*** DMSO DAPT. JAG-FC (ug/ml) Fold change in RLU. Fold change in RLU JAG1-Fc Wnt1 CM 1.2. Fold change in expression
|
|
|
- Norman Powell
- 6 years ago
- Views:
Transcription
1 A DMSO DAPT C JAGFC (ug/ml) D 5 6 JAG1Fc Wnt1 CM Fold change in expression *** * JAG1Fc Wnt1 CM JAG1Fc Dvl2 Fig. S1. Dishevelled inhibits Notch signalling. (A) SHEPRPJkLuc cells were cultured on plastic treated with different concentrations of JAG1Fc ligand for 24 hours before analysing luciferase activity. DAPT (4 mm) was added as indicated to inhibit gsecretase function. Data are presented as mean fold change (±s.e.m.) in relative luciferase units (RLU) compared with control cells cultured on plastic treated with mg/ml Jag1Fc ligand. Immobilised JAG1Fc induced luciferase expression in a dosedependent manner that was abolished by DAPT treatment. (,C) SHEPRPJk Luc cells were cultured for 24 hours on plastic treated with 2 mg/ml JAG1Fc and treated with conditioned medium from control or Wnt1expressing SHEP cells for the last 12 hours before lysis. () Data are presented as mean fold change (±s.e.m.) in relative luciferase units (RLU) compared with control cells. Jag1Fcinduced luciferase expression was lower after treatment with Wnt1conditioned medium (twotailed ttest). (C) qrtpcr analysis of Notch target, HES1, in SHEP RPJkLuc cells. Expression was normalised to HPRT1. Data are presented as mean fold change (±s.e.m.) in normalised expression values relative to control cells. HES1 expression was significantly reduced in cells treated with Wnt1 conditioned medium (twotailed ttest). (D) Control or Dvl2expressing SHEPRPJkLuc cells were cultured on plastic treated with the soluble ligand JAG1Fc. Data are presented as mean fold change (±s.e.m.) in ligandinduced reporter activity [measured in relative luciferase units (RLU)] compared with control cells. Notch signalling was significantly lower in Dvl2expressing cells than controls (twotailed ttest). P=.52, *P<.5, ***P<.1.
2 A 12 TOPflash Wnt1 Dvl2 βcat TOPflash KCl LiCl DMSO S Fig. S2. Activation of Wnt signalling by Wnt pathway components and GSK3b inhibitors. HEK 293T cells were transfected with the Wnt reporter construct (TOPflash) and a Renilla luciferase control construct (prlcmv). Wnt signalling was activated by cotransfection of vectors encoding Wnt pathway components or drug treatments, as indicated. Data are presented as mean fold increase in relative luciferase units (RLU), relative to the corresponding negative control. (A) Expression of Wnt pathway components activates signalling. Fold increase in RLU in response to expression of mwnt1, mdvl2, S45F mbcatenin (bcat) or empty vector control. () GSK3b inhibitors activate Wnt signalling. Cells were treated overnight with 2 mm LiCl or 1 mm S (S) to inhibit GSK3b, and the respective controls of 2 mm KCl or DMSO are shown. These are the same conditions used to active Wnt signalling as in Fig. 1.
3 A 2.5 RPJκLuc NmN1 GSK3β K85R TOPflash GSK3β K85R Fig. S3. GSK3b K85R does not inhibit Notch signalling. (A) GSK3b K85R expression does not inhibit Notch signalling. CHOK1 cells were transfected with the RPJkreporter construct (RPJkLuc) and a Renilla luciferase control construct (prlcmv). Notch and Wnt signalling were activated by expression of DNmN1 and GSK3b K85R. Data are presented as mean fold change (±s.e.m.) in relative luciferase units (RLU) compared with DNmN1 alone. GSK3b K85R did not inhibit DNmN1 activity (P>.5). () Activation of Wnt signalling by GSK3b K85R. Cells were transfected with the Wnt reporter construct (TOPflash) and prlcmv. Wnt signalling was activated by expression of GSK3b K85R. Data are presented as mean fold increase in relative luciferase units (RLU), relative to the negative control.
4 A * * XNICD XNICD XDvl2 Fig. S4. Dishevelled rescues the XNICD phenotype in vivo. (A,) Anterior views of the same Xenopus embryos that are shown in Fig. 2F,H. The injected side is marked with an asterisk. Scale bar: 5 mm. A NmN1 TM ANK NCR C238 C351 C Fold change RLU ** ** **.2 Dvl2 NmN1 C238 NmN1 C351 NmN1 C425 Fig. S5. Dishevelled inhibits DNmN1 Cterminal deletion mutants. (A) Schematic of the Notch constructs used in the Cterminal deletion study. TM, transmembrane domain; ANK, Ankyrin repeats. () CHOK1 cells were transfected with the RPJkreporter construct (RPJkLuc) and a Renilla luciferase control construct (prlcmv). Notch and Wnt signalling were activated by expression of mdvl2 with DNmN1 or one of the DNmN1 deletion constructs: DC238, DC351 and DC425. Data are presented as mean fold change (±s.e.m.) in relative luciferase units (RLU), relative to each construct expressed alone. Dishevelled significantly inhibited each Notch construct (**P<.1, oneway ANOVA and Tukey s posthoc test).
5 A Fold change RLU Dvl2 UASLuc GAL4VP16 MAMLGAL Wnt1HA Dvl2V5 MAML1 MAML2 42 HA 95 V5 52 Tubulin Fig. S6. Dishevelled does not inhibit MAML. (A) CHOK1 cells were transfected with the GAL4reporter construct (UASLuc) and a Renilla luciferase control construct (prlcmv). The transcriptional reporter was activated by coexpression of either GAL4VP16 or MAMLGAL4. Data are presented as mean fold change (±s.e.m.) in relative luciferase units (RLU), relative to each construct expressed alone. Dishevelled coexpression did not inhibit the activity of either construct (P>.5). () Wnt signalling does not reduce the expression of MAML. Cells were transfected with expression constructs encoding either Wnt1HA or Dvl2V5. Lysates were analysed by immunoblotting to examine the expression of endogenous MAML1 and MAML2. HA, V5 and Tubulin are shown as controls. The position of molecular weight markers are shown (in kda).
6 A C Dvl2 VP16RPJκ *** *** VP16RPJκ K275M i ii V5 GFP Hoescht Merge VP16RPJκ Dvl2V5 VP16RPJκGFP VP16RPJκGFP Dvl2V5 VP16RPJκ K275M Dvl2V5 75 VP16 75 VP16 15 V5 15 V5 Lysate IP:V5 Lysate IP:V5 Fig. S7. Dishevelled inhibits CSL transcription factors. (A) Dishevelled inhibits a VP16RPJk molecule that cannot bind NICD. CHOK1 cells were transfected with RPJkLuc and prlcmv. Notch and Wnt signalling were activated by cotransfection of vectors encoding VP16RPJk or VP16RPJkK275M and mdvl2, as indicated. Data are presented as mean fold change (±s.e.m.) in relative luciferase units (RLU), relative to each RPJk molecule alone. mdvl2 inhibited both VP16RPJk constructs (***P<.1, oneway ANOVA and Tukey s posthoc test). () Dishevelled does not alter the nuclear localisation of RPJk. Cells expressing VP16RPJkGFP and mdvl2v5, as indicated, were fixed and immunostained for GFP (green) and V5 (red) epitopes. (C,D) Dishevelled binds RPJk and a form of RPJk that cannot bind NICD. CHOK1 cells expressing mdvl2v5 and VP16RPJk (C) or VP16RPJkK275M (D) were subjected to immunoprecipitation (IP) using V5 antibody. IP samples were analysed by western blotting with V5 and VP16 antibodies, alongside total lysates. Positions of molecular weight markers (in kda) are shown.
7 Table S1. Molecular cloning primers used Primer name N1 521F N1 5589R N1 597F N1 64R mβcat S45FF mβcat S45FR mβcat 1914F mβcat 2555R RPJκ K275MF RPJκ K275MR hn4 4357F hn4 4563R RPJκ gliif RPJκ gliir T7 GHR mdvl2 132R mdvl2 1654F mdvl2 793F mdvl2 1668R mmaml1 176F mmaml1 548R Sequence TAGTAAGCTTGTGAAGAGTGAGCCGGTGGA TGCTGCTGAGTCCACTGTCT AGGGTGTCTTCCAGATCCTGCTCCG TACGCTCGAGGTTGTACTCATCCAAAAGCCGCACG ACCACCACAGCTCCTTTCCTGAGTGGCAAGGGC GCCGTTGCCACTCAGGAAAGGAGCTGTGGTGGT GAGATAGTAGAAGGGTGTACTGG CCTACTCGAGGTCAGTATCAAACCAGG CGGGCAGACTGTCATGCTTGTGTGCTCAGTG CACTGAGCACACAAGCATGACAGTCTGCCCG TACCAAGCTTCCCCTGCTGCCTGGACCA AGGCCGTCGAGTGAAACCA CAGTAAGATCTATGCCCTCCGGTTTTCCT CTGAAGATCTGGACACCACGGTTGCTGT TAATACGACTCACTATAGGG TAGAAGGCACAGTCGAGG GATCGGCGCCCGCCATGGTCTCGCT GATCGCCGGCTGTGAGAGTTAC ACTGAGCAGAGCAGTGCCT CACGCTCGAGGTAACTCTCACAGCCACCA GATCGGCCATGGAGGCCATCGCGGGCGCTGGAGGC AGTTGTGTGAAACAGAGT
8 Table S2. qrtpcr primers used Gene Forward primer sequence Reverse primer sequence HES1 AAAGATAGCTCGCGGCATT TGCTTCACTGTCATTTCCAGA HEY1 TATCGGAGTTTGGGATTTCG GCATCTAGTCCTTCAATGATG CT HPRT1 CC TGACCTTGATTTATTTTGCATA CGAGCAAGACGTTCAGTACT atubulin GCAGGAAAGCATGTCCCCA TGGCAGCATCTTCCTTTCCA esr1 CAGCACCAGCTCACAGTGCA GCGCATCTTTTCCACAATGG rpl8 TACGCCACCGTTATCTCCCA CGACCACCACCAGCAACAAC Table S3. Primary antibodies used Antigen βgal Renilla luciferase CleavedNotch1 (NICD Val 1744) Dvl2 GFP Lamin1 myc (4A6 clone) RPJκ (clone T679) VP16 V5 Tubulin Source Promega, Madison, USA Millipore, illerica, USA Rockland Immunochemicals, Gilbertsville, USA Cell Signaling Technology, Danvers, USA Invitrogen, Carlsbad, USA Abcam, Cambridge, UK Millipore Institute of Immunology Co, Tokyo, Japan Santa Cruz iotechnology California, USA Invitrogen Keith Gull, University of Manchester, UK
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Data Sheet. Notch Pathway Reporter Kit Catalog # 60509
Data Sheet Notch Pathway Reporter Kit Catalog # 60509 6042 Cornerstone Court W, Ste B Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. NOTCH signaling
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
SUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human
Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human dpasmcs (a) and PAECs (b) treated with IL-1β (1 ng ml -1
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
A. List of selected proteins with high SILAC (H/L) ratios identified in mass
Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:
Supplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
Supplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643
Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Supplementary. limb. bars
Figure 1. CD163 -/- mice exhibit a similar phenotype ass WT mice in the absence of ischemic injury. a, Laser Doppler analysiss with perfusion quantitation at baseline (n= =10 per group). b, Immunostaining
Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652
Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
In canonical Wnt signaling, Dishevelled (Dvl) is a critical
Published Online: 17 March, 2008 Supp Info: http://doi.org/10.1083/jcb.200710050 Downloaded from jcb.rupress.org on September 11, 2018 JCB: ARTICLE Nuclear Dvl, c-jun, -catenin, and TCF form a complex
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
The official electronic file of this thesis or dissertation is maintained by the University Libraries on behalf of The Graduate School at Stony Brook
Stony Brook University The official electronic file of this thesis or dissertation is maintained by the University Libraries on behalf of The Graduate School at Stony Brook University. Alll Rigghht tss
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Supporting Information online
Supporting Information online THE RIVER BLINDNESS DRUG IVERMECTIN AND RELATED MACROCYCLIC LACTONES INHIBIT WNT-TCF PATHWAY RESPONSES IN HUMAN CANCER Alice Melotti, Christophe Mas, Monika Kuciak, Aiala
PAWS1 controls Wnt signalling through association with casein kinase 1a
Article PAWS1 controls Wnt signalling through association with casein kinase 1a Polyxeni Bozatzi 1,, Kevin S Dingwell 2,, Kevin ZL Wu 1, Fay Cooper 2, Timothy D Cummins 1, Luke D Hutchinson 1, Janis Vogt
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in
Supporting Information
Supporting Information ou et al..73/pnas.08791112 dd Thymidine Release & transfection dd Thymidine Release dd MG132 Fix and IF -14 h 0 h 8 h 24 h 34 h 36 h siontrol simps1-1 simps1-1 simps1-1 simps1-2
Appendix. Table of Contents
Appendix Table of Contents Appendix Figures Figure S1: Gp78 is not required for the degradation of mcherry-cl1 in Hela Cells. Figure S2: Indel formation in the MARCH6 sgrna targeted HeLa clones. Figure
/05/$15.00/0 Molecular Endocrinology 19(10): Copyright 2005 by The Endocrine Society doi: /me
0888-8809/05/$15.00/0 Molecular Endocrinology 19(10):2610 2623 Printed in U.S.A. Copyright 2005 by The Endocrine Society doi: 10.1210/me.2005-0047 Activin Regulates Luteinizing Hormone -Subunit Gene Expression
Silencing neurotransmission with membrane-tethered toxins
nature methods Silencing neurotransmission with membrane-tethered toxins Sebastian Auer, Annika S Stürzebecher, René Jüttner, Julio Santos-Torres, Christina Hanack, Silke Frahm, Beate Liehl & Inés Ibañez-Tallon
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Your Partner in Proteomics. Reporter System Luciferase Reporter Stable Cell Lines One-Step Luc Assay Kit Stable Cell Lines.
Reporter System Luciferase Reporter Stable Cell Lines One-Step Luc Assay Kit Stable Cell Lines www.abeomics.com Reporter Cell Lines Reporter cell lines are used for cell-based assays for screening of drugs/compounds
Supplemental Information. Lck/Hck/Fgr-Mediated Tyrosine. Phosphorylation Negatively Regulates. TBK1 to Restrain Innate Antiviral Responses
Cell Host & Microbe, Volume 21 Supplemental Information Lck/Hck/FgrMediated Tyrosine Phosphorylation Negatively Regulates to Restrain Innate Antiviral Responses Shengduo Liu, Shasha Chen, Xinran Li, Shiying
Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway
Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway S1 Oleksi Petrenko and Ute M. Moll Figure S1. MIF-Deficient Cells Have Reduced Transforming Ability (A) Soft
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Nature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD
Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +
FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP
Daam2 Is Required for Dorsal Patterning via Modulation of Canonical Wnt Signaling in the Developing Spinal Cord
Article Is Required for Dorsal Patterning via Modulation of Canonical Wnt Signaling in the Developing Spinal Cord Hyun Kyoung Lee 1 and Benjamin Deneen 1,2, * 1 Center for Cell and Gene Therapy 2 Department
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
SUPPLEMENTARY MATERIAL
SYPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY MATERIAL Figure S1. Phylogenic studies of the mir-183/96/182 cluster and 3 -UTR of Casp2. (A) Genomic arrangement of the mir-183/96/182 cluster in vertebrates.
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer