Table S1. List of the genes regulated by thyroid hormones in intestinal crypt cells

Size: px
Start display at page:

Download "Table S1. List of the genes regulated by thyroid hormones in intestinal crypt cells"

Transcription

1 Table S1. List of the genes regulated by thyroid hormones in intestinal crypt cells Probeset ID Gene symbol Cell adhesion/extracellular matrix Gene title Fold change a pvalue a WT THvsPTU T-Test TRa0/0 vs WT-C TRb-/- vs WT-C _at Tgfbi Transforming growth factor. beta induced NC NC _at Mgp Matrix Gla protein NC NC _at Gp1bb Glycoprotein Ib. beta polypeptide * I NC _at Cfh Complement component factor h NC D _at Fga Fibrinogen. alpha polypeptide * NC D _at Cldn8 Claudin D D _at Amn Amnionless * D D _a_at Afm Afamin * D D _a_at Ttr Transthyretin * NC D _at Dab1 Disabled homolog 1 (Drosophila * NC NC Cell cycle control/proliferation _s_at Ccnb1 Cyclin B NC NC _at Aurka Aurora kinase A NC NC _at Dock5 Dedicator of cytokinesis 5 * I I _s_at Sesn1 Sestrin NC NC _at Cdc2a Cell division cycle 2 homolog A (S. pombe) NC NC _at Bub1b Budding uninhibited by benzimidazoles NC NC homolog. b (S. cerevisiae) _a_at Tacc3 Transforming. acidic coiled-coil containing NC NC protein _at Mad2l1 MAD2 (mitotic arrest deficient. homolog)-like NC NC (yeast) _at Ube2c Ubiquitin-conjugating enzyme E2C NC NC _at Ccna2 Cyclin A I NC _at Cdkn1c Cyclin-dependent kinase inhibitor 1C (P57) -4, D D _a_at Cenph Centromere protein H NC NC _at Cdk8 Cyclin-dependent kinase 8 * NC D Cell Signaling _at sfrp2 Secreted frizzled-related protein NC I _at Tlr3 Toll-like receptor 3 $ NC I _at Gng10 Guanine nucleotide binding protein (G protein) NC NC gamma _at Notch1 Notch gene homolog 1 (Drosophila) 2 MS NC NC _at Notch2 Notch gene homolog 2 (Drosophila) NC NC _at Fzd2 Frizzled homolog 2 (Drosophila) NC NC _x_at Wnt5b Wingless-related MMTV integration site 5B $ NC I _at Dkk3 Dickkopf homolog 3 (Xenopus laevis) $ NC I _at Epha4 Eph receptor A4 $ NC I _at Dvl1 Dishevelled 1, dsh homolog (Drosophila) 1.5 MS NC NC Down- regulated _x_at Marcksl1 MARCKS-like NC NC

2 _a_at Rab30 RAB30. member RAS oncogene family NC D _x_at Ndrg N-myc downstream regulated gene NC NC _at Bmp7 Bone morphogenetic protein 7 * D D _a_at Edn1 Endothelin 1 * NC D _at Fgf1 Fibroblast growth factor NC NC _at Acvr1b Activin A receptor type 1B * NC NC _s_at Gli2 GLI-Kruppel family member GLI2 $ NC D _a_at Fgf12 Fibroblast growth factor 12 $ NC D _at Bmp2 Bone morphogenetic protein 2 * NC I _at Pgrmc2 Progesterone receptor membrane component NC NC _s_at Csf1r Colony stimulating factor 1 receptor * NC D _at Sel1 Sel-1 suppressor of lin-12-like (C. elegans) NC NC _a_at FgfRl1 Fibroblast growth factor receptor-like 1 $ NC D _a_at EgfR Epidermal growth factor receptor $ NC D _s_at FgfR1 Fibroblast growth factor receptor 1 $ NC D _s_at Rhoc Ras homolog gene family. member C * NC NC Membrane proteins/transporters _at Lbp Lipopolysaccharide binding protein NC NC _a_at Slc13a1 Solute carrier family 13 (sodium/sulphate NC NC symporters). member _at Cd14 CD14 antigen NC NC _s_at Il17re Interleukin 17 receptor E NC I _a_at Kcne3 Potassium voltage-gated channel. Isk-related NC NC subfamily. gene _a_at Higd1a HIG1 domain family. member 1A NC NC _s_at Steap1 Six transmembrane epithelial antigen of the NC NC prostate _x_at sec61g SEC61. gamma subunit NC NC _a_at Lrig1 Leucine-rich repeats and immunoglobulin-like NC NC domains _at Abce1 ATP-binding cassette. sub-family E (OABP). member NC NC _a_at Pdzk1ip1 PDZK1 interacting protein 1 * D D _at Slc6a3 Solute carrier family 6 (neurotransmitter transporter. dopamine). member NC D _at Anxa13 Annexin A NC NC _at Abcb1a ATP-binding cassette. sub-family B (MDR/TAP). * D D member 1A _a_at Armcx1 Armadillo repeat containing. X-linked 1 * NC D _at Ctns Cystinosis. Nephropathic NC D _at Ptprd Protein tyrosine phosphatase. receptor type. D NC NC _at Abcg2 ATP-binding cassette. sub-family G (WHITE). * NC D member _s_at Tgoln1 Trans-golgi network protein /// trans-golgi * D D network protein _at Slc18a1 Solute carrier family 18 (vesicular monoamine). member NC NC Metabolism _at Upp1 Uridine phosphorylase NC NC _at Galgt2 Galactosyl-N-acetylglucosaminylpolypeptidebeta-1, NC NC 4-N-acetylgalactosaminyltransferase

3 _at Letm1 Leucine zipper-ef-hand containing I NC transmembrane protein _a_at Psmb8 Proteosome (prosome, macropain) subunit, beta NC NC type _s_at Gfm1 G elongation factor mitochondrial 1 * I NC _at Paics Phosphoribosylaminoimidazole carboxylase * NC NC _a_at Cyb5r1 Cytochrome b5 reductase 1 * NC NC _x_at Pgd Phosphogluconate dehydrogenase * NC NC _at Pkm2 Pyruvate kinase. muscle NC NC _at D19Wsu12e DNA segment. Chr 19. Wayne State University NC NC 12. expressed _at Shmt2 Serine hydroxymethyl transferase 2 * NC D (mitochondrial) _at Mthfd2 Methylenetetrahydrofolate dehydrogenase (NAD+ * NC I dependent) _s_at Idh3a Isocitrate dehydrogenase 3 (NAD+) alpha * NC NC _at Dhrs7 Dehydrogenase/reductase (SDR family) member * NC NC _at Psma1 Proteasome (prosome. macropain) subunit. alpha NC NC type _at Ndufb3 NADH dehydrogenase (ubiquinone) 1 beta NC NC subcomplex _s_at Gsta1 Glutathione S-transferase. alpha 1 (Ya) NC NC _at Ucp2 Uncoupling protein 2 (mitochondrial. proton NC NC carrier) _a_at Mod1 Malic enzyme supernatant * NC NC _a_at March5 Membrane-associated ring finger (C3HC4) NC NC _at Abhd6 Abhydrolase domain containing NC NC _at Ndufa5 NADH dehydrogenase (ubiquinone) 1 alpha NC NC subcomplex, _at Elovl6 ELOVL family member 6. elongation of long NC NC chain fatty acids (yeast) _at Acss2 Acyl-CoA synthetase short-chain family member NC NC _at Cycs Cytochrome c. somatic * NC NC _a_at Umps Uridine monophosphate synthetase NC NC Down regulated _at Rdh7 Retinol dehydrogenase NC NC _at Aldh1a1 Aldehyde dehydrogenase family 1. subfamily A NC NC _at Acot1 Acyl-CoA thioesterase NC D _at Aldh1a7 Aldehyde dehydrogenase family 1. subfamily A I NC _s_at Gstm3 Glutathione S-transferase. mu NC D _a_at Hmgcs2 3-hydroxy-3-methylglutaryl-Coenzyme A NC NC synthase _at Vnn1 Vanin NC NC _at Stard5 StAR-related lipid transfer (START) domain NC NC containing _at Prkg2 Protein kinase. cgmp-dependent. type II * NC NC _at Ass1 Argininosuccinate synthetase NC NC _at Btd Biotinidase NC NC _a_at Faah Fatty acid amide hydrolase NC NC _x_at Cyp4f16 cytochrome P450. family 4. subfamily f. * NC NC polypeptide _at Pipox Pipecolic acid oxidase NC NC _at Nnt Nicotinamide nucleotide transhydrogenase NC NC _at Slc25a36 Solute carrier family 25. member 36 * D D _at Adh1 Alcohol dehydrogenase 1 (class I) NC NC _at Akr1c13 Aldo-keto reductase family 1. member C NC D _at Gstm4 Glutathione S-transferase. mu NC NC

4 _at Gyk Glycerol kinase NC NC _a_at Limk2 LIM motif-containing protein kinase 2 * NC NC _a_at Scpep1 Serine carboxypeptidase 1 * NC NC _x_at Aco1 Aconitase 1 * NC NC _at Acss1 Acyl-CoA synthetase short-chain family member NC NC _at Man1a Mannosidase 1. alpha NC D _at Gcnt2 Glucosaminyl (N-acetyl) transferase 2. I NC D branching enzyme _at Pank3 Pantothenate kinase 3 (Pank3), mrna NC NC _at Pklr Pyruvate kinase liver and red blood cell NC D _at Aldh6a1 Aldehyde dehydrogenase family 6. subfamily A NC NC _x_at Aldh18a1 Aldehyde dehydrogenase 18 family, member A NC I Nucleic Acid Metabolism _at Rbm14 RNA binding motif protein NC NC _at Pola1 Polymerase (DNA directed). alpha NC NC _at Apobec3 Apolipoprotein B editing complex NC NC _at Rrm1 Ribonucleotide reductase M NC NC _a_at Apobec1 Apolipoprotein B editing complex MS NC NC _at Piwil2 Piwi-like homolog 2 (Drosophila) * NC D _at Rnase4 Ribonuclease, RNase A family 4 * NC D Stress and apoptosis _a_at Hsp110 Heat shock protein NC NC _at Dffb DNA fragmentation factor. beta subunit $ I I _at Gpx2 Glutathione peroxidase NC NC _at Tnfrsf14 Tumor necrosis factor receptor superfamily. * I NC member _s_at Hspe1 Heat shock protein 1 (chaperonin 10) NC NC _at Hif3a Hypoxia inducible factor 3. alpha subunit NC NC _at Cat catalase NC D _at Sgk3 Serum/glucocorticoid regulated kinase 3 * NC D _at Ddit4 DNA-damage-inducible transcript I NC Transcriptional regulation _a_at Zbtb20 Zinc finger and BTB domain containing 20 $ I I _s_at Zfp654 Zinc finger protein NC NC _at Fos FBJ osteosarcoma oncogene NC I _at Hes2 Hairy and enhancer of split 2 (Drosophila) $ NC I _a_at Ctnnb1 Catenin (cadherin associated protein) beta NC I _a_at Surb7 SRB7 (suppressor of RNA polymerase B) NC NC homolog (S. cerevisiae) _at Asf1b ASF1 anti-silencing function 1 homolog B (S NC NC cerevisiae) _a_at Cenpa Centromere protein A NC NC _at Klf9 Kruppel-like factor 9 $ NC I _at Hes1 Hairy and enhancer of split 1 (Drosophila) 1.5 MS NC NC

5 _at Neurod1 Neurogenic differentiation NC NC _at Tcf23 Transcription factor NC D _at Tcfec Transcription factor EC * NC D _at FoxP1 Forkhead box P1. full insert sequence NC NC _a_at Sox10 SRY-box containing gene 10 $ NC D _at Cxxc5 CXXC finger NC NC _s_at Hnf4a Hepatic nuclear factor 4, alpha # NC NC _a_at Srebf1 Sterol regulatory element binding factor 1 # NC NC _a_at Nkx2-3 NK2 transcription factor related, locus 3 $ NC D (Drosophila) _at Cdx2 Caudal type homeo box 2 $ NC D _a_at Tcf4 Transcription factor 4 $ NC D Miscellaneous _at Sh3bgr SH3-binding domain glutamic acid-rich protein NC NC _at Gm1 Gene model 1, (NCBI) * NC NC _a_at Oact1 O-acyltransferase (membrane bound) domain NC NC containing _at Kif4 Kinesin family member NC NC _at Dnclc1 Dynein, cytoplasmic, light chain I NC _at Arpp19 camp-regulated phosphoprotein NC NC _a_at Cryz Crystallin. Zeta * NC NC _at Adamts1 A disintegrin-like and metallopeptidase with # NC I thrombospondin type 1 motif _at Ankmy2 Ankyrin repeat and MYND domain containing 2 # NC NC _a_at Dab2 Disabled homolog 2 (Drosophila) * NC NC _at Lrrc50 Leucine rich repeat containing NC NC _a_at Fmo5 Flavin containing monooxygenase 5 * NC NC _at Vat1 Vesicle amine transport protein 1 homolog (T NC NC californica) _at Pxmp4 Peroxisomal membrane protein NC D _at Spfh1 SPFH domain family. member NC NC _at Atp13a3 ATPase type 13A3 * NC NC a: we filtered for a pvalue<0.05 and a fold change of at least 50%. *: Comparison WT-TH vs WT-C $: Comparison TRb-/- vs WT-C; #: Comparison WT-PTU vs WT-C. NC: not changed; I: significantly increased; D: significantly decreased MS: marginally significant Cell cycle control/proliferation Transcriptional regulation Cell Signaling Nucleic Acid Metabolism Stress and apoptosis Metabolism Cell adhesion/extracellular matrix Membrane proteins/transporters

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain

More information

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Maturity-onset diabetes of the young (MODY) is a heterogeneous group

Maturity-onset diabetes of the young (MODY) is a heterogeneous group Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the

More information

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical

More information

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death

SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation

More information

BIOL 158: BIOLOGICAL CHEMISTRY II

BIOL 158: BIOLOGICAL CHEMISTRY II BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an

More information

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001

BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The

More information

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

doi: /nature09493

doi: /nature09493 SUPPLEMENTARY INFORMATION doi:10.1038/nature09493 Supplementary Fig. 1 Inductive role of liver sinusoidal endothelial cell (LSEC)-derived angiocrine signal in liver regeneration. LSECs lining the liver

More information

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2

More information

7 Pathways That Harvest Chemical Energy

7 Pathways That Harvest Chemical Energy 7 Pathways That Harvest Chemical Energy Pathways That Harvest Chemical Energy How Does Glucose Oxidation Release Chemical Energy? What Are the Aerobic Pathways of Glucose Metabolism? How Is Energy Harvested

More information

Citric acid cycle and respiratory chain. Pavla Balínová

Citric acid cycle and respiratory chain. Pavla Balínová Citric acid cycle and respiratory chain Pavla Balínová Mitochondria Structure of mitochondria: Outer membrane Inner membrane (folded) Matrix space (mtdna, ribosomes, enzymes of CAC, β-oxidation of FA,

More information

BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION

BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your

More information

Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B

Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal 24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of

More information

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

More information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S2. b-galactosidase staining of SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

More information

PCB 3023 Exam 4 - Form A First and Last Name

PCB 3023 Exam 4 - Form A First and Last Name PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb) Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer

More information

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A). Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease

More information

Electron Transport Chain and Oxidative phosphorylation

Electron Transport Chain and Oxidative phosphorylation Electron Transport Chain and Oxidative phosphorylation So far we have discussed the catabolism involving oxidation of 6 carbons of glucose to CO 2 via glycolysis and CAC without any oxygen molecule directly

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer

More information

* Kyoto Encyclopedia of Genes and Genomes.

* Kyoto Encyclopedia of Genes and Genomes. Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

More information

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points. BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which

More information

Supplemental Data. NKp46 Identifies an NKT Cell Subset Susceptible to Leukemic Transformation in Mouse and Man

Supplemental Data. NKp46 Identifies an NKT Cell Subset Susceptible to Leukemic Transformation in Mouse and Man Supplemental Data NKp46 Identifies an NKT Cell Subset Susceptible to Leukemic Transformation in Mouse and Man Jianhua Yu 1,2*, Takeki Mitsui 1,3*, Min Wei 1, Hsiaoyin Mao 1, Jonathan P Butchar 4, Mithun

More information

WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA

WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure

More information

Electron transport chain chapter 6 (page 73) BCH 340 lecture 6

Electron transport chain chapter 6 (page 73) BCH 340 lecture 6 Electron transport chain chapter 6 (page 73) BCH 340 lecture 6 The Metabolic Pathway of Cellular Respiration All of the reactions involved in cellular respiration can be grouped into three main stages

More information

CHE 242 Exam 3 Practice Questions

CHE 242 Exam 3 Practice Questions CHE 242 Exam 3 Practice Questions Glucose metabolism 1. Below is depicted glucose catabolism. Indicate on the pathways the following: A) which reaction(s) of glycolysis are irreversible B) where energy

More information

CELL BIOLOGY - CLUTCH CH AEROBIC RESPIRATION.

CELL BIOLOGY - CLUTCH CH AEROBIC RESPIRATION. !! www.clutchprep.com CONCEPT: OVERVIEW OF AEROBIC RESPIRATION Cellular respiration is a series of reactions involving electron transfers to breakdown molecules for (ATP) 1. Glycolytic pathway: Glycolysis

More information

Zool 3200: Cell Biology Exam 4 Part I 2/3/15

Zool 3200: Cell Biology Exam 4 Part I 2/3/15 Name: Key Trask Zool 3200: Cell Biology Exam 4 Part I 2/3/15 Answer each of the following questions in the space provided, explaining your answers when asked to do so; circle the correct answer or answers

More information

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name 5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

More information

2. What is molecular oxygen directly converted into? a. Carbon Dioxide b. Water c. Glucose d. None of the Above

2. What is molecular oxygen directly converted into? a. Carbon Dioxide b. Water c. Glucose d. None of the Above Biochem 1 Mock Exam 3 Chapter 11: 1. What is glucose completely oxidized into? a. Carbon Dioxide and Water b. Carbon Dioxide and Oxygen c. Oxygen and Water d. Water and Glycogen 2. What is molecular oxygen

More information

Under aerobic conditions, pyruvate enters the mitochondria where it is converted into acetyl CoA.

Under aerobic conditions, pyruvate enters the mitochondria where it is converted into acetyl CoA. Under aerobic conditions, pyruvate enters the mitochondria where it is converted into acetyl CoA. Acetyl CoA is the fuel for the citric acid cycle, which processes the two carbon acetyl unit to two molecules

More information

) one consumes in breathing is converted to:, which of the following would be found in the oxidized state?

) one consumes in breathing is converted to:, which of the following would be found in the oxidized state? MCB 102: Pantea s Sxn Chapter 19 Problem Set Answer Key 1) Page: 690 Ans: E Almost all of the oxygen (O 2 ) one consumes in breathing is converted to: A) acetyl-coa. B) carbon dioxide (CO 2 ). C) carbon

More information

Lecture: 26 OXIDATION OF FATTY ACIDS

Lecture: 26 OXIDATION OF FATTY ACIDS Lecture: 26 OXIDATION OF FATTY ACIDS Fatty acids obtained by hydrolysis of fats undergo different oxidative pathways designated as alpha ( ), beta ( ) and omega ( ) pathways. -oxidation -Oxidation of fatty

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/2/e1602038/dc1 Supplementary Materials for Mitochondrial metabolic regulation by GRP78 Manoj Prasad, Kevin J. Pawlak, William E. Burak, Elizabeth E. Perry, Brendan

More information

Lecture #27 Lecturer A. N. Koval

Lecture #27 Lecturer A. N. Koval Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates

More information

Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F

Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A Expression of representative subunits of the mitochondrial respiratory chain was analyzed by real time

More information

INTERACTION DRUG BODY

INTERACTION DRUG BODY INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase

More information

Chapter 14. Energy conversion: Energy & Behavior

Chapter 14. Energy conversion: Energy & Behavior Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making

More information

FREE ENERGY Reactions involving free energy: 1. Exergonic 2. Endergonic

FREE ENERGY Reactions involving free energy: 1. Exergonic 2. Endergonic BIOENERGETICS FREE ENERGY It is the portion of the total energy change in a system that is available for doing work at constant temperature and pressure; it is represented as ΔG. Reactions involving free

More information

Oxidative Phosphorylation

Oxidative Phosphorylation Electron Transport Chain (overview) The NADH and FADH 2, formed during glycolysis, β- oxidation and the TCA cycle, give up their electrons to reduce molecular O 2 to H 2 O. Electron transfer occurs through

More information

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse

More information

Energy Production In A Cell (Chapter 25 Metabolism)

Energy Production In A Cell (Chapter 25 Metabolism) Energy Production In A Cell (Chapter 25 Metabolism) Large food molecules contain a lot of potential energy in the form of chemical bonds but it requires a lot of work to liberate the energy. Cells need

More information

Role of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1):

Role of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1): Role of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1):159-234 Drug Metab Rev. 2007;39(1):159-234 Drug Metab Rev. 2007;39(1):159-234 A schematic representation of the most relevant

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

Lecture 29: Membrane Transport and metabolism

Lecture 29: Membrane Transport and metabolism Chem*3560 Lecture 29: Membrane Transport and metabolism Insulin controls glucose uptake Adipose tissue and muscles contain a passive glucose transporter GluT4 which takes up glucose from blood. (This is

More information

Enzymes and Metabolism

Enzymes and Metabolism PowerPoint Lecture Slides prepared by Vince Austin, University of Kentucky Enzymes and Metabolism Human Anatomy & Physiology, Sixth Edition Elaine N. Marieb 1 Protein Macromolecules composed of combinations

More information

Chemical Energy. Valencia College

Chemical Energy. Valencia College 9 Pathways that Harvest Chemical Energy Valencia College 9 Pathways that Harvest Chemical Energy Chapter objectives: How Does Glucose Oxidation Release Chemical Energy? What Are the Aerobic Pathways of

More information

Energy storage in cells

Energy storage in cells Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen

More information

Chapter 8 Mitochondria and Cellular Respiration

Chapter 8 Mitochondria and Cellular Respiration Chapter 8 Mitochondria and Cellular Respiration Cellular respiration is the process of oxidizing food molecules, like glucose, to carbon dioxide and water. The energy released is trapped in the form of

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

More information

Mechanistic Toxicology

Mechanistic Toxicology SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi

More information

Principles of cell signaling Lecture 4

Principles of cell signaling Lecture 4 Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway

More information

MITOCHONDRIA LECTURES OVERVIEW

MITOCHONDRIA LECTURES OVERVIEW 1 MITOCHONDRIA LECTURES OVERVIEW A. MITOCHONDRIA LECTURES OVERVIEW Mitochondrial Structure The arrangement of membranes: distinct inner and outer membranes, The location of ATPase, DNA and ribosomes The

More information

Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting

Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting Question No. 1 of 10 Question 1. Which of the following statements about the nucleus is correct? Question #01 A. The

More information

Quiz #1. BIO200 January 11, point each

Quiz #1. BIO200 January 11, point each Quiz #1 January 11, 2013 1. The primary amine group of an amino acid has a pka of 10 and the carboxylic acid group of an amino acid has a pka of 2. The side chain of the amino acid alanine is a methyl

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

NBCE Mock Board Questions Biochemistry

NBCE Mock Board Questions Biochemistry 1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation

More information

Summary of Endomembrane-system

Summary of Endomembrane-system Summary of Endomembrane-system 1. Endomembrane System: The structural and functional relationship organelles including ER,Golgi complex, lysosome, endosomes, secretory vesicles. 2. Membrane-bound structures

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

Mitochondria and ATP Synthesis

Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis 1. Mitochondria are sites of ATP synthesis in cells. 2. ATP is used to do work; i.e. ATP is an energy source. 3. ATP hydrolysis releases energy

More information

number Done by Corrected by Doctor Nayef Karadsheh

number Done by Corrected by Doctor Nayef Karadsheh number 17 Done by Abdulrahman Alhanbali Corrected by Lara Abdallat Doctor Nayef Karadsheh 1 P a g e Pentose Phosphate Pathway (PPP) Or Hexose Monophosphate Shunt In this lecture We will talk about the

More information

Electron Transport and oxidative phosphorylation (ATP Synthesis) Dr. Howaida Nounou Biochemistry department Sciences college

Electron Transport and oxidative phosphorylation (ATP Synthesis) Dr. Howaida Nounou Biochemistry department Sciences college Electron Transport and oxidative phosphorylation (ATP Synthesis) Dr. Howaida Nounou Biochemistry department Sciences college The Metabolic Pathway of Cellular Respiration All of the reactions involved

More information

4. Levels of which of the following compounds will not affect the rate of glycolysis in a cell?

4. Levels of which of the following compounds will not affect the rate of glycolysis in a cell? BIOL 201 FINAL EXAMINATION 2004 Cell Biology and Metabolism VERSION 1 1. Consider the reaction A B + C. Under standard conditions of temperature, pressure and ph, if the concentrations of A, B, and C are

More information

Glycolysis. Cellular Respiration

Glycolysis. Cellular Respiration Glucose is the preferred carbohydrate of cells. In solution, it can change from a linear chain to a ring. Energy is stored in the bonds of the carbohydrates. Breaking these bonds releases that energy.

More information

Edge attributes. Node attributes

Edge attributes. Node attributes HMDB ID input pane Network view Node attributes Edge attributes Supplemental Figure 1. Cytoscape App MetBridge Generator. The left pane is Cytoscape App MetBridge Generator (code name: rsmetabppi). User

More information

Biology 638 Biochemistry II Exam-2

Biology 638 Biochemistry II Exam-2 Biology 638 Biochemistry II Exam-2 Biol 638, Exam-2 (Code-1) 1. Assume that 16 glucose molecules enter into a liver cell and are attached to a liner glycogen one by one. Later, this glycogen is broken-down

More information

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the

More information

CELLULAR METABOLISM. Metabolic pathways can be linear, branched, cyclic or spiral

CELLULAR METABOLISM. Metabolic pathways can be linear, branched, cyclic or spiral CHM333 LECTURE 24 & 25: 3/27 29/13 SPRING 2013 Professor Christine Hrycyna CELLULAR METABOLISM What is metabolism? - How cells acquire, transform, store and use energy - Study reactions in a cell and how

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

Cell Physiology Final Exam Fall 2008

Cell Physiology Final Exam Fall 2008 Cell Physiology Final Exam Fall 2008 Guys, The average on the test was 69.9. Before you start reading the right answers please do me a favor and remember till the end of your life that GLUCOSE TRANSPORT

More information

FATTY ACID SYNTHESIS

FATTY ACID SYNTHESIS FATTY ACID SYNTHESIS Malonyl- CoA inhibits Carni1ne Palmitoyl Transferase I. Malonyl- CoA is a precursor for fa=y acid synthesis. Malonyl- CoA is produced from acetyl- CoA by the enzyme Acetyl- CoA Carboxylase.

More information

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.

More information

PHM142 Energy Production + The Mitochondria

PHM142 Energy Production + The Mitochondria PHM142 Energy Production + The Mitochondria 1 The Endosymbiont Theory of Mitochondiral Evolution 1970: Lynn Margulis Origin of Eukaryotic Cells Endosymbiant Theory: the mitochondria evolved from free-living

More information

Cellular Physiology (PHSI3009) Contents:

Cellular Physiology (PHSI3009) Contents: Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases

More information

Cornstarch

Cornstarch Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

More information

Online Supporting Information. Global gene expression profiling in larval zebrafish exposed to microcystin-lr and Microcystis

Online Supporting Information. Global gene expression profiling in larval zebrafish exposed to microcystin-lr and Microcystis Online Supporting Information Global gene expression profiling in larval zebrafish exposed to microcystin-lr and Microcystis reveals endocrine disrupting effects of cyanobacteria Emily D. Rogers, 1,2 Theodore

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

More information

Electron Transport and Oxidative. Phosphorylation

Electron Transport and Oxidative. Phosphorylation Electron Transport and Oxidative Phosphorylation Electron-transport chain electron- Definition: The set of proteins and small molecules involved in the orderly sequence of transfer to oxygen within the

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

Aerobic Fate of Pyruvate. Chapter 16 Homework Assignment. Chapter 16 The Citric Acid Cycle

Aerobic Fate of Pyruvate. Chapter 16 Homework Assignment. Chapter 16 The Citric Acid Cycle Chapter 16 Homework Assignment The following problems will be due once we finish the chapter: 1, 3, 7, 10, 16, 19, 20 Additional Problem: Write out the eight reaction steps of the Citric Acid Cycle, using

More information

Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada?

Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada? Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada? Alberto Ocana Albacete University Hospital Salamanca May 19th, 2016 WHAT IS PERSONALIZED MEDICINE? Molecular

More information

True or False: 1. Reactions are called endergonic if they occur spontaneously and release free energy.

True or False: 1. Reactions are called endergonic if they occur spontaneously and release free energy. True or False: 1. Reactions are called endergonic if they occur spontaneously and release free energy. 2. Enzymes catalyze chemical reactions by lowering the activation energy 3. Biochemical pathways are

More information

Supplemental Table 1:

Supplemental Table 1: Supplemental Table 1: Gene up-regulated in remnant kidneys of the lesion-prone FVB/N mice as compared to the resistant B6D2F1 animals 2 months after 75% nephron reduction. Gene Symbol Gene Name F FDR Accession

More information

GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1

GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 1. The endocrine system consists of glands that secrete chemical signals, called hormones, into the blood. In addition, other organs and cells

More information

Determination Differentiation. determinated precursor specialized cell

Determination Differentiation. determinated precursor specialized cell Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:

More information

Electron transport chain, oxidative phosphorylation, mitochondrial transport systems

Electron transport chain, oxidative phosphorylation, mitochondrial transport systems Electron transport chain, oxidative phosphorylation, mitochondrial transport systems JAN ILLNER Respiratory chain & oxidative phosphorylation INTERMEMBRANE SPACE ubiquinone cytochrome c ATPase Production

More information

MITOCW watch?v=ddt1kusdoog

MITOCW watch?v=ddt1kusdoog MITOCW watch?v=ddt1kusdoog The following content is provided under a Creative Commons license. Your support will help MIT OpenCourseWare continue to offer high-quality educational resources for free. To

More information

BIO 5099: Molecular Biology for Computer Scientists (et al)

BIO 5099: Molecular Biology for Computer Scientists (et al) BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being a Eukaryote: From DNA to Protein, A Tour of the Eukaryotic Cell. Christiaan van Woudenberg Being A Eukaryote Basic eukaryotes

More information