Stearoyl-CoA desaturase inhibition blocks formation of hepatitis C virus-induced specialized membranes

Size: px
Start display at page:

Download "Stearoyl-CoA desaturase inhibition blocks formation of hepatitis C virus-induced specialized membranes"

Transcription

1 StearoyloA desaturase inhibition blocks formation of hepatitis virusinduced specialized membranes Rodney K. Lyn 1,2, Ragunath Singaravelu 1,3, Stacia Kargman 4, Shifawn Hara 1, Helen han 4, Renata balla 4, Zheng Huang 4, Daniel M. Jones 5, Andrew Ridsdale 1, Rodney S. Russell 5, Anthony Partridge 4 * & John Paul Pezacki 1,2,3 * 1 ational Research ouncil of anada, ttawa, ntario, anada. 2 Department of hemistry, and 3 Department of Biochemistry, Microbiology and Immunology, University of ttawa, ttawa, anada. 4 Merck Research Laboratories, Merck & o., Kenilworth,.J., USA. 5 Immunology and Infectious Diseases, aculty of Medicine, Memorial University of ewfoundland, St. John s, ewfoundland, anada. urrent address for H: Alexion Pharmaceuticals, Montreal, anada; R: Inception Sciences anada Inc., Vancouver, anada; ZH: Eli Lilly hina Research & Development enter, Shanghai, hina; AP: Pharmaron, Beijing, hina. orrespondence and requests for materials should be addressed to A.P. (Anthony.Partridge@pharmaron.com) or J.P.P. (John.Pezacki@nrccnrc.gc.ca).

2 Relative ell Viability Supplementary igure S ompound [SD] (nm) A (nm) Supplementary igure S1: ytotoxicity assay for inhibitor A. The toxicity of inhibitor A was evaluated via an MTT assay following a 96 hour treatment in Huh7SGR cells. Results confirm no significant cytotoxicity was observed at the concentrations tested.

3 Supplementary igure S2 A H stearic acid SD1 H oleic acid B mau stearic acid oleic acid min Supplementary igure S2: Measuring SD1 cellbased enzymatic activity by labeling of stearic acid. (a) SD1 enzymatic assays were performed by treatment of cells with stearic acid. An organic extraction was performed to isolate lipids, and the conversion rate to oleic acid was subsequently measured via reverse phase HPL. Detection was performed using a scintillation analyzer. (b) An illustration of a typical chromatogram is shown.

4 Supplementary igure S3 A B Huh nm 500 nm 1000 nm Huh7.5 GR 500 nm 1000 nm ellular lipid volume (%) ellular lipid volume (%) 100 nm D nm 15 nm ompound B treatment 50 nm nm 15 nm 50 nm ompound B treatment Supplementary igure S3: S3 protease inhibitor has no effect on LD phenotype. (a) Huh7.5 and (b) Huh7.5GR cells were treated with various concentrations of inhibitor B: 50nM, 15nM, and 5nM and nontreated (mock) of the inhibitor B. 96 hours posttreatment, cells were fixed and imaged by ARS microscopy. Representative images are shown for each concentrations (n=2). Scale bar = 10μm. The LD density was measured by voxel analysis under multiple field of views for (c) Huh7.5 cells (n>10) and (d) Huh7.5GR cells (n>10). The bar graphs illustrate the average cellular lipid volume measured by voxel analysis with error bars representing the standard error of the mean.

5 % change in HV expression in Dig vs Diguc HV expression relative to mock HV expression relative to mock Supplementary igure S4 A ompound A Digitonin uclease P B Dig Diguc P40 P= DigucP40 uc SD SDDig SDDiguc SDP40 SDDigucP40 : % ompound A inhibitor: % Inhibitor SD A Supplementary igure S4: HV RA susceptibility to exogenously added nuclease after inhibiting SD1. (a) Huh7SGR cells were treated with vehicle (DMS) (Lanes 16) or a concentration of inhibitor A yielding a 50% reduction in HV RA levels (Lanes 711) for 96 hours. RTPR was performed to illustrate the relative differences in HV RA abundance (n=4). The second trial (2) was shown as a representative image in igure 2. (b) The densitometry for each trial in (a) is quantified and individually shown. (c) The change in HV RA abundance between digitonin and digitonin nuclease treatments for both mock and inhibitor A treated cells is shown. This graph demonstrates that SD1 inhibition with inhibitor A increases susceptibility of HV RA to exogenously added nucleases in digitonin permeabilized cells.

6 Supplementary igure S5 Supplementary igure S5: Electron microscopy shows that high dose treatment with inhibitor A reduces the appearance of membranous webs and the size and number of lipid droplets in Huh7SGR cells. Huh7SGR cells treated for 96h with vehicle (DMS) (ab) or 500nM inhibitor A (cd) were fixed and processed for EM. ne representative cell is shown for each treatment at magnifications of 1500X (a,c) and 2500X (b,d) MW: membranous webs, LD: lipid droplets, : nucleus

7 Supplementary Table S1: Palmitoleic acid or oleic acid treatment rescues SD inhibitors antiviral effect. Inhibition Rescue E 50 (nm) Inhibitor Structure Gt1b Gt1a Gt1b 50%HS 10% BS 100 µm leic acid 100 µm Palmitoleic acid H > D >40000 H E H >40000 Br > H 3 H 3 H H G > >40000 >40000 H H Br >40000 H 2 S

8 Supplementary Table S2: SD inhibitors do not directly repress HV S3 protease and S5B polymerase activity in vitro. Inhibitor Structure S3 E 50 (nm) S5B E 50 (nm) H > H E > >80000 Br H 3 H 3 H H > G H > H H 2 S Br > >80000

9 Supplementary Table S3: List of primers Primer ame 18S rra WD 18S rra REV HV IRES WD HV IRES REV JH1 HV IRES REV ucleotide Sequence GGATGGGGGGTTATT AATTGTAATTGTGTGT GTTGGGAAGGTGAGTA GAAATTAGGATT GAAATGGGGGATA

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and

More information

Evaluation of Chemical Labeling Strategies for Monitoring HCV RNA using Vibrational Microscopy

Evaluation of Chemical Labeling Strategies for Monitoring HCV RNA using Vibrational Microscopy Electronic Supplementary Information Evaluation of Chemical Labeling Strategies for Monitoring HCV RA using Vibrational Microscopy Matthew oestheden 1,2, Qingyan Hu 1, Angela M. Tonary 1, Li-Lin Tay 3,

More information

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex.

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. Figure Captions Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5- FU(10)/LDH nanohybrids,

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei, Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-

More information

Longitudinal tracking of single live cancer cells to understand cell cycle effects of the

Longitudinal tracking of single live cancer cells to understand cell cycle effects of the Longitudinal tracking of single live cancer cells to understand cell cycle effects of the nuclear export inhibitor, selinexor Joshua M. Marcus 1, Russell T. Burke 1, John A. DeSisto 1, Yosef Landesman

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Enzyme-activatable Probe with a Self-immolative Linker for Rapid and Sensitive

More information

A highly selective AIE fluorogen for lipid droplet imaging in live cells and green algae

A highly selective AIE fluorogen for lipid droplet imaging in live cells and green algae Electronic Supporting Information highly selective IE fluorogen for lipid droplet imaging in live cells and green algae Erjing Wang, ab Engui Zhao, ab Yuning Hong, ab Jacky W. Y. Lam, ab and en Zhong Tang*

More information

A novel toxicogenomics-based approach to categorize. (non-)genotoxic carcinogens

A novel toxicogenomics-based approach to categorize. (non-)genotoxic carcinogens Supplementary Material A novel toxicogenomics-based approach to categorize (non-)genotoxic carcinogens Mirjam M Schaap, Paul FK Wackers, Edwin P Zwart, Ilse Huijskens, Martijs J Jonker, Giel Hendriks,

More information

Lipids and Fatty Acids

Lipids and Fatty Acids Lipids and Fatty Acids Objectives: 1. What are Lipids? properties glycerolipids vs. isoprenoids glycerolipid structure glycerolipid nomenclature 2. Fatty acid biosynthesis ellular localization Substrate

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,

More information

Loss of protein association causes cardiolipin degradation in Barth syndrome

Loss of protein association causes cardiolipin degradation in Barth syndrome SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas

More information

Supplementary materials

Supplementary materials Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds

More information

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the P-gp expression (% of control) 12 1 8 6 4 2 * * Untreated SipA SipA/pSipA WT Supplementary Figure 1. SipA modulates the expression of P-gp in healthy murine intestinal epithelium in vivo. Salmonella Typhimurium

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 ZV 50 nm Relative to Protein Levels () C Relative to Protein Levels () 6 4 2 0 10 8 6 4 2 0 Treatment Time (6 h) ZV Concentration (25 µm) ZV Concentration (25 µm) Supplementary Figure

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Supporting Information

Supporting Information Supporting Information Mass Spectrometry Imaging Shows Cocaine and Methylphenidate have Opposite Effects on Major Lipids in Drosophila Brain Mai H. Philipsen *, Nhu T. N. Phan *, John S. Fletcher *, Per

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2

More information

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in Dynamic Interaction of Stress Granule, and Mediates Multiple Functions in Hepatitis C Virus Infection Véronique Pène, Qisheng Li#, Catherine Sodroski, Ching-Sheng Hsu, T. Jake Liang# Liver Diseases Branch,

More information

SUPPORTING INFORMATION. Evidence for Regulation of Hemoglobin Metabolism and Intracellular Ionic Flux

SUPPORTING INFORMATION. Evidence for Regulation of Hemoglobin Metabolism and Intracellular Ionic Flux SUPPORTING INFORMATION Evidence for Regulation of Hemoglobin Metabolism and Intracellular Ionic Flux by the Plasmodium falciparum Chloroquine Resistance Transporter Andrew H. Lee, Satish K. Dhingra, Ian

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

BIK BIM NOXA PUMA MCL-1. p53

BIK BIM NOXA PUMA MCL-1. p53 HT116 cells A IK IM NOXA PUMA ML-1 p53 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 Procaspase 3 PARP leaved Product 12 8 4 24 hr 48 hr Figure S1. HT116 cell death by different proteasome inhibitors.

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50

More information

High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA

High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA High Throughput Screening as a Research Tool Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA Structure of this seminar Applications of High Throughput Screening

More information

Figure S1, Beyer et al.

Figure S1, Beyer et al. Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r

More information

33VASTVNGATSANNHGEPPS51PADARPR58

33VASTVNGATSANNHGEPPS51PADARPR58 Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation

More information

Regulator for oily skin and balance of skin s microflora

Regulator for oily skin and balance of skin s microflora Regulator for oily skin and balance of skin s microflora Sylvia Eisenberg 1, Nicole Beyer 1, Jutta ZurLage 1, Anett Moschner 1, Hansjürgen Driller 1 1. Merck KGaA, Frankfurter Str. 250, 64293 Darmstadt,

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6* Supplementary Information for Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling Elissaveta Petrova 1,5, Jessica Rios-Esteves 1,2, Ouathek Ouerfelli 3, J. Fraser Glickman 4, and Marilyn

More information

Antiviral Library. HBV Subset. Focus on non-nucleoside compounds

Antiviral Library. HBV Subset. Focus on non-nucleoside compounds Antiviral Library BV ubset ocus on non-nucleoside compounds YAI, eb, 2015 Isosteric transformations eference Compounds examples W 2014106019 BV replication inhibition in immortalized murine hepatocyte

More information

Iron depletion enhances production of antimicrobials by Pseudomonas

Iron depletion enhances production of antimicrobials by Pseudomonas Iron depletion enhances production of antimicrobials by Pseudomonas aeruginosa. Angela T. Nguyen 1, Jace W. Jones 1, Max A. Ruge 1, Maureen A. Kane 1, and Amanda G. Oglesby-Sherrouse 1,2 * University of

More information

Supporting Information. for. Advanced Functional Materials, adfm Wiley-VCH 2006

Supporting Information. for. Advanced Functional Materials, adfm Wiley-VCH 2006 Supporting Information for Advanced Functional Materials, adfm.200500627 Wiley-VCH 2006 69451 Weinheim, Germany Supporting information for: Self-assembly of a Novel Micelle Structure from Graft and Diblock

More information

Supplementary. A multi-analyte responsive chemosensor vanilinyl Schiff base: fluorogenic. sensing to Zn(II), Cd(II) and I -

Supplementary. A multi-analyte responsive chemosensor vanilinyl Schiff base: fluorogenic. sensing to Zn(II), Cd(II) and I - Electronic Supplementary Material (ESI) for ew Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre ational de la Recherche Scientifique 2018 Supplementary A multi-analyte

More information

Bich T. N. Vu 1, Yinsheng Wang 2, Vairamani Mariappanadar 3, John-Stephen A. Taylor 1 and Michael L. Gross 1

Bich T. N. Vu 1, Yinsheng Wang 2, Vairamani Mariappanadar 3, John-Stephen A. Taylor 1 and Michael L. Gross 1 Study of Deamination Kinetics of 5-Methyl Cytosine-Containing Pyrimidine Dimers in ligodeoxynucleotides by uclease P1 Enzyme Digestion Coupled with Tandem Mass Spectrometry Bich T.. Vu 1, Yinsheng Wang

More information

Astrocyte signaling controls spike timing-dependent depression at neocortical synapses

Astrocyte signaling controls spike timing-dependent depression at neocortical synapses Supplementary Information Astrocyte signaling controls spike timing-dependent depression at neocortical synapses Rogier Min and Thomas Nevian Department of Physiology, University of Berne, Bern, Switzerland

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18

More information

Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers

Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers The Journal of International Medical Research 2011; 39: 71 77 Pathological Features and Prognosis in Chronic Hepatitis B Virus Carriers ZH LU, W CHEN, ZC JU, H PEI, XJ YANG, XB GU AND LH HUANG Department

More information

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via

Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces

More information

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,

More information

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier

More information

Dogma: HCV treatment for eradication. Lisa Barrett MD PhD FRCPC Dept. of Infectious Diseases, Microbiology and Immunology April 18, 2015

Dogma: HCV treatment for eradication. Lisa Barrett MD PhD FRCPC Dept. of Infectious Diseases, Microbiology and Immunology April 18, 2015 Dogma: HCV treatment for eradication Lisa Barrett MD PhD FRCPC Dept. of Infectious Diseases, Microbiology and Immunology April 18, 2015 Disclosures Some discussion of non-hc approved compounds Industry:

More information

Specific polyunsaturated fatty acids modulate lipid delivery and oocyte development in C. elegans revealed by molecular-selective label-free imaging

Specific polyunsaturated fatty acids modulate lipid delivery and oocyte development in C. elegans revealed by molecular-selective label-free imaging Specific polyunsaturated fatty acids modulate lipid delivery and oocyte development in C. elegans revealed by molecular-selective label-free imaging Wei-Wen Chen 1,2,3,+, Yung-Hsiang Yi 4,5,+, Cheng-Hao

More information

Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma

Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma cells were treated with celecoxib ( 5.0 M) and/or sildenafil (, 2.0 M). ls were isolated after

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours) A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different

More information

Supporting Information

Supporting Information Supporting Information Natural small molecule FMHM inhibits lipopolysaccharide-induced inflammatory response by promoting TRAF6 degradation via K48-linked polyubiquitination Ke-Wu Zeng 1, Li-Xi Liao 1,

More information

human epithelial cells were pretreated with control sirna (50 nm) or GSK-3β sirna (50 nm)

human epithelial cells were pretreated with control sirna (50 nm) or GSK-3β sirna (50 nm) GSK3β facilitates IFNγ signaling Supplementary Figure Legends Figure S1. The effects of inhibiting GSK3β on IFNγinduced TNFα expression. A, A549 human epithelial cells were pretreated with control sirna

More information

Supplementary information Common molecular mechanism of amyloid pore formation by Alzheimer s -amyloid peptide and -synuclein

Supplementary information Common molecular mechanism of amyloid pore formation by Alzheimer s -amyloid peptide and -synuclein 1 Supplementary information Common molecular mechanism of amyloid pore formation by Alzheimer s -amyloid peptide and -synuclein by Coralie Di Scala, Nouara Yahi, Sonia Boutemeur, Alessandra Flores, Léa

More information

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Prolonged mitotic arrest induces a caspase-dependent DNA damage SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey

More information

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded

More information

Supplementary Information. Supplementary Figure 1

Supplementary Information. Supplementary Figure 1 Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or

More information

SUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7

SUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7 SUPPLEMENTAL DATA Figure S1. Muscle mass changes in different anatomical regions with age. (A) The TA and gastrocnemius muscle showed a significant loss of weight in aged mice (24 month old) compared to

More information

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,

More information

The Components of Life

The Components of Life The omponents of Life Section 1.2 Organic hemistry Pre-View 1.2 hemistry Review MAAP-EO Biology I 8 Section 1.2 The omponents of Life Section 1.2, continued Organic hemistry Each line represents a bond.

More information

Rice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants

Rice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants Rice in vivo RN structurome reveals RN secondary structure conservation and divergence in plants Hongjing Deng 1,2,,5, Jitender heema 3, Hang Zhang 2, Hugh Woolfenden 2, Matthew Norris 2, Zhenshan Liu

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain. Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

Successive optimisation of waste cooking oil transesterification in a continuous microwave assisted reactor

Successive optimisation of waste cooking oil transesterification in a continuous microwave assisted reactor Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Successive optimisation of waste cooking oil transesterification in a continuous microwave

More information

Hepatitis C in Australia:

Hepatitis C in Australia: Hepatitis C in Australia: Epidemiology and Clinical Presentation (and a bit of virology ) A/Prof Mark Douglas Hepatitis C - Distribution Te and Jensen 2010 Clin Liver Dis Hepatitis C Epidemiology Estimated

More information

Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection

Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

ab Hepatic Lipid Accumulation/ Steatosis Assay Kit

ab Hepatic Lipid Accumulation/ Steatosis Assay Kit ab133131 Hepatic Lipid Accumulation/ Steatosis Assay Kit Instructions for Use For evaluating steatosis risk of drug candidates using Oil Red O to stain neutral lipids in hepatocytes. This product is for

More information

Mechanical Stress-Dependent Autophagy Components Release via Extracellular

Mechanical Stress-Dependent Autophagy Components Release via Extracellular Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,

More information

Supplementary Information. Targeting BRK-positive Breast Cancer with Small

Supplementary Information. Targeting BRK-positive Breast Cancer with Small Supplementary Information Targeting BRK-positive Breast Cancer with Small Molecule Kinase Inhibitors Jie Jiang 1#, Fu Gui 1#, Zhixiang He 1#, Li Li 1, Yunzhan Li 1, Shunying Li 2, Xinrui Wu 1, Zhou Deng

More information

SEDEX 90LT Presentation

SEDEX 90LT Presentation SEDEX 90LT Presentation HPLC 2011, Budapest SENSITIVITY FLEXIBILITY SEDERE EXPERIENCE SEDEX 90LT Technology SEDEX 990LT 0LT Light Source Selected Blue-Violet Laser 405nm 10mW Output SEDEX 90LT Technology

More information

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence

More information

The Effects of Transposing Mitochondria From Drug Resistant to Drug Sensitive Breast Cancer Cells

The Effects of Transposing Mitochondria From Drug Resistant to Drug Sensitive Breast Cancer Cells The Effects of Transposing Mitochondria From Drug Resistant to Drug Sensitive Breast Cancer Cells By: Shahzaad Jahangier Department of Chemistry and Biochemistry University of Minnesota Duluth Breast Cancer

More information

genome edited transient transfection, CMV promoter

genome edited transient transfection, CMV promoter Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp

More information

PHARMACEUTICAL MICROBIOLOGY JIGAR SHAH INSTITUTE OF PHARMACY NIRMA UNIVERSITY

PHARMACEUTICAL MICROBIOLOGY JIGAR SHAH INSTITUTE OF PHARMACY NIRMA UNIVERSITY PHARMACEUTICAL MICROBIOLOGY JIGAR SHAH INSTITUTE OF PHARMACY NIRMA UNIVERSITY VIRUS - HISTORY In 1886, the Dutch Chemist Adolf Mayer showed TMD In 1892, the Russian Bactriologist Dimtri Iwanowski isolate

More information

Reading: Chapter 13 (Epidemiology and Disease) in Microbiology Demystified

Reading: Chapter 13 (Epidemiology and Disease) in Microbiology Demystified Biology 100 Winter 2013 Reading Guide 02 Reading: Chapter 13 (Epidemiology and Disease) in Microbiology Demystified Directions: Fill out the reading guide as you read. Again, the reading guide is designed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary igure 1. The expression level of PP4 (At4g16860) is diminished in the rpp4 mutant (SK017569). The mna was extracted to analyze the expression level of PP4 using quantitative PC (qpc). Gene

More information

Supporting Information

Supporting Information Supporting Information H 2 O 2 -Activatable and O 2 -Evolving Nanoparticles for Highly Efficient and Selective Photodynamic Therapy against Hypoxic Tumor Cells Huachao Chen, Jiangwei Tian, Weijiang He,*

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

D. J. Dargan,* C. B. Gait and J. H. Subak-Sharpe

D. J. Dargan,* C. B. Gait and J. H. Subak-Sharpe Journal of General Virology (1992), 73, 407-411. Printed in Great Britain 407 The effect of cicloxolone sodium on the replication in cultured cells of adenovirus type 5, reovirus type 3, poliovirus type

More information

Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%

Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20% Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3

More information

HQ-DNPH 3 V SBT 2003 WHO 2,4- Report Series DNPH 8 HQ-DNPH cartridge DNPH. HQ-DNPH cartridge 2 1 HPLC LC-20AD SPD M20A

HQ-DNPH 3 V SBT 2003 WHO 2,4- Report Series DNPH 8 HQ-DNPH cartridge DNPH. HQ-DNPH cartridge 2 1 HPLC LC-20AD SPD M20A BUNSEKI KAGAKU Vol. 6, No. 1, pp. 791-797 211 211 The Japan Society for Analytical hemistry 791 2,4-1 2 2 1 2 HQ 2,4- DNPH HQ-DNPH, 3 V 1 SBT 23 WHO 28 9 29 Technical Report Series 955 1 FDA 29 7 2 22

More information

Supplemental Figures

Supplemental Figures Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)

More information

A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain

A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain Viruses 2009, 1, 1204-1208; doi:10.3390/v1031204 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Article A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza

More information

Grade of steatosis. group Case No. Supplementary Figure 1:

Grade of steatosis. group Case No. Supplementary Figure 1: a Supplementary Figure 1: b group Case No Grade of steatosis 15m AL 2746 NN 1 15m AL 2746 BN 1 15m AL 2638 2LN 3 15m AL 2638 2RN 3 12m AL 2640 RN 0 12m AL 2640 BN 1 12m AL 2640 LN 2 12m AL 2635 NN 2 12m

More information

Supplementary Information

Supplementary Information Supplementary Information Serum and synovial fluid lipidomic profiles predict obesity-associated osteoarthritis, synovitis, and wound repair Chia-Lung Wu 1,2, Kelly A. Kimmerling 1,2, Dianne Little 3,

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

ras Multikinase Inhibitor Multikinase Inhibitor 0.1

ras Multikinase Inhibitor Multikinase Inhibitor 0.1 a ras ** * ** * ** ** ** ** un in et m lu Se ib SL G 32 W 7 So 50 ra 74 fe ni b LY W 294 or 0 tm 02 R an ap n a in Ev my er cin ol im BE us Z2 3 En P 5 za I13 st 0 au rin D as SP ati 60 nib C 012 is 5

More information

High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart.

High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. Daniel Aston, Rebecca A. Capel, Kerrie L. Ford, Helen C. Christian,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Nature Medicine: doi: /nm.2109

Nature Medicine: doi: /nm.2109 HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael

More information

Supplementary information

Supplementary information Supplementary information Lipid peroxidation causes endosomal antigen release for cross-presentation Ilse Dingjan 1, Daniëlle RJ Verboogen 1, Laurent M Paardekooper 1, Natalia H Revelo 1, Simone P Sittig

More information

Supporting Information

Supporting Information Supporting Information ou et al..73/pnas.08791112 dd Thymidine Release & transfection dd Thymidine Release dd MG132 Fix and IF -14 h 0 h 8 h 24 h 34 h 36 h siontrol simps1-1 simps1-1 simps1-1 simps1-2

More information

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Clinical Experiences Using a Low-Dose, High-Frequency Human Growth Hormone Treatment Regimen

Clinical Experiences Using a Low-Dose, High-Frequency Human Growth Hormone Treatment Regimen Journal of Advancement in Medicine Volume 12, Number 3, Fall 1999 Clinical Experiences Using a Low-Dose, High-Frequency Human Growth Hormone Treatment Regimen Edmund Chein, MD, Daniel G. Vogt, MD, and

More information