl-cpg epenent repressor in this system (Fig. 4). The omine geneti n iohemil results inite tht M2 n MeCP2 funtion in inepenent pthwys. It remins possile tht nother methyl-cpg ining repressor (for exmple, M1; refs.,26) might ompenste for sene of MeCP2. Although Mep2 femle mie initilly showe no symptoms n rise norml litters, they quire the inerti n hinlim lsping phenotypes t ges greter thn three months (Fig. 2). y nine months of ge, out one-hlf of the heterozygous mie showe unmiguous symptoms, often inluing rething irregulrities, ut some remine symptomti t one yer. The r Ce Th He Lu Li Sp Ki Sv Te Sk T het 67 8 <2 6 3 <2 <2 1 <2 () wt 11k lox 8.2k ko 1.2k % re f / nestin re (6) Fig. 3 Effets of Mep2 eletion on oy weight., oy weight from irth of iniviul mles from single litter. Mep2- null mles re signifintly smller thn wil-type littermtes from roun wening ( 3 weeks of ge).,, oy weight from wening of two ifferent litters on C7L/6 (6) kgroun, showing reue weight of Mep2-null nimls (open symols) ompre with wil-type littermtes (fille symols)., oy weight of Mep2 (open symols) n wil-type (fille symols) littermtes on C7L/6 129 F1 kgroun. The two mutnt nimls (of 4 in the litter) surviving eyon 7 weeks gine weight reltive to littermtes. e, Southernlot nlysis of tissue DNA from mle mouse ontining the nestin-cre trnsgene n the floxe llele of Mep2. The proportion of reomintion in eh tissue is lirte y omprison with n intensities in DNA from heterozygote for the wiltype n null lleles (het), where the rtio is known to e 1:1. The tissues teste re rin (minus ereellum) (r), ereellum (Ce), thymus (Th), hert (He), lung (Lu), liver (Li), spleen (Sp), kiney (Ki), seminl vesiles (Sv), testis (Te), skeletl musle (Sk) n til (T). Perentge of hromosomes elete is shown elow eh lne. f, oy weight from wening of C7L/6 Mep2 mles (open symols) rrying nestin-cre trnsgene tht uses eletion of Mep2 preominntly in rin (e) ompre with wil-type littermtes (fille symols). Reue weight like tht seen for Mep2 mles is pprent, initing neurologil origin for this omponent of the phenotype. f, Animls ying nturlly () n those srifie for experimentl resons () re inite. overlpping ely seen in mie n humns efore onset of the effets of Mep2 muttion is unexpete given the ifferent timing of their evelopmentl progrmmes. The moility of ffete nimls ws quntifie using n open fiel test 27. Symptomti heterozygotes visite fewer squres, spent more time eing immoile n rere less thn ge-mthe wil-type ontrols (Tle 1). This ws not ue to heightene nxiety, s fel olus ounts, grooming times n time spent in ifferent zones of the fiel were similr to those of ontrols. Unlike Mep2-null nimls, heterozygotes i not unergo rpi eteriortion, rising the possiility tht the Mep2 onition n, like RTT, exhiit long-term stility. Fig. 4 Asene of ovious geneti or iohemil intertions etween 3 MeCP2 n the methyl-cpg ining 1 Wt repressor M2., Cumultive plot Mep2 ko survivl (n =1) ompring perentge of Mep2 3 M2/Mep2 ko survivl (n =18) Mep2 ko 8 (open symols) n Mep2 Mep2 ko symptom free (n =8), M2 ko M2 / M2/Mep2 ko symptom free (n =9) oule-mutnt nimls M2/Mep2 ko (fille symols) tht survive (tringles) 6 or remine free of neurologi- l symptoms (irles) with 4 inresing time. The profiles for the 1 two genotypes were etermine in prllel using littermtes on C7L/6 129 kgroun (6/129) n re inepenent of the t 1 shown in Fig. 2., Repression of methylte reporter onstrut ontining the pgl2 promoter reltive MeCP2 to the sme reporter unmethylte, is only slightly less effiient in Mep2 ells thn in wil-type ells. Reltive repression is signifintly less effiient in M2 / ells n this effiieny is not reue in oule-mutnt Mep2, M2 / ells. Co-trnsfetion with n MeCP2 expression onstrut (right) restores repression of the methylte reporter gene. nimls (%) reltive expression (%) 324 nture genetis volume 27 mrh 1
4 1 Nture Pulishing Group 1 Nture Pulishing Group The results of this n the ompnying pper 28 show tht mie with the Mep2-null muttion re vli moel for humn RTT, s elye onset of neurologil risis ffeting git, posture, rething n spontneous movement is seen in oth onitions. These t support the view tht RTT is primrily neurologil isese, ut in other respets they hllenge urrent pereptions of this onition. First, it hs een thought tht RTT is use y muttions tht impir the funtion of MeCP2, ut o not intivte it. Avne mouse evelopment in the sene of MeCP2, plus eviene tht ertin humn MECP2 muttions pprently olish the funtion of the protein 29,3, rgue tht mny RTT ptients my e heterozygous for wht re effetively null muttions in MECP2. A seon unexpete fining is tht the solute time of onset of symptoms overlps in humn n mouse MECP2 heterozygotes. This pproximte orresponene in rel time, not evelopmentl time, rgues ginst evelopmentl efet ue to MeCP2 efiieny, s this woul rise muh erlier in rpily eveloping mie. An lterntive hypothesis is tht neurogenesis n e omplishe in the sene of MeCP2, ut tht the resulting rin ells, whether humn or mouse, re funtionlly unstle. rin funtion in MECP2-null mles of either speies my therefore eline steeply, leing to erly symptoms n eth. Heterozygous femles, on the other hn, hve mny rin ells tht express wil-type MeCP2 n woul therefore tke longer to reh the level of rin ell ysfuntion t whih neurologil symptoms pper. Methos Conitionl gene trgeting onstrut. The trgeting vetor ws esigne to flnk the oing sequenes in exons 3 n 4 (ll ut the first 8 of the protein) with sites, lso ing n itionl intron n polyenyltion signl from the humn β-gloin gene n neomyin resistne gene for seletion of trnsfete ES ells. The trgeting vetor ws onstrute using 7.2-k mhi genomi frgment sulone in psiiks+ from 4-k 129 mouse osmi. The 3 mhi site is present in the mouse genome, with the site oming from the osmi polylinker. The site n ignosti restrition sites were inserte into n NoI site in intron 2 using oligonuleoties. A seon NoI site in the 3 UTR ws use to insert 2.8- k mhi-xi frgment ontining intron 2 n the polyenyltion signl of humn β-gloin, followe y 1.2 k TK-neo ssette flnke y sites ( floxe ; gift from A. Smith). This resulte in trgeting vetor with 2.8 k of homology, 1.2 k of 3 homology n 3.2-k floxe segment. The vetor ws linerize for trnsfetion t the 3 en using XhoI. ES ell ulture n gene trgeting. We rrie out gene trgeting in the ES ell line E14 TG2 (A. Smith) whih is erive from the mouse sustrin 129/Ol. Cells were grown on geltinize ishes without feeer ells in the presene of reominnt humn LIF ( gift from A. Smith) in Glsgow MEM (Life Tehnologies) supplemente with 1% fetl ovine serum (Gloephrm), 1 MEM non-essentil mino is, soium pyruvte (1 mm), β-merptoethnol ( µm; ll Life Tehnologies). ES ells ( 1 7 ells) were trnsfete with the linerize trgeting vetor ( µg DNA in.8 ml HEPES uffere sline) y eletroportion (8 V, 3 µf, ior Gene Pulser) n plte in 1-m ishes t 1 6 ells per ish. Corretly trgete lones were ientifie y Southern-lot nlysis. For trgeting t the 3 en, ES-ell DNA ws igeste with mhi n the lots proe with 1.2-k NoI mhi frgment. The 11-k wil-type n ws reple in trgete lones y 8.2-k n from the floxe llele. To hek Tle 1 Performne of wil-type n Mep2 femles in open fiel testing Wil type Heterozygote P= Numer of nimls 7 11 Totl no. squres visite 139 (16) 73 (14).87 % Squres visite outer 8.8 (2.7) 8.4 (4.3) NS mile 14.6 (2.3) 1.4 (4.1) NS inner 4. (.8) 4.3 (1.4) NS Numer of rers 1.9 (4.4) 4.3 (1.3).78 Numer of fel oli 2.7 (.8) 3.6 (.) NS Time spent grooming (s) 14. (2.8) 9.2 (1.9) NS Time spent immoile (s) 27.9 (.2) 9.3 (18.2).172 Men vlues re shown followe y the stnr error of the men in rkets. Vlues for wil-type n heterozygous femles were ompre using n unpire t-test. Where signifint ifferene ws foun t the 9% onfiene level, the P vlue is shown. NS inites 'not signifint'. The squres of the open fiel pprtus were lssifie s outer, mile or inner. for the presene of the site, the sme mhi-igeste DNA ws proe with.9-k XI-NoI frgment. The wil-type llele gve n 11-k n, the trgete gene without site, 1-k n, n the trgete gene with site, 6.8-k n. Genertion n reeing of himeri mie. Corretly trgete ES ell lones for injetion into lstoysts were pssge the y efore injetion n injete into lstoysts from nturlly mte C7L/6 femles t 3. ys post oitum. Injetions were performe in M2 meium (Sigm) with 1 1 ES ells eing injete into eh lstoyst efore trnsfer to pseuopregnnt reipient femles (6 12 lstoysts per reipient). Chimeri pups were ientifie y their gouti ot olor n, on mturity, were mte with C7L/6 mie. As Mep2 is X-linke, ll gouti F1 femles were heterozygous for the floxe llele, n this ws onfirme y Southern lot. We rosse heterozygous femles with wil-type C7L/6 mles (F2 genertion). Resulting hemizygous mles were rosse to heterozygous femles to generte homozygous femles (F3) n the line ws then mintine in the homo/hemizygous stte. Cre-expressing mie n eletion of Mep2. We otine eleter mie 22, whih rry uiquitously expresse Cre trnsgene on the X hromosome. Mle eleter mie were rosse with homozygous floxe femles. All femle pups were Mep2 n hemizygous for re. All mle pups were hemizygous for the Mep2 lox llele. Mep2 femles were rosse with wil-type C7L/6 mles to give Mep2 or Mep2 femles n Mep2 or Mep2 mles. The three Mep2 lleles were ientifie y Southern-lot nlysis y igesting with mhi n proing with the 1.2- k NoI-mHI 3 proe (Mep2 +, 11 k; Mep2 lox, 8.2 k; Mep2, 1.2 k). Heterozygous nestin-cre mles 23 were rosse with Mep2 lox/lox femles to generte mles tht h Mep2 elete in neurl n glil ells. Animls rrying the nestin-cre trnsgene were ientifie y PCR on til genomi DNA (forwr primer CreF, GACCGTACACCAAAATTTGCCTG 3 ; reverse primer CreR, TTACGTATATCCTGGCAGCGATC 3 ; min t 94 C, 3 yles of 3 s t 94 C, 3 s t 64 C, 4 s t 72 C, followe y min t 72 C. The 46-p prout ws visulize y running on 1.% TAE grose gel. Vrious tissues were use to mke genomi DNA, whih ws igeste with mhi, Southern lotte n proe with the NoI- mhi 3 Mep2 proe. The extent of eletion in eh tissue ws quntifie using ImgeQunt softwre (Moleulr Dynmis), orreting for kgroun n higher intensity signl from the smller, elete llele. Southern-, northern- n western-lot nlysis. Genomi DNA ws prepre from ES ell lones n til tips y stnr proeures. RNA ws prepre from mouse tissues using TriRegent (Sigm) following homogeniztion in n UltrTurrx homogenizer. RNA ws me from the lystes oring to the mnufturer s protool. Southern n northern lots were prepre y stnr proeures. Riotive proe ws etete using PhosphoImger (Moleulr Dynmis) n quntitte using ImgeQunt softwre. We rrie out western-lot nlysis on totl rin extrts from wil-type, floxe n mutnt mie. rins were ollete in ol PS n trnsfere to ol Lemmli smple uffer without SDS (6 mm Tris Cl, ph 6.8, 1 mm DTT, 1% glyerol). The tissue ws then homogenize using n UltrTurrx on high spee for 1 s efore ing SDS to 2%. Lystes were sonite riefly, oile for min n entrifuge for 1 min t 13, r.p.m. Super- nture genetis volume 27 mrh 1 3
5 1 Nture Pulishing Group 1 Nture Pulishing Group ntnt liquots were run on 12.% SDS PAGE gels with 1 µg protein per lne. Western lots with nti-mecp2 rit polylonl ntioy (Upstte ioteh) were rrie out oring to the mnufturer s instrutions n visulize on Hyperfilm using the ECL system (Amershm). Trnsient trnsfetion ssys. We use til firolsts with the following four genotypes: Mep2,M2 ; Mep2,M2 ; Mep2,M2 / ; n Mep2,M2 /. M2 / ells were otine s esrie 24. Mep2 ells were otine y immortlizing til firolsts from Mep2 mles on either n M2 or M2 / kgroun n susequently trnsfeting with CMVre trnsgene. Cell lones tht h elete Mep2 were then selete. Cells were grown to pproximtely % onfluene n trnsfete using Lipofetmine oring to the mnufturer's instrutions (Life Tehnologies). Eh well of 6-well plte ws trnsfete with 2 µg of either M.SssI methylte or unmethylte pgl2-promoter plsmi plus prl-sv4 ontrol plsmi ( ng; Promeg). Where neessry, CMV-Mep2 expression onstrut (1 ng) ws o-trnsfete. Luiferse levels were mesure fter 4 h using the Dul Luiferse Assy kit oring to mnufturer's instrutions (Promeg). Smple vlues were otine oring to the following formul: (luiferse smple luiferse ontrol)/(renill smple renill ontrol) where ontrol vlues re otine from untrnsfete ells. Reltive luiferse vlues re efine s the smple vlue otine using methylte pgl-promoter plsmi ivie y the smple vlue otine using the unmethylte pgl- Promoter plsmi. Phenotypi testing n pthologil nlysis. Mie were nlyse using the SHIRPA primry sreen test series 31 tht ws evelope for rpi phenotype testing in muttion sreens. Motor efets were teste y ssying grip strength, wire mneuver n lim tone n sensory efets y visul pling, toe pinh, ornel n pinn reflexes. Hering ws teste y the lik ox test. For pthologil nlysis, orgns were exmine mrosopilly n soli orgns were weighe. All orgns smple for histologil nlysis were emee in prffin wx, setione (4 µm) n stine with hemtoxylin n eosin. rin n spinl or were itionlly stine with Luxol fst lue resyl violet stins. Tissues exmine inlue hert, lrynx, lung, liver, pnres, tongue, esophgus, stomh, intestine, thymus, spleen, kiney, renl gln, testes, skeletl musle, rin n spinl or. The open fiel pprtus onsiste of retngulr ox m in size, ivie into 48 (8 6) equl squres. The ehviorl prmeters registere uring min session were s follows: (i) the totl numer of entries into squres (suivie into movement in outer, mile n inner zones); (ii) the numer of rers (stning on hin legs with forelegs in ir or ginst the wll); (iii) efetion; (iv) time spent grooming; n (v) time spent immoile. Aknowlegments We thnk D. Mleo for monitoring erly mouse litters; F. Tronhe n G. Shütz for nestin-cre mie; J. Mnson for eleter mie; A.J.H. Smith for ES ells; L. Vizor n J. Nole for phenotypi testing; J. Anthony n I. Dvis for photogrphing mie; A. Greig n J. Dvison for tehnil ssisne; stff of the Anne Wlker uiling for niml husnry; A. Ms for instrution on mouse lstoyst injetion; n J. Sekl, W. Skrnes, S. rown, C. Aott, S. Kriuionis n J. Selfrige for vie. This work ws fune y The Wellome Trust. Reeive Novemer ; epte 2 Ferury Rett, V.A. Uer ein eigenrtiges hirntrophishes Synrom ei Hypermmonmie im Kineslter. Weiner Meizinishe Wohenshrift 37, (1966). 2. Hgerg,., Airi, J., Dis, K. & Rmos, O. A progressive synrome of utism, ementi, txi, n loss of purposeful hn use in girls: Rett's synrome: report of 3 ses. Ann. Neurol. 14, (1983). 3. Amir, R.E. et l. Rett synrome is use y muttions in X-linke MECP2, enoing methyl-cpg-ining protein 2. Nture Genet. 23, (1999). 4. Amir, R.E. et l. Influene of muttion type n X hromosome intivtion on Rett synrome phenotypes. Ann. Neurol. 47, ().. Wn, M. et l. Rett synrome n eyon: reurrent spontneous n fmilil MECP2 muttions t CpG hotspots. Am. J. Hum. Genet. 6, (1999). 6. ienvenu, T. et l. MECP2 muttions ount for most ses of typil forms of Rett synrome. Hum. Mol. Genet. 9, (). 7. Chele, J.P. et l. Long-re sequene nlysis of the MECP2 gene in Rett synrome ptients: orreltion of isese severity with muttion type n lotion. Hum. Mol. Genet. 9, (). 8. Hmpson, K., Woos, C.G., Ltip, F. & We, T. Muttions in the MECP2 gene in ohort of girls with Rett synrome. J. Me. Genet. 37, (). 9. Huppke, P., Lone, F., Krmer, N., Engel, W. & Hnefel, F. Rett synrome: nlysis of MECP2 n linil hrteriztion of 31 ptients. Hum. Mol. Genet. 9, (). 1. Ot, K. et l. Muttion nlysis of the methyl-cpg-ining protein 2 gene (MECP2) in ptients with Rett synrome. J. Me. Genet. 37, (). 11. Xing, F. et l. Muttion sreening in Rett synrome ptients. J. Me. Genet. 37, (). 12. uyse, I.M. et l. Dignosti testing for Rett synrome y DHPLC n iret sequening nlysis of the MECP2 gene: ientifition of severl novel muttions n polymorphisms. Am. J. Hum. Genet. 67, (). 13. Lewis, J.D. et l. Purifition, sequene n ellulr loliztion of novel hromosoml protein tht ins to methylte DNA. Cell 69, (1992). 14. Nn, X., Tte, P., Li, E. & ir, A.P. DNA methyltion speifies hromosoml loliztion of MeCP2. Mol. Cell. iol. 16, (1996). 1. Nn, X., Cmpoy, J. & ir, A. MeCP2 is trnsriptionl repressor with unnt ining sites in genomi hromtin. Cell 88, (1997). 16. Nn, X. et l. Trnsriptionl repression y the methyl-cpg-ining protein MeCP2 involves histone eetylse omplex. Nture 393, (1998). 17. Jones, P.L. et l. Methylte DNA n MeCP2 reruit histone eetylse to repress trnsription. Nture Genet. 19, (1998). 18. Tte, P., Skrnes, W. & ir, A. The methyl-cpg ining protein MeCP2 is essentil for emryoni evelopment in the mouse. Nture Genet. 12, 8 (1996). 19. Meehn, R.R., Lewis, J.D., MKy, S., Kleiner, E.L. & ir, A.P. Ientifition of mmmlin protein tht ins speifilly to DNA ontining methylte CpGs. Cell 8, (1989).. Ng, H.-H. et l. MD2 is trnsriptionl repressor elonging to the MeCP1 histone eetylse omplex. Nture Genet. 23, 8 61 (1999). 21. Suer,. & Henerson, N. Site-speifi DNA reomintion in mmmlin ells y the Cre reominse of teriophge P1. Pro. Ntl. A. Si. USA 86, (1988). 22. Shwenk, F., ron, U. & Rjewsky, K.A. re-trnsgeni mouse strin for the uiquitous eletion of -flnke gene segments inluing eletion in germ ells. Nulei Ais Res. 23, 8 81 (199). 23. Tronhe, F. et l. Disruption of the gluoortioi reeptor gene in the nervous system results in reue nxiety. Nture Genet. 23, (1999). 24. Henrih,., Guy, J., Rmshoye,., Wilson, V.A. & ir, A. Closely relte proteins MD2 n MD3 ply istintive ut interting roles in mouse evelopment. Genes Dev. (in press).. Fujit, N. et l. Methyltion-meite trnsriptionl silening in euhromtin y methyl-cpg ining protein MD1 isoforms. Mol. Cell. iol. 19, (1999). 26. Ng, H.-H., Jeppesen, P. & ir, A. Ative repression of methylte genes y the hromosoml protein MD1. Mol. Cell. iol., (). 27. Crwley, J.N. et l. ehviourl phenotypes of inre mouse strins: implitions n reommentions for moleulr stuies. Psyhophrmology 132, (1997). 28. Chen, R., Akrin, S., Tuor, M. & Jenish, R. Defiieny of methyl-cpg ining protein-2 in CNS neurons results in Rett-like phenotype in mie. Nture Genet. 27, (1). 29. Yusufzi, T.M. & Wolffe, A.P. Funtionl onsequenes of Rett synrome muttions on humn MeCP2. Nulei Ais Res. 28, (). 3. Free, A. et l. DNA reognition y the methyl-cpg ining omin of MeCP2. J. iol. Chem. (in press). 31. Rogers, D.C. et l. ehviorl n funtionl nlysis of mouse phenotype: SHIRPA, propose protool for omprehensive phenotype ssessment. Mmm. Genome 8, (1997). 326 nture genetis volume 27 mrh 1
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationsupplementary information
DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3... Reltive mrna mount.8.
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationEFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN. Research Report to Northarvest Bean Growers, January 19, 2009
EFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN Reserh Report to Northrvest Ben Growers, Jnury 19, 29 Berlin D. Nelson, Susilo Poromrto, n Ruell Goswmi, Dept. Plnt Pthology, NDSU Ojetive: Determine
More informationOther Uses for Cluster Sampling
Other Uses for Cluster Smpling Mesure hnges in the level of n ttriute Hypothesis testing versus intervl estimtion Type I n 2 errors Power of the test Mesuring ttriute t sme time in ifferent sites Exmple:
More informationChapter 7. Control and Coordination
Chpter 7 Control n Coorintion 1 Whih of the following sttements is orret out reeptors? Gusttory reeptors etet tste while olftory reeptors etet smell Both gusttory n olftory reeptors etet smell Auitory
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1138 Supplementl Figure 1 Inflmmtory Monoytes Host ells CCR2 CCL2 Disseminting Tumor Cells Metstsis Assoite Mrophges VEGF Extrvstion & Metstti Seeing Supplementl Figure 1 The t from this
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationnestin ironetin p75 s1 CNS SKPs Dermo-1 +ve SKPs CNS H2O SCGs Skin Di. SKPs TH SHOX2 GAPDH NCAM D H Figure S1, Immunoytohemil nlysis o SKP spheres ulture rom neontl mouse (nestin, ironetin, S-1) or rt
More informationWesternBright Quantum
WesternBright Quntum Quntify hemiluminesent Western lots over wie ynmi rnge WesternBright Quntum is new hemiluminesent regent speilly formulte for CCD imging. This novel Horserish peroxise (HRP) sustrte
More informationSUPPLEMENTARY INFORMATION
DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1134 CS+ CS- MCH 3 OCT OCT 3 MCH CS- CS+ OCT MCH 3 MCH OCT 3 OCT vs MCH OCT vs MCH ppetitive memory (PI) A 1-1 Unpire onitioning DDC-GAL4/UAS-Trp UAS-Trp/+ -2 MCH OCT OCT MCH sugr OCT MCH
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationRotoroll OK! User's Guide
Rotoroll Pge Sfety preution. The user must never open Rotoroll to inspet it, reple prts or unertke repirs. The reeling mehnisms spring my pop out of its set n use mge n injury to persons, nimls n ojets
More informationDGCR8 is essential for microrna biogenesis and silencing of embryonic stem cell self-renewal
7 Nture Pulishing Group http://www.nture.om/nturegenetis DGCR is essentil for mirorna iogenesis n silening of emryoni stem ell self-renewl Yngming Wng, Rostislv Mevi, Collin Melton, Ruolf Jenish & Roert
More informationPTSE RATES IN PNNI NETWORKS
PTSE RATES IN PNNI NETWORKS Norert MERSCH 1 Siemens AG, Hofmnnstr. 51, D-81359 Münhen, Germny Peter JOCHER 2 LKN, Tehnishe Universität Münhen, Arisstr. 21, D-80290 Münhen, Germny Lrs BURGSTAHLER 3 IND,
More informationSupplementary Figure S1_Cottini
Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationN6-methyladenosine (m6a) is the most prevalent messenger
https://oi.org/8/s556-8-7- m 6 A mrna methyltion regultes tivity to promote the prolifertion n tumorigeniity of enometril ner Jun Liu,,, Mrk A. Ekert,, Bryn T. Hr,,, Song-Mei Liu,, Zhike Lu,, Kngkng Yu,,5,
More informationIncreasing the usage level of corn and distillers grains in market turkey diets through the use of supplemental amino acids
Inresing the usge level of orn n istillers grins in mrket turkey iets through the use of supplementl mino is August 014 By: Sny Noll University of Minnesot Contents EXECUTIVE SUMMARY... INTRODUCTION...
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSystemic delivery of genes to striated muscles using adeno-associated viral vectors
24 Nture Pulishing Group http://wwwntureom/nturemeiine Systemi elivery of genes to strite musles using eno-ssoite virl vetors Pul Gregorevi,4,Mihel J Blnkinship,4,Jmes M Allen 2,Roert W Crwfor,Leonr Meuse,
More informationInhibition of Dexamethasone-induced Fatty Liver Development by Reducing mir-17-5p Levels
originl rtile Inhiition of Dexmethsone-inue Ftty Liver Development y Reuing -5p Levels Willim W Du,, Fengqiong Liu 3, Sze Wn Shn,, Xini Ciny M,, Shn Gupt,, Tinru Jin 4, Dvi Spner, Sergey N Krylov 5, You
More informationCEACAM1 regulates insulin clearance in liver
CEACAM1 regultes insulin lerne in liver Mtthew N. Poy 1, Yn Yng 1, Khijeh Rezei 1, Mts A. Fernström 1, Arhm D. Lee 2, Yoshiki Kio 3, Snr K. Erikson 4 & Soni M. Njjr 1 Pulishe online: 19 Ferury 2002, DOI:
More informationShear behaviour of regular and irregular rock joints under cyclic conditions
Pper No. 69 ISMS 2016 Sher ehviour of regulr n irregulr rok joints uner yli onitions S. M. Mhi Niktr, *, K. Seshgiri Ro, Amit Kumr Shrivstv Deprtment of Civil Engineering, Inin Institute of Tehnology Delhi,
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationAbortion frequency (%) Ovary position on ear Ovary volume (mm 3 )
ortion frequeny (%) 5 1 Ovry position on er 3 1 WW WD pex Bse Ovry volume (mm 3 ) Figure S1. Ovry volume (thik lines) n ortion frequeny (thin lines) s funtion of position long the er, 15 ys fter silk emergene
More informationBDNF release from single cells elicits local dendritic growth in nearby neurons
BDNF relese from single ells eliits lol enriti growth in nery neurons Hley Wilson Horh 1,2 n Lwrene C. Ktz 1 1 Howr Hughes Meil Institute, Deprtment of Neuroiology, Duke University Meil Center, Box 3209,
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationPlzf regulates limb and axial skeletal patterning
rtile Plzf regultes lim n xil skeletl ptterning Mri Brn 1, Niol Hwe 1, Lee Niswner 2 & Pier Polo Pnolfi 1 The promyeloyti leukemi zin finger (Plzf) protein (enoe y the gene Zfp145) elongs to the POZ/zin-finger
More informationProvider How To. Software Process Service Results
Softwre Proess Servie Results Provier How To Copyright Glenwoo Systems LLC 2010. The informtion herein remins the property of Glenwoo Systems LLC. This informtion my not e reprinte or uplite, n is governe
More informationCSE 5311 Notes 2: Binary Search Trees
S Notes : inry Ser Trees (Lst upte /7/ 8:7 M) ROTTIONS Single left rottion t (K rotting ege ) Single rigt rottion t (K rotting ege ) F oule rigt rottion t F G F G Wt two single rottions re equivlent? (OTTOM-UP)
More informationOperating Systems Principles. Page Replacement Algorithms
Operting Systems Priniples Pge Replement Algorithms Steve Gor gor@se.unl.eu http://www.se.unl.eu/~gor/courses/csce45 Virtul Memory Mngement Funmentl issues Plement strtegy Replement strtegies Lo ontrol
More informationstatic principle: output determined by a connection with strong node dynamic principle: output (sometimes) determined by a weak (floating) node
stti n ynmi priniple pmos network nmos network v out stti priniple: output etermine y onnetion with strong noe ynmi priniple: output (sometimes) etermine y wek (floting) noe hrging: C s is eing hrge up
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture277 d 25 25 2 Time from sound onset (ms) 25 25 2 Time from sound onset (ms) Firing rte (spikes/s) Firing rte (spikes/s).8.6..2 e f g h.8.6..2 Frtion of neurons Frtion of neurons N = 53 2 2
More informationRoquin binds inducible costimulator mrna and effectors of mrna decay to induce micrornaindependent post-transcriptional repression
ins inuile ostimultor mrna n effetors of mrna ey to inue mirornainepenent post-trnsriptionl repression Elke Glsmher 1, Ki P Hoefig 1,3, Kthrin U Vogel 1,3, Niol Rth 1, Lirui Du 1, Christine Wolf 1, Eliseth
More informationA liver HIF-2α/IRS2 pathway sensitizes hepatic insulin signaling and is modulated by VEGF inhibition
A liver HIF-2α/IRS2 pthwy sensitizes hepti insulin signling n is moulte y VEGF inhiition Kevin Wei1,1, Stephnie M. Pieewiz1,1, Lis M. MGinnis1,1, Cullen M. Tniguhi2, Stnley J. Wiegn3, Keith Anerson3, Crol
More informationRoot tip contact with low-phosphate media reprograms plant root architecture
27 Nture Pulishing Group http://www.nture.om/nturegenetis Root tip ontt with low-phosphte mei reprogrms plnt root rhiteture Sergio Svistoonoff,2, urey Creff, Mtthieu Reymon,3,Céile Sigoillot-Clue, Lilin
More informationDirectional guidance of neuronal migration in the olfactory system by the protein Slit
rtiles Diretionl guine of neuronl migrtion in the olftory system y the protein Wei Wu*, Kit Wong, Jin-hui Chen*, Zhi-hong Jing, Sophie Dupuis, Jne Y. Wu & Yi Ro * Lortory of Moleulr Neuroiology, Shnghi
More informationBrain-derived neurotrophic factor regulates energy balance downstream of melanocortin-4 receptor
Brin-erive neurotrophi ftor regultes energy lne ownstrem of melnoortin-4 reeptor Boji Xu 1,5,Evn H Gouling 2,Keling Zng 1,Dvi Cepoi 3,Roger D Cone 3,Kevin R Jones 4,Lurene H Teott 2 & Louis F Reihrt 1
More informationTargeting BIG3 PHB2 interaction to overcome tamoxifen resistance in breast cancer cells
Reeive Fe 13 Aepte 15 Aug 13 Pulishe Sep 13 DOI: 1.13/nomms33 OPEN Trgeting intertion to overome tmoxifen resistne in rest ner ells Tetsuro Yoshimru 1, Msto Komtsu 1, Tisuke Mtsuo 1, Yi-An Chen, Yoihi
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationOPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis
OPGL is key regultor of osteolstogenesis, lymphoyte evelopment n lymph-noe orgnogenesis Young-Yun Kong*, Hiroki Yoshi*, Iliko Srosi², Hong-Lin Tn², Emm Timms³, Csey Cpprelli², Sen Morony², Antonio J. Oliveir-os-Sntos*,
More informationRestoration of p53 function leads to tumour regression in vivo. p53 locus. Targeting vector DTA LSL. Targeted allele
Vol 445 8 Ferury 27 oi:1.138/nture5541 Restortion of funtion les to tumour regression in vivo Anre Ventur 1, Dvi G. Kirsh 1,2, Mrgret E. MLughlin 1, Dvi A. Tuveson 1, Jn Grimm 3, Lur Lintult 1, Jmie Newmn
More informationRegulation of NKT cell-mediated immune responses to tumours and liver inflammation by mitochondrial PGAM5-Drp1 signalling
Reeive Mr Aepte Aug Publishe 8 Sep DOI:.8/nomms97 Regultion of NKT ell-meite immune responses to tumours n liver inflmmtion by mitohonril PGAM-Drp signlling Young Jun Kng, Bo-Rm Bng, Kyung Ho Hn, Lixin
More informationSUPPLEMENTARY INFORMATION
DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.
More informationLETTERS. Chfr is required for tumor suppression and Aurora A regulation
25 Nture Pulishing Group http://www.nture.om/nturegenetis Chfr is required for tumor suppression nd Auror A regultion Xiohun Yu 1, Ktherine Minter-Dykhouse 1, Liviu Mlurenu 2, Wei-Meng Zho 3, Dongwei Zhng
More informationTranscription factor Ets-1 links glucotoxicity to pancreatic beta cell dysfunction through inhibiting PDX-1 expression in rodent models
Dietologi () 9: DOI.7/s ARTICLE Trnsription ftor Ets links gluotoxiity to pnreti et ell ysfuntion through inhiiting PDX expression in roent moels Fng Chen & Min Sh & Ynyng Wng & Tijun Wu & Wei Shn & Ji
More informationLethal graft-versus-host disease in mouse models of T cell receptor gene therapy
r t i l e s Lethl grft-versus-host isese in mouse moels of T ell reeptor gene therpy Gvin M Benle,6, Crsten Linnemnn,6, Ann I Hooijks, Lur Bies, Moniek A e Witte, Annelies Jorritsm, Anrew D M Kiser, Nine
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationAnti-Tumour Necrosis Factor-alpha Therapy in Crohn s Disease: Clinical and Health Economic Aspects
Anti-Tumour Nerosis Ftor-α Therpy in Crohn s Disese Anti-Tumour Nerosis Ftor-lph Therpy in Crohn s Disese: Clinil n Helth Eonomi Aspets Fion MGuire, 5th yer Meiine ABSTRACT Ojetives: Crohn s isese is hroni,
More informationInsulin regulation of heart function in aging fruit flies
4 Nture Pulishing Group http://www.nture.om/nturegenetis Insulin regultion of hert funtion in ging fruit flies Roert J Wessells, Erin Fitzgerld, Jmes R Cypser, Mr Ttr & Rolf Bodmer Insulin-IGF reeptor
More informationA savings procedure based construction heuristic for the offshore wind cable layout optimization problem
A svings proeure se onstrution heuristi for the offshore win le lyout optimiztion prolem Sunney Foter (B.Eng. Mehnil) MS. Cnite in Energy Deprtment of Informtis, University of Bergen, Norwy sunney.foter@stuent.ui.no
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationSingle nucleotide polymorphisms (SNPs) are the most common
Originl Artile A Funtionl Polymorphism on Chromosome 15q25 Assoite with Survivl of Erly Stge Non Smll-Cell Lung Cner Gung Jin, MD, PhD,* Eun Young Be, BS, Enyue Yng, PhD, Eung Be Lee, MD, PhD, Won-Kee
More informationGSK-3 is a master regulator of neural progenitor homeostasis
GSK-3 is mster regultor of neurl progenitor homeostsis Woo-Yng Kim 1, Xinshuo Wng 1, Yohong Wu 1, Brdley W Dole 2, Stish Ptel 3, Jmes R Woodgett 3 & Willim D Snider 1 The development of the rin requires
More informationFates-shifted is an F box protein that targets Bicoid for degradation and regulates developmental fate determination in Drosophila embryos
ARTICLES Ftes-shifted is n F ox protein tht trgets Bioid for degrdtion nd regultes developmentl fte determintion in Drosophil emryos Juno Liu 1 nd Jun M 1,2,3 Bioid (Bd) is morphogeneti protein tht instruts
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationParathyroid hormone related peptide is a naturally occurring, protein kinase A dependent angiogenesis inhibitor
Prthyroi hormone relte peptie is nturlly ourring, protein kinse A epenent ngiogenesis inhiitor MANJIRI M. BAKRE 1, YUHONG ZHU 1, HONG YIN 1, DOUG W. BURTON 2, ROBERT TERKELTAUB 2, LEONARD J. DEFTOS 2 &
More informationMacmillan Publishers Limited. All rights reserved
oi:1.138/nture11126 A tumour suppressor network relying on the polymine hypusine xis Cluio Suoppo 1 *, Cornelius Miething 2,3 *, Lis Linqvist 4, José Reyes 2, Cristin Ruse 2, Iris Appelmnn 2,3, Seungti
More informationPerception of Saudi dentists and lay people to altered smile esthetics
The Sui Dentl Journl (2013) 25, 13 21 King Su University The Sui Dentl Journl www.ksu.eu.s www.sieneiret.om ORIGINAL ARTICLE Pereption of Sui entists n ly people to ltere smile esthetis Neel Tli, *, Smr
More informationPellino3 targets the IRF7 pathway and facilitates autoregulation of TLR3- and viral-induced expression of type I interferons
Pellino3 trgets the pthwy n filittes utoregultion of TLR3- n virl-inue expression of type I interferons Jku Sienienko 1,, Ruihri Jkson 1,, Mrk Mellett 1,, Nezir Delgi 1, Shuo Yng 1, Bingwei Wng 1, Lis
More informationSupplemental Figures and Legends
Supplementl Figures n Legens Epigeneti trgeting of Hegehog trnsriptionl output through BET romoomin inhiition Yujie Tng 1,2, Shrreh Gholmin 2, Simone Shuert 1,2, Mine I. Willrson 3, Alex Lee 4, Prtiti
More informationLean, but not obese, fat is enriched for a unique population of regulatory T cells that affect metabolic parameters
Len, ut not oese, ft is enrihe for unique popultion of regultory T ells tht ffet metoli prmeters Mrkus Feuerer,5, Lur Herrero 2,5, Dniel Cipollett,4,5, Afi Nz 2, Jmie Wong,5, Ali Nyer 2, Jongsoon Lee 2,
More informationNeuroligin-1 dependent competition regulates cortical synaptogenesis and synapse number
Neuroligin- epenent ompetition regultes ortil synptogenesis n synpse numer Hyung-Be Kwon,3, Yevgeni Kozorovitskiy, Won-Jong Oh 2, Rui T Peixoto, Nzi Akhtr, Jessi L Sulnier, Chenghu Gu 2 & Bernro L Stini
More informationb-sitosterol activates Fas signaling in human breast cancer cells
ARTICLE IN PRESS Phytomeiine 14 (2007) 747 754 www.elsevier.e/phyme -Sitosterol tivtes Fs signling in humn rest ner ells A.B. Aw,, M. Chinnm, C.S. Fink, P.G. Brfor Deprtment of Exerise n Nutrition Sienes
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationc-abl inhibition mitigates diet-induced obesity through improving insulin sensitivity of subcutaneous fat in mice
Dietologi (7) :9 9 DOI.7/s--- ARTICLE -Al inhiition mitigtes iet-inue oesity through improving insulin sensitivity of suutneous ft in mie Rong Wu, & Jin-gung Sun, & Ji-qiu Wng & Binhu Li & Qingsong Liu
More informationletters to nature ... Modulation of HIV-1 replication by RNA interference
... Moultion of HIV-1 replition y RNA interferene Jen-Mr Jque, Krine Triques & Mrio Stevenson Progrm in Moleulr Meiine, University of Msshusetts Meil Shool, 373 Plnttion Street, Worester, Msshusetts 165,
More informationInhibition of mtor induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease
Inhiition of mtor indues utophgy nd redues toxiity of polyglutmine expnsions in fly nd mouse models of Huntington disese Brind Rvikumr 1,6, Corlie Vher 1,6, Zdenek Berger 1,2, Jnet E Dvies 1, Shouqing
More informationExtent to Which Crude Protein May Be Reduced in Corn-soybean Meal Broiler Diets Through Amino Acid Supplementation 1
Interntionl Journl of Poultry Siene 3 (): 46-50, 004 Asin Network for Sientifi Informtion 004 Extent to Whih Crue Protein My Be Reue in Corn-soyen Mel Broiler Diets Through Amino Ai Supplementtion 3 Jinlin
More informationComparative Performance of Broiler Chickens Fed Varying Levels of Palm Kernel Cake and Maize Offal
Pkistn Journl of Nutrition 3 (4): 254-257, 2004 Asin Network for Sientifi Informtion, 2004 Comprtive Performne of Broiler Chikens Fe Vrying Levels of Plm Kernel Cke n Mize Offl E.V. Ezieshi n J.M. Olomu
More informationMultiple sclerosis (MS) is a chronic, demyelinating, degenerative
Dign Intervent Riol 2005; 11:137-141 Turkish Soiety of Riology 2005?????????????????????? NEURORADIOLOGY ORIGINAL ARTICLE The effetiveness of mgnetiztion trnsfer tehnique in the evlution of ute plques
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationnature letters to nature ... Mechanism for the learning deficits in a mouse model of neurofibromatosis type 1 advance online publication
vne online pulition... Mehnism for the lerning efiits in mouse moel of neurofiromtosis type 1 Rui M. Cost*, Nikoli B. Feerov*, Jeff H. Kogn*, Geoffrey G. Murphy*, Joel Stern*, Msuo Ohno*, Rju Kuherlpti,
More informationAJ PUTT. Hematology. Chemistry. Species: Canine Gender: Female Year of Birth: 2013 Client: PUTT
Speies: Cnine Gender: Femle Yer of Birth: 2013 Client: PUTT Requisition #: 9034-12 Aession #: W2152816 Aount Code: 72364 Veterinrin: CARTER Pnel/Profile: Tik Pnel Add-on Senior Profile with L 4Dx Plus
More informationIntroduction to Study Designs II
Introdution to Study Designs II Commonly used study designs in publi helth & epidemiologi reserh Benjmin Rihrd H. Muthmbi, DrPH, MPH Stte HIV Epidemiologist HIV Epidemiology Investigtion Setion PA Deprtment
More informationHuman body epigenome maps reveal noncanonical DNA methylation variation
LETTER OPEN oi:.8/nture65 Humn oy epigenome mps revel nonnonil DNA methyltion vrition Mtthew D. Shultz, {*, Yupeng He, *, John W. Whitker {, Mnoj Hrihrn, Ern A. Mukmel,5, Dnny Leung 6, Nish Rjgopl 6, Joseph
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationShort term pre and post operative stress prolongs incision induced pain hypersensitivity without changing basal pain perception
Co et l. Mol Pin () 11:73 DOI 1.11/s99--77-3 Moleulr Pin RESEARCH Open Aess Short term pre n post opertive stress prolongs inision inue pin hypersensitivity without hnging sl pin pereption Jing Co 1,,
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationER-α36 mediates cisplatin resistance in breast cancer cells through EGFR/HER-2/ ERK signaling pathway
Zhu et l. Journl of Experimentl & Clinil Cner Reserh (218) 37:123 https://oi.org/1.1186/s134618798z RESEARCH Open Aess ERα36 meites ispltin resistne in rest ner ells through /HER2/ signling pthwy Linlin
More informationSupplementary information to accompany the manuscript entitled:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementry informtion to ompny the mnusript entitled: A mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationCapsid-specific T-cell Responses to Natural Infections With Adeno-associated Viruses in Humans Differ From Those of Nonhuman Primates
originl rtile See pge 1923 Cpsi-speifi T-ell Responses to Nturl Infetions With Aeno-ssoite Viruses in Humns Differ From Those of Nonhumn Primtes Hu Li 1, Mrio O Lsro 1, Bei Ji 1,2, Shih Wen Lin 1,3, Lriss
More information