A) Translation. B) Transcription
|
|
|
- Stuart Willis
- 5 years ago
- Views:
Transcription
1 A) Translation HSPA1B heat shock 70kDa protein 1B NM_ EEF1A2 eukaryotic translation elongation factor 1 alpha NM_ HSPA1A heat shock 70kDa protein 1A NM_ EIF4G1 eukaryotic translation initiation factor 4 gamma, BE TPM1 tropomyosin 1 (alpha) Z24727 B) Transcription TRIM16 tripartite motif-containing NM_ STAT1 signal transducer and activator of transcription 1, 91kDa NM_ GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa NM_ NFE2L2 nuclear factor (erythroid-derived 2)-like NM_ ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein NM_ PIR pirin (iron-binding nuclear protein) NM_ SIX2 sine oculis homeobox homolog 2 (Drosophila) NM_ NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) AF HOXC6 homeobox C NM_ HIRA HIR histone cell cycle regulation defective homolog A (S. cerevisiae) X75296 ILF3 interleukin enhancer binding factor 3, 90kDa AF SF1 splicing factor NM_ ZNF580 zinc finger protein NM_ HOXC10 homeobox C NM_ MYC v-myc myelocytomatosis viral oncogene homolog (avian) NM_ TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) U85658 MAML1 mastermind-like 1 (Drosophila) NM_ IVNS1ABP influenza virus NS1A binding protein AF RAB13 RAB13, member RAS oncogene family NM_002870
2 C) Signalling CHN1 chimerin (chimaerin) BF STAT1 signal transducer and activator of transcription 1, 91kDa NM_ ITGAV integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) AI C3 complement component NM_ C1S complement component 1, s subcomponent M18767 IGF2R insulin-like growth factor 2 receptor NM_ CALM3 calmodulin 3 (phosphorylase kinase, delta) NM_ OPN3 opsin 3 (encephalopsin, panopsin) NM_ FGFR3 fibroblast growth factor receptor 3 (achondroplasia, thanatophoric dwarfism) NM_ FZD2 frizzled homolog 2 (Drosophila) L37882 LGR5 leucine-rich repeat-containing G protein-coupled receptor AL TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) U85658 GNAS GNAS complex locus AA DUSP14 dual specificity phosphatase NM_ TYRO3 TYRO3 protein tyrosine kinase U05682 MAML1 mastermind-like 1 (Drosophila) NM_ WISP2 WNT1 inducible signaling pathway protein NM_ INSL4 insulin-like 4 (placenta) NM_ IL13RA1 interleukin 13 receptor, alpha NM_ TSPAN8 tetraspanin NM_ RGS2 regulator of G-protein signalling 2, 24kDa NM_ P2RY6 pyrimidinergic receptor P2Y, G-protein coupled, NM_ GNAQ Guanine nucleotide binding protein (G protein), q polypeptide BF AKAP12 A kinase (PRKA) anchor protein (gravin) AB003476
3 D) Proliferation PRKRA protein kinase, interferon-inducible double stranded RNA dependent activator AF SKP2 S-phase kinase-associated protein 2 (p45) BC AKR1C3 aldo-keto reductase family 1, member C AB EMP2 epithelial membrane protein NM_ SLC29A2 solute carrier family 29 (nucleoside transporters), member AF CHERP calcium homeostasis endoplasmic reticulum protein NM_ HOXC10 homeobox C NM_ INHBC inhibin, beta C NM_ MYC v-myc myelocytomatosis viral oncogene homolog (avian) NM_ MAPRE2 microtubule-associated protein, RP/EB family, member NM_ TGFBI transforming growth factor, beta-induced, 68kDa NM_ SPOCK1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) AF GPNMB glycoprotein (transmembrane) nmb NM_ INSL4 insulin-like 4 (placenta) NM_ EPB41L3 erythrocyte membrane protein band 4.1-like AI E) Cell Cycle STAT1 signal transducer and activator of transcription 1, 91kDa NM_ S100A4 S100 calcium binding protein A NM_ APOBEC3B apolipoprotein B mrna editing enzyme, catalytic polypeptide-like 3B NM_ SKP2 S-phase kinase-associated protein 2 (p45) BC MYC v-myc myelocytomatosis viral oncogene homolog (avian) NM_ MAPRE2 microtubule-associated protein, RP/EB family, member NM_ RGS2 regulator of G-protein signalling 2, 24kDa NM_ S100P S100 calcium binding protein P NM_ MACF1 microtubule-actin crosslinking factor AB029290
4 F) Motility ABI2 abl interactor AF WASPIP Wiskott-Aldrich syndrome protein interacting protein AW ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha AI HYOU1 hypoxia up-regulated NM_ SPOCK1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) AF PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) NM_ ACTR2 ARP2 actin-related protein 2 homolog (yeast) BE IQGAP1 IQ motif containing GTPase activating protein D29640 TPM1 tropomyosin 1 (alpha) Z24727 G) Cell Adhesion ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha AI ITGAV integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) AI PODXL podocalyxin-like NM_ SCARB1 scavenger receptor class B, member NM_ CD44 CD44 molecule (Indian blood group) M24915 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein NM_ SPON2 spondin 2, extracellular matrix protein NM_ DGCR2 DiGeorge syndrome critical region gene AU ICAM1 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor NM_ NELL2 NEL-like 2 (chicken) NM_ TYRO3 TYRO3 protein tyrosine kinase U05682 TGFBI transforming growth factor, beta-induced, 68kDa NM_ SPOCK1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) AF WISP2 WNT1 inducible signaling pathway protein NM_ ALCAM activated leukocyte cell adhesion molecule AA CLEC2B C-type lectin domain family 2, member B BC RAB13 RAB13, member RAS oncogene family NM_002870
5 H) Apoptosis HSPA1B heat shock 70kDa protein 1B NM_ HSPA1A heat shock 70kDa protein 1A NM_ ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha AI CLU clusterin M25915 SCARB1 scavenger receptor class B, member NM_ HSPD1 heat shock 60kDa protein 1 (chaperonin) NM_ BAG3 BCL2-associated athanogene NM_ NCKAP1 NCK-associated protein NM_ P8 p8 protein (candidate of metastasis 1) AF NUDT2 nudix (nucleoside diphosphate linked moiety X)-type motif NM_ SGK serum/glucocorticoid regulated kinase NM_ I) Cell Structure TUBA3 tubulin, alpha AF MTX2 metaxin NM_ FBN2 fibrillin 2 (congenital contractural arachnodactyly) NM_ H1FX H1 histone family, member X NM_ P gamma tubulin ring complex protein (76p gene) BC MFAP5 microfibrillar associated protein U37283 MYLK myosin, light polypeptide kinase NM_ DYNLT3 dynein, light chain, Tctex-type NM_ TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein NM_ MAP7 microtubule-associated protein AW IPO7 importin AL CALCOCO2 calcium binding and coiled-coil domain BC KIF5B kinesin family member 5B BF223224
6 J) Metabolism AKR1C2 aldo-keto reductase family 1, member C U05598 AKR1C1 aldo-keto reductase family 1, member C NM_ ALDH3A1 aldehyde dehydrogenase 3 family, membera NM_ INPP1 inositol polyphosphate-1-phosphatase NM_ HSPE1 heat shock 10kDa protein 1 (chaperonin 10) NM_ GCLM glutamate-cysteine ligase, modifier subunit NM_ UGDH UDP-glucose dehydrogenase NM_ EPHX1 epoxide hydrolase 1, microsomal (xenobiotic) NM_ SLC29A1 solute carrier family 29 (nucleoside transporters), member AF PGD phosphogluconate dehydrogenase NM_ DPAGT1 dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase BC AGPS alkylglycerone phosphate synthase NM_ SLCO4A1 solute carrier organic anion transporter family, member 4A NM_ ATP5G3 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) NM_ GLUL glutamate-ammonia ligase (glutamine synthetase) AL GSTM4 glutathione S-transferase M NM_ ASS argininosuccinate synthetase NM_ CLU clusterin M25915 FBLN1 fibulin NM_ SCARB1 scavenger receptor class B, member NM_ HSPD1 heat shock 60kDa protein 1 (chaperonin) NM_ HNRPA0 heterogeneous nuclear ribonucleoprotein A NM_ AKR1C3 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) AB PTBP1 polypyrimidine tract binding protein AA TXNRD1 thioredoxin reductase NM_ SLCO3A1 solute carrier organic anion transporter family, member 3A NM_ HNRPA3P1 heterogeneous nuclear ribonucleoprotein A3 pseudogene BG SORD sorbitol dehydrogenase L29008 UCK2 uridine-cytidine kinase BC SLC29A2 solute carrier family 29 (nucleoside transporters), member AF FASN fatty acid synthase AI NQO1 NAD(P)H dehydrogenase, quinone NM_000903
7 SLC39A6 solute carrier family 39 (zinc transporter), member AI PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) NM_ ACAA2 acetyl-coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) NM_ DPM3 dolichyl-phosphate mannosyltransferase polypeptide NM_ UGP2 UDP-glucose pyrophosphorylase NM_ IDI1 isopentenyl-diphosphate delta isomerase BC NUDT2 nudix (nucleoside diphosphate linked moiety X)-type motif NM_ SLC27A5 solute carrier family 27 (fatty acid transporter), member NM_ KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor BE SLC16A7 solute carrier family 16 (monocarboxylic acid transporters), member NM_ CENTA2 centaurin, alpha NM_ MACF1 microtubule-actin crosslinking factor AB K) Miscellaneous SF3B1 splicing factor 3b, subunit 1, 155kDa AF UBE2E3 ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) AB DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member NM_ TMPRSS3 transmembrane protease, serine NM_ SRRM1 serine/arginine repetitive matrix NM_ CTSC cathepsin C NM_ PNMA1 paraneoplastic antigen MA NM_ CCDC6 coiled-coil domain containing NM_ FHL1 four and a half LIM domains NM_ NEFH neurofilament, heavy polypeptide 200kDa X15306 SF3A2 splicing factor 3a, subunit 2, 66kDa L21990 CTSD cathepsin D (lysosomal aspartyl peptidase) NM_ PRKCSH protein kinase C substrate 80K-H NM_ RBPMS RNA binding protein with multiple splicing D84109 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) NM_ P2RX5 purinergic receptor P2X, ligand-gated ion channel, U49396 ANXA6 annexin A NM_ F8A1 coagulation factor VIII-associated (intronic transcript) NM_012151
8 ABCE1 ATP-binding cassette, sub-family E (OABP), member AI C4BPB complement component 4 binding protein, beta NM_ MEST mesoderm specific transcript homolog (mouse) NM_ PSMB8 proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7) U17496 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member AI GOLGA4 golgi autoantigen, golgin subfamily a, NM_002078
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Receptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Signal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
Effects of Second Messengers
Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many
Principles of cell signaling Lecture 4
Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway
Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
CELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
Signal Transduction: G-Protein Coupled Receptors
Signal Transduction: G-Protein Coupled Receptors Federle, M. (2017). Lectures 4-5: Signal Transduction parts 1&2: nuclear receptors and GPCRs. Lecture presented at PHAR 423 Lecture in UIC College of Pharmacy,
SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
Supplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
Gene Expression Multiplexing Menu
Gene Expression Multiplexing Menu Mouse Rat Human Table of CONTENTS Mouse Inflammatory Plex 2 Rat Stress Plex 3 Growth Regulation Plex 4 Multitox Plex 5 Pharma III Plex 6 Reference Plex 7 Human Transporter
Revision. camp pathway
االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition
BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.
BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which
Chapter 3 Part 2! Pages (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis!
Chapter 3 Part 2! Pages 65 89 (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis! The Cell Theory! Living organisms are composed of one or more cells.!
AP Biology Cells: Chapters 4 & 5
AP Biology Cells: Chapters 4 & 5 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The was the first unifying principle of biology. a. spontaneous generation
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
Cell Communication. Local and Long Distance Signaling
Cell Communication Cell to cell communication is essential for multicellular organisms Some universal mechanisms of cellular regulation providing more evidence for the evolutionary relatedness of all life
Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B
Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein
Signal-Transduction Cascades - 2. The Phosphoinositide Cascade
Signal-Transduction Cascades - 2 The Phosphoinositide Cascade Calcium ion as a second messenger Tyrosine kinase and receptor dimerization scribd.com Faisal Khatib JU The Phosphoinositide Cascade Used by
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
BIO 5099: Molecular Biology for Computer Scientists (et al)
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being a Eukaryote: From DNA to Protein, A Tour of the Eukaryotic Cell. Christiaan van Woudenberg Being A Eukaryote Basic eukaryotes
Lecture 15. Signal Transduction Pathways - Introduction
Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals
Protein Trafficking in the Secretory and Endocytic Pathways
Protein Trafficking in the Secretory and Endocytic Pathways The compartmentalization of eukaryotic cells has considerable functional advantages for the cell, but requires elaborate mechanisms to ensure
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
Supplemental Table 1:
Supplemental Table 1: Gene up-regulated in remnant kidneys of the lesion-prone FVB/N mice as compared to the resistant B6D2F1 animals 2 months after 75% nephron reduction. Gene Symbol Gene Name F FDR Accession
Supplementary Material 1
Supplementary Material 1 Legend of Supplementary Figure 1. Heat-map generated using class comparison methods and clustered using analysis of variance test (ANOVA), as described in the Methods section.
Supporting Information
Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling
Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being A Eukaryote. Eukaryotic Cells. Basic eukaryotes have:
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 15: Being a Eukaryote: From DNA to Protein, A Tour of the Eukaryotic Cell. Christiaan van Woudenberg Being A Eukaryote Basic eukaryotes
Developing a clinically feasible personalized medicine approach to pediatric
Developing a clinically feasible personalized medicine approach to pediatric septic shock Hector R. Wong, Natalie Z. Cvijanovich, Nick Anas, Geoffrey L. Allen, Neal J. Thomas, Michael T. Bigham, Scott
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,
Chapter 9. Cellular Signaling
Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The
Objective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
Protein sorting (endoplasmic reticulum) Dr. Diala Abu-Hsasan School of Medicine
Protein sorting (endoplasmic reticulum) Dr. Diala Abu-Hsasan School of Medicine dr.abuhassand@gmail.com An overview of cellular components Endoplasmic reticulum (ER) It is a network of membrane-enclosed
Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed
Supplementary Information Table S1. Differentially expressed transcripts between hepatic inkt cells sorted form and plck-hcd1d tg mice. Differentially expressed transcripts identified by gene expression
PCB 3023 Exam 4 - Form A First and Last Name
PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this
Cell signaling. How do cells receive and respond to signals from their surroundings?
Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a
The Tissue Engineer s Toolkit
The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli
Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
BIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
Isoprene-Derived Secondary Organic Aerosol Induces the Expression of. Oxidative Stress Response Genes in Human Lung Cells
1 2 3 Supporting Information Isoprene-Derived Secondary Organic Aerosol Induces the Expression of Oxidative Stress Response Genes in Human Lung Cells 4 5 6 7 8 9 10 11 12 13 14 15 Ying-Hsuan Lin 1,a, Maiko
Table 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION
BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your
Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system
Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds
BIOL 4374/BCHS 4313 Cell Biology Exam #2 March 22, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #2 March 22, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) In the
Sarah Jaar Marah Al-Darawsheh
22 Sarah Jaar Marah Al-Darawsheh Faisal Mohammad Receptors can be membrane proteins (for water-soluble hormones/ligands) or intracellular (found in the cytosol or nucleus and bind to DNA, for lipid-soluble
Genome-wide analysis of pain-, nerve- and neurotrophin -related gene expression in the degenerating human annulus
Gruber et al. Molecular Pain 2012, 8:63 MOLECULAR PAIN RESEARCH Genome-wide analysis of pain-, nerve- and neurotrophin -related gene expression in the degenerating human annulus Helen E Gruber 1,2*, Gretchen
Chemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
Supplementary Tables 1
Supplementary Tables 1 Supplementary Table 1: The 11 genes in the geneset for Case Study 1 At1g62570 At1g09350 At1g60470 At2g47180 At4g17090 At5g20830 At2g16890 At3g51240 At3g55120 At4g27560 At5g08640
2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
Cell Communication. Chapter 11. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 11 Cell Communication PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
Cellular Physiology (PHSI3009) Contents:
Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases
REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
Optimized between-group classification: a new jackknife-based gene selection procedure for genome-wide expression data Supplementary information
Optimized between-group classification: a new jackknife-based gene selection procedure for genome-wide expression data Supplementary information Florent Baty 1 florent.baty@unibas.ch Michel P Bihl 1 michel.bihl@unibas.ch
Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl-
Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl- 2 upregulation in pregnancy B. Santner-Nanan, K. Straubinger, P. Hsu, G. Parnell, B. Tang, B. Xu, A. Makris,
Molecular Trafficking
SCBM 251 Molecular Trafficking Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science rutaiwan.toh@mahidol.ac.th Lecture outline 1. What is molecular trafficking? Why is it important?
Lecture: CHAPTER 13 Signal Transduction Pathways
Lecture: 10 17 2016 CHAPTER 13 Signal Transduction Pathways Chapter 13 Outline Signal transduction cascades have many components in common: 1. Release of a primary message as a response to a physiological
Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective
BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical
Cell Communication. Chapter 11. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 11 Cell Communication PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
REGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25
REGULATION OF ENZYME ACTIVITY Medical Biochemistry, Lecture 25 Lecture 25, Outline General properties of enzyme regulation Regulation of enzyme concentrations Allosteric enzymes and feedback inhibition
Characterization of Complete Response to IL-2 Using Gene Expression Analysis and Tissue Array Validation in Metastatic RCCa
Characterization of Complete Response to IL-2 Using Gene Expression Analysis and Tissue Array Validation in Metastatic RCCa Allan J. Pantuck, M.D. UCLA Department of Urology Society of Biologic Therapy
Examination I PHRM 836 Biochemistry for Pharmaceutical Sciences II September 30, 2014
Examination I PHRM 836 Biochemistry for Pharmaceutical Sciences II September 30, 2014 PHRM 836 Exam I - 1 Name: Instructions 1. Check your exam to make certain that it has 10 pages including this cover
Effect of Acid and Pepsin on LPR-Sensitive Mucins In Vitro
Novel Drug Targets for Reflux Disease Role of LPR in Injury and Disease is Controversial Nikki Johnston, Ph.D. Department of Otolaryngology and Communication Sciences Medical College of Wisconsin Milwaukee,
UNIVERSITY OF YORK BSc Stage 2 Degree Examinations Department: BIOLOGY. Title of Exam: Cell Biology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BSc Stage 2 Degree Examinations 2017-18 Department: BIOLOGY Title of Exam: Cell Biology Time allowed: 1 hour and 30 minutes Total marks available
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The
Lipids and Membranes
Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis
Comparison of nanoparticle protein corona profiles resulting from changes in nanoparticle environment and engineered properties.
Comparison of nanoparticle protein corona profiles resulting from changes in nanoparticle environment and engineered properties. Korin Wheeler Dept. of Chemistry & Biochemistry Santa Clara University at
Protein regulation Protein motion
Lecture 13 Protein regulation Protein motion Antoine van Oijen BCMP201 Spring 2008 04/02 Section IV 04/09 Hands-on methods session / PS 4 due 1 Today s lecture 1) Mechanisms of protein regulation 2) Molecular
Nucleic acids. Nucleic acids are information-rich polymers of nucleotides
Nucleic acids Nucleic acids are information-rich polymers of nucleotides DNA and RNA Serve as the blueprints for proteins and thus control the life of a cell RNA and DNA are made up of very similar nucleotides.
MCB Chapter 11. Topic E. Splicing mechanism Nuclear Transport Alternative control modes. Reading :
MCB Chapter 11 Topic E Splicing mechanism Nuclear Transport Alternative control modes Reading : 419-449 Topic E Michal Linial 14 Jan 2004 1 Self-splicing group I introns were the first examples of catalytic
Complexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome
DNA Genome Complexity RNA Transcriptome Systems Biology Linking all the components of a cell in a quantitative and temporal manner Protein Proteome Metabolites Metabolome Where are the functional elements?
Hs LOC Hs.7100 T Hs YARS Tyrosyl-tRNA synthetase 0.24
Supplementary Table S1 Genes differently expressed between LNM35 and N15 UniGene ID Gene symbol Description Ratio Genes up-regulated in LNM35 Hs.535012 LOC441052 6.14 Hs.182885 SLC35B2 Solute carrier family
Cellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
Cell Physiology Final Exam Fall 2008
Cell Physiology Final Exam Fall 2008 Guys, The average on the test was 69.9. Before you start reading the right answers please do me a favor and remember till the end of your life that GLUCOSE TRANSPORT
Supplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma
Signal Transduction Pathways. Part 2
Signal Transduction Pathways Part 2 GPCRs G-protein coupled receptors > 700 GPCRs in humans Mediate responses to senses taste, smell, sight ~ 1000 GPCRs mediate sense of smell in mouse Half of all known
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
Signaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
Processing of RNA II Biochemistry 302. February 13, 2006
Processing of RNA II Biochemistry 302 February 13, 2006 Precursor mrna: introns and exons Intron: Transcribed RNA sequence removed from precursor RNA during the process of maturation (for class II genes:
Tala Saleh. Ahmad Attari. Mamoun Ahram
23 Tala Saleh Ahmad Attari Minna Mushtaha Mamoun Ahram In the previous lecture, we discussed the mechanisms of regulating enzymes through inhibitors. Now, we will start this lecture by discussing regulation