Gene Expression Multiplexing Menu
|
|
- Brice Mills
- 5 years ago
- Views:
Transcription
1 Gene Expression Multiplexing Menu Mouse Rat Human
2 Table of CONTENTS Mouse Inflammatory Plex 2 Rat Stress Plex 3 Growth Regulation Plex 4 Multitox Plex 5 Pharma III Plex 6 Reference Plex 7 Human Transporter Plex 8 Pharma III Plex 9 Inflamamatory Plex 10 Growth Regulation Plex 11 Immunotox Plex 12 Multitox Plex 13 Reference Plex 14 Breast Cancer Plex 15 Multitox Plex 16 1
3 Mouse Inflammatory Plex Mouse Inflammatory Plex 1 Actin, beta (ACTB) X Tumor necrosis factor (Tnf) NM_ Interleukin-6 (IL-6) X Membrane cofactor protein (Mcp) NM_ Matrix metalloproteinase 9 (Mmp9) NM_ Interferon-gamma inducing factor (IL-18) D Interferon-inducible protein 10 receptor (Cxcr3, C-X-C) AB Platelet-derived growth factor-inducible KC protein (Cxcl1) J Interleukin 4 (Il-4) M Interleukin 12b (Il12b) NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Macrophage colony-stimulating factor (Csf) M Chemokine (C-C motif) receptor 2 (Ccr2) NM_ Connective tissue growth factor (Ctgf) NM_ Transcription factor NF-kappa-B DNA binding subunit M Interleukin 10 (IL-10) M Interleukin 1 beta (Il1b) NM_ Fibroblast growth factor 1 (Fgf1) NM_ Interferon gamma (Ifng) NM_ T-cell activation gene 3 (TCA3, CCl1, C-C) M Kanmycin Resistant 22 Peptidylprolyl isomerase A (Ppia / Cyclophillin A) X Signal transducer and activator of transcription 1 (Stat1) NM_ Interferon regulatory factor 1 (Irf-1) M
4 Rat Stress Plex Rat Stress Plex 1 Glutathione reductase (Gsr) NM_ ATPase inhibitory factor 1 (Atpif1) NM_ Cyclin-dependent kinase inhibitor 1A, (p21/waf1) U Glutamate cysteine ligase, modifier subunit (Gclm) NM_ Thioredoxin reductase(txnr1) U Topoisomerase (DNA) 2 alpha (Top2a) NM_ DnaJ (Hsp40) homolog, subfamily B, member 4 (Dnajb4) NM_ Heat shock 10 kda protein 1 (Hspe1) NM_ Ornithine transcarbamylase (Otc) NM_ Heme oxygenase (HMOX-1) J Heat shock 70kD protein 1A (Hspa1a) NM_ Solute carrier family 10 (sodium/bile acid cotransporter family), member 1 (Slc10a1) NM_ Heat shock 90kDa protein 1, beta (Hspcb) NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) NM_ Glutathione S-transferase, mu type 3 (Gstm3) NM_ Bcl2-associated athanogene 3 (Bag3) NM_ Heat shock factor binding protein 1 (Hsbp1) NM_ Hypoxia up-regulated 1 (Hyou1) NM_ Actin, beta (ACTB) NM_ Kanmycin Resistant 21 Biliverdin reductase B (flavin reductase (NADPH)) (Blvrb) XM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Cytochrome P450, 1a1 (Cyp1a1) NM_
5 Rat Multitox Plex Rat Multitox Plex 1 Cyclophilin A NM_ Cytochrome4A1 (CYP4A22) NM_ Cytochrome2B1 J Cytochrome3A1 L Cytochrome2E1 NM_ Cytochrome P-450 M1 (CYP2C9 orthologue) J Cytochrome 2D22 (human CYP2D6 homolog) NM_ NADPH cytochrome P-450 reductase M UDP-glucuronosyltransferase NM_ Aldehyde dehydrogenase AF Cyclin dependent kinase inhibitor 1A (p21) U Cytochrome P450 (PB1) 2C19 orthologue M Heme Oxygenase (Hmox1) NM_ NAD(P)H dehydrogenase quinone 1 NM_ Growth arrest DNA damage 153 (Gadd153) U Cyclooxygenase-2 S Growth arrest DNA damage 45 L Apoptosis related cysteine protease NM_ CyclinD1 (Ccnd1) NM_ Proliferating cell nuclear antigen NM_ Tumor protein p53 NM_ Cytochrome 1A2 K Actin, beta (ACTB) NM_ Kanmycin Resistant 25 TSC22 L Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Cytochrome1A1 NM_
6 Rat Growth Regulation Plex Rat Growth Regulation Plex 1 Cyclophilin A NM_ Cytochrome4A1 (CYP4A22) NM_ Cytochrome2B1 J Cytochrome3A1 L Cytochrome2E1 NM_ Cytochrome P-450 M1 (CYP2C9 orthologue) J Cytochrome 2D22 (human CYP2D6 homolog) NM_ NADPH cytochrome P-450 reductase M UDP-glucuronosyltransferase NM_ Aldehyde dehydrogenase AF Cyclin dependent kinase inhibitor 1A (p21) U Cytochrome P450 (PB1) 2C19 orthologue M Heme Oxygenase (Hmox1) NM_ NAD(P)H dehydrogenase quinone 1 NM_ Growth arrest DNA damage 153 (Gadd153) U Cyclooxygenase-2 S Growth arrest DNA damage 45 L Apoptosis related cysteine protease NM_ CyclinD1 (Ccnd1) NM_ Proliferating cell nuclear antigen NM_ Tumor protein p53 NM_ Cytochrome 1A2 K Actin, beta (ACTB) NM_ Kanmycin Resistant 25 TSC22 L Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Cytochrome1A1 NM_
7 Rat Pharma III Plex Rat Pharma III Plex 1 Cytochrome P450, family 2, subfamily b, (CYP2B2) polypeptide 2 XM_ Glutathione-S-transferase, pi 1 (Gstp1) NM_ CyclinE1 D CyclinG1 X Trefoil factor 1 (Tff1) NM_ Insulin-like growth factor binding protein 5 (IGFBP-5) M Cytochrome P450, subfamily IIA (phenobarbital-inducble)/ (Cytochrome P450 IIA3) (Cyp2a3a) NM_ Cytochrome P450, family 1, subfamily b, polypeptide 1 (Cyp1b1) NM_ Peroxisome proliferator activated receptor alpha(ppara) M Myelocytomatosis viral oncogene homolog (avian) (c-myc) AY Cytochrome P450, subfamily 3A, polypeptide 3 (Cyp3a3) NM_ Cytochrome P450, family 1, subfamily a, (CYP1A2) polypeptide 2 K Baculoviral IAP repeat-containing 5 (Birc5/survivin) AF Peptidylprolyl isomerase A (Ppia / Cyclophillin A) NM_ ATP-binding cassette, sub-family B (MDR/TAP), (Abcb1) member 1 AY Myeloblastosis oncogene-like 1 (MYB) XM_ Cytochrome P450, family 3, subfamily a, (Cyp3a13) polypeptide 13 NM_ Actin, beta (ACTB) NM_ Kanmycin Resistant 20 Cytochrome P450, family 2, subfamily d, (Cyp2d13) polypeptide 13 NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_
8 Rat Reference Plex Rat Reference Plex 1 Beta-glucuronidase M Ribosomal protein L37a (RPL37A) X Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Ca2-activated neutral protease large subunit BC ATP synthase NM_ Nuclear factor NF45 XM_ Glycerol kinase NM_ QRSHs glutaminyl-trna synthetase NM_ kDa Alu RNA binding protein XM_ Histone deacetylase HD1 XM_ Ezrin AF Transferrin Receptor M Proteasome subunit Y BC Transcription Factor IID XM_ MLN51 AF Lysosomal hyaluronidase AF Acidic Ribosomal Protein BC Elongation factor EF-1-alpha BC Hypoxanthine ribosyl transferase M Beta 2 microglobulin NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) NM_ Actin, beta (ACTB) NM_ E2 Ubiquitin conjugating enzyme UbcH5B U s-rRNA M Kanmycin Resistant 7
9 Human Transporter Plex Human Transporter Plex 1 Bile salt export pump (BSEP, ABCB11 ) AF Glutathione transferase M1B (GSTM1) J ATP-binding cassette, sub-family B (MDR/TAP), member 1 (ABCB1) NM_ Glutathione S-transferase A1 (GSTA1) NM_ Glutathione S-transferase pi (GSTP1) NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC ATP-binding cassette, sub-family C (CFTR/MRP), member 4 (ABCC4) NM_ Solute carrier organic anion transporter family, member 1B3 (SLCO1B3, OATP8) NM_ ATP-binding cassette, sub-family B (MDR/TAP), member 4 (ABCB4) NM_ Human peptide transporter (HPEPT1, SLC15A1 ) U Organic cation transporter 1 (hoct1) U Solute carrier organic anion transporter family, member 1A2 (SLCO1A2, OATP-A) BC Organic anion transporter OATP-C (SLCO1B1) AB ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (ABCC5 ) AB Na/taurocholate cotransporting polypeptide (NTCP, SLC10A1) L Actin, beta (ACTB) NM_ Glutathione S-transferase A2 (GSTA2) NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ O-6-methylguanine-DNA methyltransferase (MGMT) NM_ Multidrug resistance-associated protein (MRP, ABCC1) L ATP-binding cassette, sub-family C (CFTR/MRP), member 2 (ABCC2) NM_ Breast cancer resistance protein (BCRP, ABCG2) AF Kanmycin Resistant 24 Multidrug resistance-associated protein 3 (MRP3, ABCC3) AF Solute carrier family 2 (facilitated glucose transporter), member 1 (GLUT1, SLC2A1) NM_ DNA Topoisomerase I J
10 Human Pharma III Plex Human Pharma III Plex 1 Cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6) NM_ Cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) NM_ ATP-binding cassette, sub-family B (MDR/TAP), member 1 (ABCB1) NM_ Cytochrome P450 PCN3 (CYP3A5) J Glutathione S-transferase pi (GSTP1) NM_ V-myb myeloblastosis viral oncogene homolog(myb) NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC Baculoviral IAP repeat-containing 5 (survivin) (BIRC5) NM_ Cytochrome P450, family 2, subfamily B, polypeptide 6 (CYP2B6) NM_ Cytochrome P450, family 2, subfamily A, polypeptide 6 (CYP2A6) NM_ V-myc myelocytomatosis viral oncogene homolog BC Cyclin E1 (CCNE1), transcript variant 2 NM_ Peroxisome proliferative activated receptor, alpha (PPARA) NM_ Cytochrome P450, family 3, subfamily A, polypeptide 4 (CYP3A4) NM_ Insulin-like growth factor binding protein 5 (IGFBP5) NM_ Cyclin G1 (CCNG1) NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Cytochrome P450, family 1, subfamily A, polypeptide 2 (CYP1A2) Z Actin, beta (ACTB) NM_ Trefoil factor 1 (TFF1) NM_ Kanmycin Resistant 9
11 Human Inflamamatory Plex Human Inflamamatory Plex 1 CD63 antigen (melanoma 1 antigen) (CD63) NM_ Interleukin 2 (IL2) NM_ Hybridoma growth factor (interleukin 6) (IL6) M Interleukin 8 (IL8) NM_ Tumor necrosis factor (TNF superfamily, member 2) (TNF) NM_ Interferon regulatory factor 1(IRF1) X Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC Interleukin 4 (IL4) NM_ Monocyte chemoattractant protein 1 receptor (MCP-1RB) U Colony stimulating factor 1 (macrophage) (CSF1) NM_ Type IV collagenase,matrix metallopeptidase 9 (MMP9) J Interleukin 10 (IL10) NM_ Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) (NFKB1) NM_ Monocyte interleukin 1 (IL-1) NM_ Signal transducer and activator of transcription 1, 91kDa (STAT1) NM_ Fibroblast growth factor 1 (acidic) (FGF1) NM_ Connective tissue growth factor (CTGF) NM_ Chemokine (C-C motif) ligand 1 (CCL1) NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Chemokine (C-X-C motif) receptor 3 (CXCR3) X Actin, beta (ACTB) NM_ Membrane cofactor protein (CD46) (MCP1) NM_ Interleukin 18 (interferon-gamma-inducing factor) (IL18) NM_ Kanmycin Resistant 25 Interferon, gamma (IFNG) NM_ Interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40) (IL12B) NM_
12 Human Growth Regulation Plex Human Growth Regulation Plex 1 Thymidine kinase (TK1) K B-cell CLL/lymphoma 2 (BCL2) M Caspase 3, apoptosis-related cysteine peptidase (CASP3) NM_ ATPase family, AAA domain containing 3A (ATAD3A) NM_ Tumor necrosis factor (TNF superfamily, member 2) (TNF) NM_ Polymerase (DNA directed), epsilon 2 (p59 subunit) (POLE2) NM_ BCL2-antagonist/killer 1 (BAK1) BC Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC Cell death-inducing DFFA-like effector a (CIDEA) NM_ Transforming growth factor-beta (TGF-beta) X Ataxia telangiectasia mutated (ATM) NM_ Calmodulin-like 3 (CALML3) BC Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (MDM2) NM_ Tumor necrosis factor receptor superfamily, member 6 (TNFRSF6) (FAS) NM_ Ribonucleotide reductase M2 polypeptide (RRM2) X Ataxia telangiectasia and Rad3 related (ATR) NM_ Cyclin-dependent kinase 2 (CDK2) NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ V-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF) NM_ Actin, beta (ACTB) NM_ Mitogen-activated protein kinase kinase kinase 7 (MAP3K7) NM_ BCL2-associated X protein (BAX) BC Kanmycin Resistant 24 DNA-dependent protein kinase catalytic subunit (PRKDC) U
13 Human Immunotox Plex Human Immunotox Plex 1 Colony stimulating factor 2 (granulocyte-macrophage) (GMCSF) NM_ CD4 antigen (p55) (CD4) NM_ Cytochrome P450, family 1, subfamily A, polypeptide 2 (CYP1A2) NM_ Cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) NM_ Caspase 3, apoptosis-related cysteine peptidase (CASP3) NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC Interleukin 23, alpha subunit p19 (IL23A) NM_ V-myc myelocytomatosis viral oncogene homolog (avian) (MYC) NM_ Lymphotoxin alpha (TNF superfamily, member 1) (LTA) NM_ Interleukin 1, beta (IL1B) NM_ CD14 antigen (CD14) NM_ Protein tyrosine phosphatase, receptor type, C (CD45) NM_ Kappa light polypeptide gene enhancer in B-cells 1(p105) (NFKB1) NM_ Intercellular adhesion molecule 1 (CD54) NM_ Cytochrome P450, family 1, subfamily A, polypeptide 1 (CYP1A1) NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2) (Cox-2) NM_ Scinderin (SCIN) (adseverin) NM_ Actin, beta (ACTB) NM_ Kanmycin Resistant 21 Caspase 9, apoptosis-related cysteine peptidase (CASP9) NM_ Interleukin 15 (IL15) NM_ Tumor protein p53 NM_ CD8 antigen, alpha polypeptide (p32) (CD8A) NM_ Nitric oxide synthase 2A (inducible, hepatocytes) (NOS2A) NM_
14 Human Multitox Plex Human Multitox Plex 1 Cytochrome 2C19 (Cyp2C19) M Cytochrome 1A2 (Cyp1A2) Z Cytochrome 2D6 (Cyp2D6) NM_ Aldehyde dehydrogenase (ALDH1A1) NM_ Heme Oxygenase (HO) X Apoptosis related cysteine protease (CASP3) NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC Cyclooxygenase-2 (Cox2) AY Cytochrome 2C9 (Cyp2C9) M Cytochrome3A4 (Cyp3A4) NM_ CyclinD1 BC Growth arrest DNA damage 153 (GADD153) NM_ Growth arrest DNA damage 45 (GADD45) NM_ Proliferating cell nuclear antigen M Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ NADPH cytochrome P-450 reductase AF Cyclin dependent kinase inhibitor 1A (p21) NM_ Cytochrome1A1 (Cyp1A1) NM_ Cytochrome2B1 (Cyp2B1) M Cytochrome2E1 (Cyp2E1) NM_ Actin, beta (ACTB) NM_ UDP-glucuronosyltransferase AF Cytochrome4A11 (Cyp4A11) NM_ Kanmycin Resistant 25 Tumor protein p53 (p53) AF NAD(P)H dehydrogenase quinone 1 (NQO1) NM_
15 Human Reference Plex Human Reference Plex 1 Ezrin X QRSHs glutaminyl-trna synthetase X Histone deacetylase HD1 U Transferrin Receptor BC Nuclear factor NF45 U MLN51 X Glycerol kinase NM_ Proteasome subunit Y D Ribosomal protein L37a (RPL37A) L S rrna M E2 Ubiquitin conjugating enzyme UbcH5B U Elongation factor EF-1-alpha NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC Lysosomal hyaluronidase AJ Transcription Factor IID X Actin, beta (ACTB) NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ ATP synthase X kDa Alu RNA binding protein (SRP14) NM_ Hypoxanthine ribosyl transferase M Beta 2 microglobulin NM_ Ca2-activated neutral protease large subunit M Kanamycin Resistant Kan(r) 24 Acidic Ribosomal Protein NM_ Beta-glucuronidase NM_
16 Human Breast Cancer Plex Human Breast Cancer Plex 1 CDC42 binding protein kinase alpha NM_ RAB6B, member RAS oncogene family NM_ BCL2 binding component 3 U Keratin 18 NM_ V-myb myeloblastosis viral oncogene homolog NM_ Egl nine homolog 1 NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC Ceruloplasmin (ferroxidase) NM_ WNT1 inducible signaling pathway protein 1 NM_ oxoacid CoA transferase 1 NM_ Aldehyde dehydrogenase 4 family, member A1 NM_ Collagen, type IV, alpha 2 X Transforming growth factor, beta 3 NM_ Estrogen receptor 1 NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Protein regulator of cytokinesis 1 NM_ Actin, beta (ACTB) NM_ Replication factor C (activator 1) 4 NM_ Exostoses (multiple) 1 NM_ Kanamycin Resistant 21 Insulin-like growth factor binding protein 5 L Kinetochore associated 2 NM_ Guanine nucleot. binding protein (G protein), alpha z polypeptide NM_ Deoxycytidine kinase NM_ Adaptor-related protein complex 2, beta 1 subunit NM_
17 Human Multitox Plex Human Multitox Plex 1 Plasminogen activator, tissue (PLAT),transcript variant 1 NM_ V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) (ERBB2), transcript variant 1 NM_ Pitrilysin metallopeptidase 1 (PITRM1) NM_ Mucin 1, transmembrane (MUC1), transcript variant 1 NM_ Cyclin E2 (CCNE2), transcript variant 3 NM_ Baculoviral IAP repeat-containing 5 (survivin) (BIRC5), transcript variant 1 NM_ Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)(egfr), transcript variant 1 NM_ V-myc myelocytomatosis viral oncogene homolog (avian) (MYC) NM_ Matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) (MMP9) NM_ Transferrin receptor (p90, CD71) (TFRC), NM_ Fibroblast growth factor 2 (basic) (FGF2), NM_ Vascular endothelial growth factor BC Cyclin D1 BC Cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A) NM_ Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) NM_ Peptidylprolyl isomerase A (Ppia / Cyclophillin A) BC Actin, beta (ACTB) NM_ SRY (sex determining region Y)-box 9 (campomelic dysplasia, autosomal sex-reversal) (SOX9) NM_ Kanamycin Resistant 20 P53 protein AF
18
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationTNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationEffect of Acid and Pepsin on LPR-Sensitive Mucins In Vitro
Novel Drug Targets for Reflux Disease Role of LPR in Injury and Disease is Controversial Nikki Johnston, Ph.D. Department of Otolaryngology and Communication Sciences Medical College of Wisconsin Milwaukee,
More informationApplied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)
RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationRole of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1):
Role of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1):159-234 Drug Metab Rev. 2007;39(1):159-234 Drug Metab Rev. 2007;39(1):159-234 A schematic representation of the most relevant
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationValidated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationU118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
More informationMolecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
More informationTable S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in
More informationDiagnostic test Suggested website label Description Hospitals available
Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular
More informationDeregulation of signal transduction and cell cycle in Cancer
Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324
More informationCell cycle, signaling to cell cycle, and molecular basis of oncogenesis
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular
More informationBIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The
More informationBiological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
More informationThe importance of pharmacogenetics in the treatment of epilepsy
The importance of pharmacogenetics in the treatment of epilepsy Öner Süzer and Esat Eşkazan İstanbul University, Cerrahpaşa Faculty of Medicine, Department of Pharmacology and Clinical Pharmacology Introduction
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1- Differential expression of stress-related genes. Feature Number Probe Name Systematic Name Gene Name Description 30248 A_52_P342860 NM_007954 Es1 Mus musculus esterase 1 (Es1), mrna
More informationCell cycle and Apoptosis. Chalermchai Mitrpant
Cell cycle and Apoptosis 2556 Chalermchai Mitrpant Overview of the cell cycle Outline Regulatory mechanisms controlling cell cycle Progression of the cell cycle Checkpoint of the cell cycle Phases of the
More informationTumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
More informationApoptosis Oncogenes. Srbová Martina
Apoptosis Oncogenes Srbová Martina Cell Cycle Control point Cyclin B Cdk1 Cyclin D Cdk4 Cdk6 Cyclin A Cdk2 Cyclin E Cdk2 Cyclin-dependent kinase (Cdk) have to bind a cyclin to become active Regulation
More informationSIRT6 histone deacetylase functions as a potential oncogene in human melanoma -
SIRT6 histone deacetylase functions as a potential oncogene in human melanoma - Garcia-Peterson et al Supplementary Figure S:Tissue microarray (TMA) staining and organization. A) Diagram of the TMA indicating
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationLecture #27 Lecturer A. N. Koval
Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates
More informationSUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationSupplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
More informationBiomarkers for Hypothesis Testing
Biomarkers for Hypothesis Testing Definition for Drug Development: Biomarker = Any Measure of a Drug Action Proximal to a Clinical Effect Biochemical (PET, MRS & CSF* for CNS drugs) Physiological EEG,
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationAVAILABLE BIOMARKER ASSAYS
AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated
More informationProf. R. V. Skibbens. Cell Cycle, Cell Division and Cancer (Part 2)
Prof. R. V. Skibbens November 22, 2010 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality - clocks go in only one direction G1 doesn t have replication-inducing
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationRho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
More informationMechanistic Toxicology
SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi
More informationRT 2 Profiler PCR Array:
RT 2 Profiler PCR Array: Rat Cell Cycle Catalog Number For Real-Time Instruments: PARN-020A ABI Standard Blocks; Bio-Rad icycler, MyiQ, and (MJ Research) Chromo 4; and Stratagene Mx3005p, Mx3000p PARN-020C
More informationEffects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )
1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo
More informationSupplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
More informationRegulation of Enzymatic Activity. Lesson 4
Regulation of Enzymatic Activity Lesson 4 Regulation of Enzymatic Activity no real regulation: - regulation of enzyme expression and turnover - control of enzyme trafficking - supply of cofactors real
More informationOligo GEArray DNA Microarray:
Oligo GEArray DNA Microarray: Rat Toxicology and Drug Resistance Catalog Number ORN-401 ERN-401 Format: HybTube (Standard protocol) HybPlate (Higher throughput protocol) Description The Oligo GEArray Rat
More informationSupplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
More informationBasic tumor nomenclature
Jonas Nilsson jonas.a.nilsson@surgery.gu.se Sahlgrenska Cancer Center Bilder gjorda av Per Holmfeldt och Jonas Nilsson Benign tumor Basic tumor nomenclature Malignant tumor = cancer Metastasis Carcinoma:
More informationData Package. Multiplex Oncology I 96 96
Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection
More informationCancer. Throughout the life of an individual, but particularly during development, every cell constantly faces decisions.
Cancer Throughout the life of an individual, but particularly during development, every cell constantly faces decisions. Should it divide? Yes No--> Should it differentiate? Yes No-->Should it die? Yes-->Apoptosis
More informationOncolytic virus strategy
Oncolytic viruses Oncolytic virus strategy normal tumor NO replication replication survival lysis Oncolytic virus strategy Mechanisms of tumor selectivity of several, some of them naturally, oncolytic
More informationCURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products.
CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products Table of Contents Major Current And Emerging Cancer Diagnostic Tests 1. Introduction
More informationSupplementary Material
10.1071/RD13007_AC CSIRO 2014 Supplementary Material: Reproduction, Fertility and Development, 2014, 26(2), 337-345. Supplementary Material Table S1. Details of primers used for quantitative reverse transcription-polymerase
More informationSupporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles
Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 1 DOI 10.5012/bkcs.2011.32.6. Supporting Information Evaluation of Toxicity and Gene Expression
More informationFig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
More informationT cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
More informationChapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
More informationTable S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical
More informationGrowth Factors. BIT 230 Walsh Chapter 7
Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of
More informationrenoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/20177 holds various files of this Leiden University dissertation. Author: Kester, Maria Sophia van (Marloes) Title: Molecular aspects of cutaneous T-cell
More informationLate regulation of immune genes and micrornas in circulating leukocytes in a pig model of
1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More informationMolecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
More informationProtein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B
Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein
More informationSupplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
More informationIndex. neurosurgery.theclinics.com. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A A Complimentary Trial of an Immunotherapy Vaccine Against Tumor-specific EGFRvIII (ACTIVATE), 90 91 Active immunotherapy, 5 8, 96. See
More informationCytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones
Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological
More informationCell signaling. How do cells receive and respond to signals from their surroundings?
Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a
More informationSignaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
More informationR.G.C.C.-RESEARCH GENETIC CANCER CENTRE LTD
ONCONOMICS 1 / 13 R.G.C.C.-RESEARCH GENETIC CANCER CENTRE LTD Dear colleague, Florina, / / We send you the results from the analysis on a patient suffering from carcinoma stage. The sample that was sent
More informationBCHM3972 Human Molecular Cell Biology (Advanced) 2013 Course University of Sydney
BCHM3972 Human Molecular Cell Biology (Advanced) 2013 Course University of Sydney Page 2: Immune Mechanisms & Molecular Biology of Host Defence (Prof Campbell) Page 45: Infection and Implications for Cell
More informationGenetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
More informationCancer Biology How a cell responds to DNA Damage
1 Cancer Biology How a cell responds to DNA Damage Jann Sarkaria Department of Oncology Mayo Clinic 2 EDUCATIONAL GOALS How proteins can transmit signals to each other. The definition of a tumor suppressor
More informationElectron Transport Chain and Oxidative phosphorylation
Electron Transport Chain and Oxidative phosphorylation So far we have discussed the catabolism involving oxidation of 6 carbons of glucose to CO 2 via glycolysis and CAC without any oxygen molecule directly
More informationC-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is
' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various
More informationInnate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
More informationProf. R. V. Skibbens
Prof. R. V. Skibbens December 2, 2011 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality The Cell Cycle clock goes in only one direction S-phase cells
More informationSupporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
More informationDetermination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationBIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
More informationVIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationp53 and Apoptosis: Master Guardian and Executioner Part 2
p53 and Apoptosis: Master Guardian and Executioner Part 2 p14arf in human cells is a antagonist of Mdm2. The expression of ARF causes a rapid increase in p53 levels, so what would you suggest?.. The enemy
More informationSynergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer
Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski,
More information1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:
Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Carcinogenesis Major Principles: 1. Nonlethal genetic damage is central to
More informationInflammation and extracellular proteinases
Inflammation and extracellular proteinases Plaque rupture 75% of MI (heart attack) Foamy macrophages Thin cap No collagen Thin fibrous cap (
More informationPCB 3023 Exam 4 - Form A First and Last Name
PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this
More informationBasic Immunology. Lecture 26 th. Immunity against tumors
Basic Immunology Lecture 26 th Immunity against tumors Neoplastic transformations are genetic alterations. Expression of cell surface antigens both self and non-self - seen by immune system. Ehrlich positive
More informationshehab Moh Tarek ... ManarHajeer
3 shehab Moh Tarek... ManarHajeer In the previous lecture we discussed the accumulation of oxygen- derived free radicals as a mechanism of cell injury, we covered their production and their pathologic
More informationf(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31.
14 12 f(x) = 1.633186874x - 21.46732234 R² =.995616541 RPKM (M8.MXA) 1 8 6 4 2 2 4 6 8 1 12 14 RPKM (M8.MXB) 14 12 f(x) =.821767782x - 4.192595677497E-14 R² = 1 RPKM (M31.XA) 1 8 6 4 2 2 4 6 8 1 12 14
More informationExamination I PHRM 836 Biochemistry for Pharmaceutical Sciences II September 30, 2014
Examination I PHRM 836 Biochemistry for Pharmaceutical Sciences II September 30, 2014 PHRM 836 Exam I - 1 Name: Instructions 1. Check your exam to make certain that it has 10 pages including this cover
More informationELISA kits for Cancer
ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL
More informationDisorders of Cell Growth & Neoplasia. Lecture 4 Molecular basis of cancer
General Pathology VPM 152 Disorders of Cell Growth & Neoplasia Lecture 4 Molecular basis of cancer Enrique Aburto Apr 2010 Skin tumor in a 10-year-old Rottweiler. Considering the external appearance and
More informationTable S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers
Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers ListHits ListTotal PopulationHits PopulationTotal Terms 3 72 10 1429 Glycolysis Pathway 3 72 11 1429 Regulation
More informationTable 1: NFkB Target Gene Sets 1.Genes included in the subset of 15k genes selected according to a MAD-based variation filter
Supplementary Information NFkB target gene sets The NFkB target gene sets are listed below (Table1). In addition to the previously performed mapping of Affymetrix probesets and corresponding Lymphochip
More informationBL 424 Test pts name Multiple choice have one choice each and are worth 3 points.
BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which
More information