Supplemental Table 1:
|
|
|
- Reynold Blake
- 5 years ago
- Views:
Transcription
1 Supplemental Table 1: Gene up-regulated in remnant kidneys of the lesion-prone FVB/N mice as compared to the resistant B6D2F1 animals 2 months after 75% nephron reduction. Gene Symbol Gene Name F FDR Accession number Lcn2 lipocalin NM_8491 Hmgb3 high-mobility group box NM_8253 Fgb fibrinogen beta chain NM_ sf1 colony stimulating factor 1 (macrophage) NM_7778 Kras v-ki-ras2 Kirsten rat sarcoma viral oncogene homolog NM_21284 Pea15a phosphoprotein enriched in astrocytes NM_1163 myc myelocytomatosis oncogene NM_1849 ol4a1 collagen, type IV, alpha NM_9931 p ceruloplasmin (ferroxidase) NM_ Socs2 suppressor of cytokine signaling NM_776 Fn1 fibronectin NM_1233 lock clock homolog (mouse) NM_7715 Ucp2 uncoupling protein 2 (mitochondrial, proton carrier) NM_11671 ol1a1 collagen, type I, alpha NM_7742 ol15a1 collagen, type XV, alpha NM_9928 Ly6e lymphocyte antigen 6 complex, locus E NM_8529 Flna filamin A, alpha (actin binding protein 28) NM_1227 ol1a2 collagen, type I, alpha NM_7743 Serping1 serpin peptidase inhibitor, clade G (1 inhibitor), member NM_9776 Sirpa signal-regulatory protein alpha NM_7547 ol4a2 collagen, type IV, alpha NM_9932 H2-K1 histocompatibility 2, K1, K region NM_11892 F3 coagulation factor III (thromboplastin, tissue factor) NM_1171 lu clusterin NM_ B19Rik RIKEN cdna 39341B19 gene Plau plasminogen activator, urokinase NM_8873 Ywhah tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein NM_11738 Tmsb1 thymosin beta NM_ stb cystatin B (stefin B) NM_7793 Tgif1 TGFB-induced factor homeobox NM_9372 Amd1 adenosylmethionine decarboxylase NM_9665 Gale UDP-galactose-4-epimerase NM_ Flnc filamin, gamma (actin binding protein 28) NM_ Gnb1 guanine nucleotide binding protein (G protein), beta polypeptide NM_8142 Hn1 hematological and neurological expressed NM_8258 Tsc22d3 TS22 domain family, member NM_ Mcl1 myeloid cell leukemia sequence 1 (BL2-related) NM_8562 Map3k1 mitogen-activated protein kinase kinase kinase NM_11945 Eif6 eukaryotic translation initiation factor NM_1579 Irf1 interferon regulatory factor NM_839 Mad2l1 MAD2 mitotic arrest deficient-like 1 (yeast) NM_19499 Hmgn2 high-mobility group nucleosomal binding domain NM_16957 Tuba1a tubulin, alpha 1a NM_11653 Hsp9b1 heat shock protein 9kDa beta (Grp94), member NM_11631 Genes with more than 1.5-fold change (F) and a false-discovery rate (FDR) <.5 (using the Benjamini- Hochberg procedure) were considered significant.
2 Supplemental Table 2: Genes down-regulated in remnant kidneys of the lesion-prone FVB/N mice as compared to the resistant B6D2F1 animals 2 months after 75% nephron reduction. Gene Symbol Gene Name F FDR Accession number Ttr transthyretin NM_13697 Inmt indolethylamine N-methyltransferase NM_9349 Selenbp1 selenium binding protein NM_915 Fgf6 fibroblast growth factor NM_124 MyoD1 myogenic differentiation NM_1866 St3gal6 ST3 beta-galactoside alpha-2,3-sialyltransferase NM_18784 Pgam2 phosphoglycerate mutase NM_1887 Metapl1 methionine aminopeptidase 1D NM_25633 Klk1 kallikrein NM_1639 Ass1 argininosuccinate synthetase NM_7494 H2-Eb1 histocompatibility 2, class II antigen E beta NM_1382 Enpp2 ectonucleotide pyrophosphatase/phosphodiesterase NM_15744 Bcat2 branched chain aminotransferase 2, mitochondrial NM_9737 Slc2a4 solute carrier family 2 (facilitated glucose transporter), member NM_924 Des desmin NM_143 yp2a4 cytochrome P45, family 2, subfamily A, polypeptide NM_9997 Folh1 folate hydrolase (prostate-specific membrane antigen) NM_1677 Tctex1 dynein, light chain, Tctex-type NM_9342 Tcea3 transcription elongation factor A (SII), NM_11542 Rgs5 regulator of G-protein signaling NM_963 Nudt19 nudix (nucleoside diphosphate linked moiety X)-type motif NM_338 Ephb2 EPH receptor B NM_1142 Gstt1 glutathione S-transferase theta NM_8185 Rdh7 retinol dehydrogenase NM_17473 Angptl3 angiopoietin-like NM_13913 Mthfd1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase NM_ Genes with more than 1.5-fold change (F) and a false-discovery rate (FDR) <.5 (using the Benjamini- Hochberg procedure) were considered significant.
3 A B Supplemental Figure 1: Hierarchical clustering analysis of the 7 differentially expressed mrnas between FVB/N and B6D2F1 strains. (A-B) Schematic representation of the transcripts up-regulated (A) and down-regulated (B) in remnant kidneys of FVB/N mice as compared to B6D2F1 animals, 2 months after nephron reduction.
4 Lcn2 mrna level ## 1 B6D2F1 FVB/N Supplemental Figure 2: Lcn2 is overexpressed in kidneys of FVB/N mice. Lcn2 mrna expression evaluated by real-time RT-PR in control () and 75% nephrectomized () B6D2F1 and FVB/N mice, 2 months after surgery. Data are means ± SEM; n = 6 and 1-11 for control and mice, respectively. ANOVA followed by Tukey-Kramer test; control versus mice: P <.1 and B6D2F1 versus FVB/N mice: ## P <.1.
5 A Lcn2 LTL Lcn2 TH Lcn2 AQP2 B Protein mrna Supplemental Figure 3: Lcn2 protein and mrna localization in remnant kidneys of FVB/N mice, 2 months after nephron reduction. (A) Lcn2 is predominantly expressed in proximal tubules. olocalization experiments in kidneys from 75% nephrectomized () FVB/N mice, 2 months after surgery. Upper panels: serial sections stained for Lcn2 (left) and Lotus Tetragonolobus Lectin (LTL, right), a marker of proximal tubules. Middle panels: serial sections stained for Lcn2 (left) and Tamm Horsfall (TH, right), a marker of ascending limbs of loops of Henle. Lower panels: serial sections stained for Lcn2 (left) and Aquaporin 2 (AQP2, right), a marker of collecting ducts. Asterisks show some of the tubules in which Lcn2 colocalizes. Magnification: X2. (B) Lcn2 is found in a punctuate cytoplasmic distribution. Lcn2 immunohistochemistry in kidneys from FVB/N mice, 2 months after surgery. Magnification: X6. () olocalization experiments in kidneys from FVB/N mice, 2 months after surgery. Serial sections stained for Lcn2 protein (left) and mrna (right). Magnification: X2.
6 A 4wk 6wk 8wk B KW/BW Lcn2 mrna level wk 6wk 8wk 4wk 6wk 8wk D Lcn2 α-tubulin 4wk 6wk 8wk 25 kda Lcn2 / α-tubulin (AU) wk 6wk 8wk Supplemental Figure 4: Lcn2 overexpression precedes the development of renal lesions. (A) Morphology of kidneys from sham-operated (control) and 75% nephrectomized () FVB/N mice, 4 (4wk), 6 (6wk) and 8 (8wk) weeks after surgery. Magnification: X2. (B) Kidney weight (KW) to body weight (BW) ratio in control and mice, 4, 6 and 8 weeks after surgery. (-D) Lcn2 expression evaluated by () real-time RT-PR and (D) western blot in kidneys from control () and mice, 4, 6 and 8 weeks after surgery. Because no differences were detected between controls at the various time points, only one group is shown. Data are means ± SEM; n = ANOVA followed by Tukey-Kramer test; control versus mice: P <.5, P <.1, P <.1.
7 Oligomeganephronia IgA nephropathy Supplemental Figure 5: LN2 is overexpressed in kidneys of patients with chronic kidney disease. LN2 staining in kidneys from controls (n = 9) and patients with oligomeganephronia (n = 11) and IgA nephropathy (n = 12). Magnification: X2.
8 A Serum creatinine (µmol/l) Lcn2 +/+ ## Lcn2 -/- B BUN (mg/dl) ## Lcn2 +/+ Lcn2 -/- Albuminuria (mg/24h) Lcn2 +/+ # Lcn2 -/- Supplemental Figure 6: Lcn2 deficiency improves renal function and albuminuria after nephron reduction. (A-B) Serum creatinine (A), blood urea nitrogen (BUN) (B) and daily urinary albumin excretion () were measured in control and 75% nephrectomized () wild-type (Lcn2 +/+ ) or mutant (Lcn2 -/- ) mice, 2 months after nephron reduction. Because no differences were detected between wild-type and mutant control mice, only one group is shown. Data are means ± SEM; n = 4-6 and 5-11 for control and, respectively. ANOVA followed by Tukey-Kramer test; control versus mice: P <.5, P <.1 and Lcn2 +/+ versus Lcn2 -/- : # P <.5, ## P <.1.
9 Lcn2 -/- Lcn2 +/+ Supplemental Figure 7: Lcn2 is not required for iron deposits in proximal tubules. Perls staining of kidneys from control and 75% nephrectomized () wild-type (Lcn2 +/+, upper panels) or mutant (Lcn2 -/-, lower panels) mice, 2 months after nephron reduction. Magnification: X2. n = 4-6 and 1-12 for control and mice, respectively.
10 A Hif-2α α-tubulin 11 kda Hif-2α / α-tubulin (AU) B EGF Hif-2α α-tubulin kda Hif-2α / α-tubulin (AU) EGF - + Supplemental Figure 8: Hypoxia Inducible Factor-2α (Hif-2α) expression does not change upon EGF activation. (A) Hif-2α protein expression and quantification in control () and 75% nephrectomized () mice, 2 months after surgery. (B) Hif-2α protein expression and quantification in mimd-3 cells, 24 hours after EGF treatment. Data are means ± SEM; n = 5 and 6-1 for in vitro and in vivo experiments, respectively.
11 Lcn2 +/+ Lcn2 -/- Proliferation index (%) Lcn2 +/+ ### Lcn2 -/- Supplemental Figure 9: Lcn2 deficiency prevents the increase of cell proliferation after nephron reduction. Ki-67 staining (black arrow) and quantification of tubular cell proliferation in kidneys from control, 75% nephrectomized () Lcn2 +/+ and Lcn2 -/- mice, 2 months after surgery. Magnification: X4. Because no differences were detected between wild-type and mutant control mice, only one group is shown. Data are means ± SEM; n = 4-5. ANOVA followed by Tukey-Kramer test; control versus mice: P <.1 and Lcn2 +/+ versus Lcn2 -/- mice: ### P <.1.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: immunoprecipitation with anti-casr antibody The Casr protein was expressed in transiently transfected HEK cells. Cell lysates from HEK cells were subjected
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the
3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
Table 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Determination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Edge attributes. Node attributes
HMDB ID input pane Network view Node attributes Edge attributes Supplemental Figure 1. Cytoscape App MetBridge Generator. The left pane is Cytoscape App MetBridge Generator (code name: rsmetabppi). User
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Supplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Supplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
Expanded View Figures
Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old
Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases
Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin
Supplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products.
CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products Table of Contents Major Current And Emerging Cancer Diagnostic Tests 1. Introduction
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/2/e1602038/dc1 Supplementary Materials for Mitochondrial metabolic regulation by GRP78 Manoj Prasad, Kevin J. Pawlak, William E. Burak, Elizabeth E. Perry, Brendan
renoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
HMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk?
HMGB1-TLR4 Interactions: Mediators of Kidney Lung Crosstalk? Dept of Emergency and Critical Care Medicine The University of Tokyo Kent Doi, MD. PhD Organ crosstalk in AKI Grams ME, Rabb H. Kidney Int.
Quantitative protein estimation of Urine
Quantitative protein estimation of Urine 1 In a healthy renal and urinary tract system, the urine contains no protein or only trace amounts. The presence of increased amounts of protein in the urine can
Non-Protein Nitrogenous Compounds. Non-Protein Nitrogenous Compounds. NPN s. Urea (BUN) Creatinine NH 3. University of Cincinnati MLS Program 1
Non-Protein Nitrogenous Compounds NPN s Urea (BUN) Creatinine NH 3 Uric Acid Ammonia University of Cincinnati MLS Program 1 Urea Metabolic product derived from catabolism of proteins Proteolysis of proteins
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi
Role of Vitamin D receptor (VDR) in HIV induced tubular injury Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi 07/10/2015 INTRODUCTION Vitamin D is technically not a Vitamin;
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
What causes cancer? Physical factors (radiation, ionization) Chemical factors (carcinogens) Biological factors (virus, bacteria, parasite)
Oncogenes What causes cancer? Chemical factors (carcinogens) Physical factors (radiation, ionization) Biological factors (virus, bacteria, parasite) DNA Mutation or damage Oncogenes Tumor suppressor genes
Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed
Supplementary Information Table S1. Differentially expressed transcripts between hepatic inkt cells sorted form and plck-hcd1d tg mice. Differentially expressed transcripts identified by gene expression
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
SwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4
P02774 Vitamin D-binding protein precursor 52.95 5.4 Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor 27.88 5.1 Cell communication c, a P02760 AMBP protein precursor
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma
Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural
Hepatogenesis I Liver development
Hepatogenesis I Liver development HB 308 George Yeoh Room 2.59 MCS Building yeoh@cyllene.uwa.edu.au Topics Early liver development Tissue interaction - role of morphogens and cytokines Liver enriched transcription
Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney
SUPPLEMENTAL FIGURE LEGENDS Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney macrophage infiltration. Wild type or COX-2 -/- mice (2 months old, C57/Bl6 background) were treated
Early cell death (FGF) B No RunX transcription factor produced Yes No differentiation
Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Osmoregulation and the Excretory System
Honors Biology Study Guide Chapter 25.4 25.10 Name Osmoregulation and the Excretory System FUNCTIONS OF THE EXCRETORY SYSTEM OSMOREGULATION Freshwater: Marine: Land Animals: Sources of Nitrogenous Wastes?
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Human Physiology - Problem Drill 17: The Kidneys and Nephronal Physiology
Human Physiology - Problem Drill 17: The Kidneys and Nephronal Physiology Question No. 1 of 10 Instructions: (1) Read the problem statement and answer choices carefully, (2) Work the problems on paper
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Tarek ElBaz, MD. Prof. Internal Medicine Chief, Division of Renal Medicine Al Azhar University President, ESNT
The Kidney in Multiple Myeloma Tarek ElBaz, MD. Prof. Internal Medicine Chief, Division of Renal Medicine Al Azhar University President, ESNT Normal Cell Plasma cells produce antibodies that bind to antigens,
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
Nephron Function and Urine Formation. Ms. Kula December 1, 2014 Biology 30S
Nephron Function and Urine Formation Ms. Kula December 1, 2014 Biology 30S The Role of the Nephron In order for the body to properly function and maintain homeostasis, the amount of dissolved substances
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Quantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
Non-protein nitrogenous substances (NPN)
Non-protein nitrogenous substances (NPN) A simple, inexpensive screening test a routine urinalysis is often the first test conducted if kidney problems are suspected. A small, randomly collected urine
Urinary system. Lab-7
Urinary system Lab-7 Excretion: processes that remove wastes and excess materials from the body Urinary system (kidneys): excretes nitrogenous wastes, excess solutes, and water The Kidneys Regulate Water
Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl-
Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl- 2 upregulation in pregnancy B. Santner-Nanan, K. Straubinger, P. Hsu, G. Parnell, B. Tang, B. Xu, A. Makris,
Renal Pathology 1: Glomerulus. With many thanks to Elizabeth Angus PhD for EM photographs
Renal Pathology 1: Glomerulus With many thanks to Elizabeth Angus PhD for EM photographs Anatomy of the Kidney http://www.yalemedicalgroup.org/stw/page.asp?pageid=stw028980 The Nephron http://www.beltina.org/health-dictionary/nephron-function-kidney-definition.html
Histopathology: Glomerulonephritis and other renal pathology
Histopathology: Glomerulonephritis and other renal pathology These presentations are to help you identify basic histopathological features. They do not contain the additional factual information that you
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases
54 Review Article Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases Toshio Tanaka 1, 2), Masashi Narazaki 3), Kazuya Masuda 4) and Tadamitsu Kishimoto 4, ) 1) Department of
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
EU FP7 Project Profiling Responses in Antibody Therapies (PRIAT) Final Report. Annex 1: PRIAT Logo
Annex 1: PRIAT Logo 1 Annex 2: Figures Figure 1: Affinity measurements against human beta-2 Microglobulin via surface plasmon resonance (SPR). SPR measurements of the scfv antibody B13 (anti-human-b2m)
Lithium-induced Tubular Dysfunction. Jun Ki Park 11/30/10
Lithium-induced Tubular Dysfunction Jun Ki Park 11/30/10 Use of Lithium Mid 19 th century: treatment of gout Late 19 th century: used for psychiatric disorders Early 20 th century: sodium substitute to
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.
WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA
A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure
Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
Chapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical