POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia

Size: px

Start display at page:

Download "POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia"

Anne Beverley Bishop
6 years ago
Views:

1 POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia Andrew J. Ramsay, Víctor Quesada, Miguel Foronda, Laura Conde, Alejandra Martínez-Trillos, Neus Villamor, David Rodríguez, Agnieszka Kwarciak, Cecilia Garabaya, Mercedes Gallardo, Mónica López-Guerra, Armando López-Guillermo, Xose S. Puente, María A. Blasco, Elías Campo and Carlos López-Otín Supplementary Material Supplementary Tables 1-6 Supplementary Figures 1-4 1

2 Supplementary Table 1. Somatic mutations in POT1-mutated samples Case Gene Chr Position Reference Found Mut 006 AC C M T185N 006 APH1B C Y T27I 006 ATM C G L2033V 006 BOD1L G R G1895E 006 C12orf C M A613E 006 C3orf A M splicing-site 006 COL4A T Y C1551R 006 CTNNA A R K855E 006 CTSO G R S249N 006 DDAH G R G270R 006 DOCK G R E1608K 006 GJB G R R32H 006 GNAI C Y A101V 006 HHLA A R I14V 006 NLRP G R V239M 006 OR10C G R V115M 006 PCDHA C M L409M 006 POT A R Y223C 006 RELN G R D368N 006 RIMS C M P889T 006 RRBP C Y A688V 006 SF3B A W N626Y 006 SI G S R91T 006 TMEM194A G R S152N 013 ABHD G R G392S 013 ADAM A W E181D 013 ADAMTS T W W669R 013 ARHGAP C Y T715I 013 DTNA G S E753Q 013 GBP C Y splicing-site 013 GRM G R A184T 013 IKZF T K L162R 013 NPBWR C Y T78M 013 ODZ C M S543* 013 PCDH G K M4I 013 POT T W Y36N 013 POU3F4 X C Y R279C 013 TEAD * -GC P144fs 013 USP G R S356N 044 BIRC T K L3687R 044 DNAH C Y A2694V 044 ECE G R S672N 2

3 044 KIAA C Y R1188W 044 OR4C C Y R231W 044 PCDHA G K D376Y 044 PENK C Y R229W 044 POT T W splicing-site 044 ROBO C M Q569K 044 SECISBP A R K15R 044 TMEM C S S1256C 044 UGT2B A R I331V 157 ABCA C Y P1342L 157 ABCD A R E374G 157 CBS G K E104D 157 COG G K V689F 157 CORO1C C S T485R 157 GFRA C M Q227K 157 HMCN C Y R394* 157 IRF C M S114R 157 MUC G S R2782T 157 OR2A T W V60D 157 PCSK G R R111Q 157 POT T K Y66* 157 TBPL A M S73R 157 USH2A C Y T2310M 184 AK G R R257H 184 AKT A M K172Q 184 C1orf C Y R386C 184 CFH G R V72I 184 HCN C Y T820M 184 KCTD T Y L202P 184 LRIG G R V811M 184 LRP C Y A65V 184 LRRC T T splicing-site 184 NOTCH * -CT P2515Rfs*4 184 POT A W M1L 184 QSER C Y Q161* 184 RAB5A A R D53G 184 RNF G R E292K 184 SLC38A T W L418H 3

4 Supplementary Table 2. Main clinical characteristics of the 341 patients with CLL Variable Category Gender Male /Female 206/135 Age, median (range) 57 (21-93) years Binet stage A 279 (82%) B 49 (14%) C 12 (4%) Rai stage (56%) I-II 134 (39%) III-IV 16 (5%) Lymphocytes (x10 9 /L), median (range) 12.4 ( ) Hemoglobin (g/l), median (range) 139 (63-175) Platelets (x10 9 /L), median (range) 197 (19-470) LDH >UNL 28/315 (9%) β 2- microglobulin >UNL 106/341 (36%) LDT < 1 year 48/275 (18%) CD38 High 105/290 (36%) ZAP-70 High 99/290 (34%) IGHV Unmutated 98/204 (48%) Genetic abnormality del(13)(q14.3) 89/208 (42%) del(11)(q22.3) 36/207(17%) /210 (15%) del(17)(p13.1) 7/209 (3%) SF3B1 Mutated 22/269 (9%) NOTCH1 Mutated 25/322 (7%) 10-year TTT (95% CI) Binet stage A 58% (50-66) 10-year OS (95% CI) All 66% (59-73) Follow-up, median (range) All 7.3 (0.6-26) years UNL: upper normal level; LDT: lymphocyte doubling time; CD38 high: >30% of positive CLL cells; ZAP-70 high: 20% of positive CLL cells; IGHV unmutated: 98% identity with germline; TTT: Time to treatment; OS: overall survival 4

5 Supplementary Table 3. Characteristics of CLL patients and tumor cells included in the experimental study of chromosomal alterations Age Sex POT1 IGHV ZAP- 70 CD38 17p deletion 11q deletion 13q deletion trisomy F Mutated Unmutated Normal 21% 92% Normal 59 M Mutated Unmutated Normal Normal 90% Normal 70 F Mutated Unmutated Normal Normal Normal Normal 56 M Mutated Unmutated Normal Normal Normal Normal 45 M Mutated Unmutated Normal Normal 34% Normal 75 M Mutated Unmutated 70 3 Normal Normal 44% Normal 68 F Unmutated Unmutated 63 1 Normal Normal Normal Normal 76 M Unmutated Unmutated 3 2 Normal Normal 22% Normal 48 M Unmutated Unmutated Normal Normal Normal Normal 79 M Unmutated Unmutated Normal Normal Normal Normal 74 M Unmutated Unmutated 14 1 Normal Normal 85% Normal 67 M Unmutated Unmutated 11 1 Normal 90% Normal Normal 5

6 Supplementary Table 4. Main clinical characteristics and outcome of the 341 patients with CLL according to their POT1 mutational status Parameter Category POT1 POT1 unmutated mutated P (n=329)* (n=12)* Gender Male (%) 197 (59%) 9 (75%) ns Age (years), median (range) 57 (21-93) 58 (33-80) ns Binet stage A 272 (83%) 7 (58%) B 44 (13%) 5 (42%) 0.02 C 12 (4%) 0 (0%) Rai stage (56%) 4 (52%) I-II 128 (39%) 6 (40%) ns III-IV 15 (5%) 1 (8%) Lymphocytes (x10 9 /L), median (range) 12.4 ( ) 17.4 (4.8-69) ns Hemoglobin (g/l), median (range) 139 (63-175) 126 ( ) ns Platelets (x10 9 /L), median (range) 198 (19-451) 171 ( ) ns LDH >UNL 26/304 (9%) 2/11 (18%) ns β 2 -microglobulin >UNL 100/280 (36%) 5/10 (50%) ns LDT < 1 year 35/187 (19%) 3/9 (34%) ns ZAP-70 >UNL 90/280 (31%) 9/10 (75%) IGHV Unmutated 89/195 (46%) 9/9 (100%) SF3B1 mutated 18/259 (7%) 4/10 (40%) NOTCH1 mutated 23/311 (7%) 2/11 (18%) ns 10-year TTT (95% CI) Binet stage A 57% (49-65) 100% ns 10-year OS (95% CI) All 67% (60-74) 40% (15-75) ns UNL: upper normal level; LDT: lymphocyte doubling time; TTT: time to treatment; OS: overall survival. 95% CI: 95% interval of confidence. * For several clinical correlates some patient data were unavailable. 6

7 Supplementary Table 5. POT1 oligonucleotide sequences used in Sanger sequencing validation Exon Primer 1 Primer 2 5 CAGCAGATATTCCAGACAACAGA AAGCATGTAATCACATTGGAGG 6 AATATGCATCAGTGTTGTTTGGC AGCTAAGCTGTGTGCATTGCC 7 AAAGCAGTGGTTTGTTCAAATG TTTGCAGTGTGTATTGAAAGCC 8 GCATGAATATTGAGGCTCGTC TTGGTTCGTAGGTTGTGCATC 9 TTGCTCTAACCCATTAAGTTTATCTTT AGTGCCAATATTCAGAGGCAT 10 ATTTGATTTGTTTCATTTGGCTC TTTCCTGACTGGTCAGTGCC 11 TTTGGCATAGGCCACAGAT AAATCTGATGAAAGCAATAGATCCTT 12 GCCAACAAGACACGGTAGAAG AGTTTCTCTCAGCAACGCTCC 13 TGAAAACGTTTGTTTTATTATGGAA TGGTTCAGGAGGATGCATGT 14 AGACAATCAGCTTAGCATTGACA GAAATCTTCACGCTTACACCAAA 15 TGCCTAATGCAGGTGACG ACCTCACACGTTATTTAATAGGACTG 16 TGCCTGCTTGAAGAAATACAGAC TTGTGAAACAAACAAGCACATTAC 17 GGGAATGACTCTTTAAATCCCTG ACCTGGAGATAATGCCAAGTTT 18 TTGGAAGCAAAGCTTTCAGAC ACAATCTTGATAGAGGGAAACTGTC 19 TTCTAATCCCATACCCATGCTAAC AATGTTAAATTTGGAAGGGACG 7

8 Supplementary Table 6. Sequences of the oligonucelotides used for mutagenesis of POT1 coding regions Mutation Y36N Forward Y36N Reverse Y223C Forward Y223C Reverse Oligonucelotide Sequence (5' to 3') GTTCTTTAAGCCCCCAAATCTAAGCAAAGGAAC GTTCCTTTGCTTAGATTTGGGGGCTTAAAGAAC GACAATAGACATTTTAGTCTGCGATAACCATGTTCATGTGGC GCCACATGAACATGGTTATCGCAGACTAAAATGTCTATTGTC 8

Supplementary Fig. 1 Supplementary Fig. 1. Biological properties of wild-type POT1 and Y36N and Y223C POT1 mutants.

(b) Representative immunoblot of HT1080 cells transiently infected with retroviral constructs encoding vector only, myc-tagged wild-type POT1, myc-tagged Y36N POT1 and myc-tagged Y223C POT1

(c) Representative images of relative telomere signal intensities observed in metaphase nuclei by telomere FISH staining (red=ttaggg, blue=dapi) of HT1080 cells transiently infected with

selection. (d) Telomerase activity in HT1080 cells expressing wild-type and mutant POT1 proteins.

9 Supplementary Fig. 1 Supplementary Fig. 1. Biological properties of wild-type POT1 and Y36N and Y223C POT1 mutants. (a) SDS-PAGE gel of 35 S-labeled wild-type and mutant POT1 proteins generated by in vitro translation. Vector refers to an empty vector reaction. (b) Representative immunoblot of HT1080 cells transiently infected with retroviral constructs encoding vector only, myc-tagged wild-type POT1, myc-tagged Y36N POT1 and myc-tagged Y223C POT1 proteins cultured for 45 population doublings. (c) Representative images of relative telomere signal intensities observed in metaphase nuclei by telomere FISH staining (red=ttaggg, blue=dapi) of HT1080 cells transiently infected with retroviral constructs encoding vector only, myc-tagged wild-type POT1, myc-tagged Y36N POT1 and myc-tagged Y223C POT1 proteins at 5 (top row) and 45 (bottom row) population doublings after selection. (d) Telomerase activity in HT1080 cells expressing wild-type and mutant POT1 proteins. A representative telomere restriction fragment (TRF) blot of HT1080 cells infected with retroviruses encoding vector only, wild-type POT1, Y223C POT1 or Y36N POT1 performed at the population doublings 5 and 45. The molecular size in kilobases is shown on the left. (e) Representative telomeric repeat amplification protocol (TRAP) assay in 5 µg and 1 µg of cell extract from the respective cell lines. Cell extracts (5 µg) treated with RNase (+) were used as negative controls. (f) Quantification of the TRAP assays shown in panel e. Bars depict means calculated from two technical replicates ± SEM. 9

Supplementary Fig. 2 Supplementary Fig. 2. Chromosomal aberrations in HT1080 cells expressing wild-type and mutant POT1 proteins.

HT1080 cells infected with retroviruses encoding vector only, wild-type POT1, Y36N POT1 or Y223C POT1 at population doublings 5, 15 and 45 by

Bars depict means of event per metaphase calculated from two independently derived cell lines ± SEM.

10 Supplementary Fig. 2 Supplementary Fig. 2. Chromosomal aberrations in HT1080 cells expressing wild-type and mutant POT1 proteins. (a-e) Quantitation of sister chromatid fusions, multitelomeric signals, chromosomal breaks, chromosome fusions and signal-free ends per metaphase in HT1080 cells infected with retroviruses encoding vector only, wild-type POT1, Y36N POT1 or Y223C POT1 at population doublings 5, 15 and 45 by telomere FISH staining. Hatched fill indicates analysis of the respective cell type at population doubling 15 when treated with 0.5 µm aphidicolin. Bars depict means of event per metaphase calculated from two independently derived cell lines ± SEM. Two-tailed Student s t test was performed for comparisons, P values are indicated. For comparative purposes, the red dashed line marks the mean value for HT1080 cells expressing wild-type POT1 at population doubling 5. 10

POT1-mutated CLL cells display unchanged telomere lengths and

(a) Mean telomere length in kilobases (Kb), as estimated by

patients displaying POT1 mutations in comparison to age-matched

Bars depict means calculated from the cells of 4 control

11 Supplementary Fig. 3 Supplementary Fig. 3. POT1-mutated CLL cells display unchanged telomere lengths and rates of telomere-deficient fusion. (a) Mean telomere length in kilobases (Kb), as estimated by QFISH of metaphase spreads, in purified B-cells from CLL patients displaying POT1 mutations in comparison to age-matched IGHV-unmutated samples (control). Bars depict means calculated from the cells of 4 control patients and 6 POT1-mutated patients ± SEM (a total of 25 metaphases were analyzed for each group), two-tailed Student s t test was performed, P values are indicated. (b) Telomerase activity in POT1-unmutated and POT111

12 mutated CLL patient cells. Bars depict patient means calculated from 3 controls and 6 POT1- mutated CLL samples ± SEM. Two-tailed Student s t test was performed for comparisons, P values are indicated. (c) Quantification of chromosome-type end-to-end fusions with no detectable TTAGGG signal. Top, representative image of a fusion with no detectable TTAGGG signal. (d) Quantification of the number of signal-free ends (SFEs) per metaphase on CLL samples by telomere FISH staining (red=ttaggg, blue=dapi). Top, representative image of a SFE. For graphs in c and d, bars depict per patient means calculated from 4 controls and 6 POT1-mutated CLL samples ± SEM. Two-tailed Student s t test was performed for comparisons, P values are indicated. POT1 mutations result in unresolved mitotic structures. (e) Right, representative image of a DNA bridge observed in interphase nuclei from POT1-mutated CLL cells. Yellow arrows indicate TTAGGG signals within DNA bridges. Left, quantification of DNA bridges using telomere FISH on interphase nuclei (red=ttaggg-cy3; blue=dapi) of B-cells from CLL patients displaying POT1 mutations (31/5692 interphase nuclei) in comparison to control cells (4/5951 interphase nuclei). (f) Right, representative image of a micronucleus (yellow arrow) in a POT1-mutated CLL cell. Left, quantification of micronuclei using telomere FISH on interphase nuclei (red=ttaggg- Cy3; blue=dapi) of B-cells from CLL patients displaying POT1 mutations (87/5692 interphase nuclei) in comparison to control cells (27/5951 interphase nuclei). (g) Right, representative image of a multilobulated nucleus (yellow arrow) in a POT1-mutated CLL cell. Left, quantification of multilobulated nuclei using telomere FISH on interphase nuclei (red=ttaggg-cy3; blue=dapi) of B-cells from CLL patients displaying POT1 mutations (83/5692 interphase nuclei) in comparison to control cells (33/5951 interphase nuclei). For the graphs in e, f and g, depicted are the total number of cellular events observed. χ 2 test with Yates correction was used for comparisons; P values are indicated on top of each comparison. 12

Supplementary Fig. 4 Supplementary Fig. 4. POT1-mutation does not induced telomeric DNA damage.

Red= detection of a somatic mutation in the respective patient; Grey= no somatic mutation found in the respective patient.

Representative immunofluorescence images of TIFs in B-cells from CLL patients displaying POT1 mutations (POT1 mutated) in comparison to control cells (control).

White arrowheads mark TIFs, characterized by co-localisation of 53BP1 with telomeres (TRF1).

13 Supplementary Fig. 4 Supplementary Fig. 4. POT1-mutation does not induced telomeric DNA damage. (a) Somatic mutations in POT1, other frequently mutated genes in CLL patients (NOTCH1, SF3B1, CHD2 and SI) and components of the p53 pathway (TP53, ATM, BCL2, APAF1, BAX, MDM2 and RB1). Red= detection of a somatic mutation in the respective patient; Grey= no somatic mutation found in the respective patient. (b) Unchanged levels of telomeredysfunction-induced foci (TIF) in POT1-mutated CLL cells. Representative immunofluorescence images of TIFs in B-cells from CLL patients displaying POT1 mutations (POT1 mutated) in comparison to control cells (control). Cells were fixed and costained with 53BP1 (green) and anti-trf1 (red) antibodies and the nuclei counterstained with DAPI (blue). White arrowheads mark TIFs, characterized by co-localisation of 53BP1 with telomeres (TRF1). (c) Quantification of TIFs present in B-cells from CLL patients displaying POT1 mutations (n=5) in comparison to control cells (n=6). Bars depict means ± SEM. (d) Quantification of TIFs present in three independently derived HT1080 cells infected with retroviruses encoding vector only, wild-type POT1, Y36N POT1 or Y223C POT1 at population doubling 45. Bars depict means ± SEM. No activation of the ATR pathway in HT1080 cells expressing mutant POT1 proteins. (e) Representative immunoblot of phosphorylated CHK1, myc and β-actin in HT1080 cells transiently infected with retroviral constructs encoding vector only, myc-tagged wild-type POT1, myc-tagged Y36N POT1 and myc-tagged Y223C POT1 proteins at 45 population doublings. 13

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech