Atherosclerosis, the major cause of morbidity and mortality

Transcription

1 National Cholesterol Awareness Month Article Basic Sciences Coenzyme Q10 Promotes Macrophage Cholesterol Efflux by Regulation of the Activator Protein-1/miR-378/ ATP-Binding Cassette Transporter G1 Signaling Pathway Dongliang Wang,* Xiao Yan,* Min Xia, Yan Yang, Dan Li, Xinrui Li, Fenglin Song, Wenhua Ling Downloaded from by guest on April 7, 2018 Objective Recent studies have shown the role of mirnas in macrophage reverse cholesterol transport and atherogenesis. We hypothesized that coenzyme Q10 (CoQ10) may increase macrophage reverse cholesterol transport by regulating mirna expression that contributes to the prevention of atherosclerosis. Approach and Results CoQ10 treatment suppressed oxidized low-density lipoprotein induced macrophage foam cell formation by ameliorating the binding of activator protein-1 to the putative promoter region of mir-378 primary transcript, thus decreasing the mir-378 level and enhancing the ATP-binding cassette transporter G1 mediated macrophage cholesterol efflux to high-density lipoprotein. Subsequently, the axis of activator protein-1/mir-378/atp-binding cassette transporter G1 cholesterol efflux was confirmed in peritoneal macrophages isolated from CoQ10-treated apolipoprotein E deficient mice. Finally, CoQ10 consumption promoted macrophage reverse cholesterol transport and inhibited the progression of atherosclerosis in apolipoprotein E deficient mice. Conclusions This study identified activator protein-1/mir-378/atp-binding cassette transporter G1 as a novel cascade for CoQ10 in facilitating macrophage cholesterol efflux in vitro and in vivo. Our data thus imply that both CoQ10 and mir-378 are promising candidates for atherosclerosis prevention and treatment. (Arterioscler Thromb Vasc Biol. 2014;34: ) Key Words: atherosclerosis coenzyme Q10 macrophages mirnas Atherosclerosis, the major cause of morbidity and mortality in Western societies, initiates and develops with the accumulation of circulating monocyte-derived macrophage foam cells in the arterial wall. Cholesterol homeostasis in macrophages is tightly regulated by cholesterol influx, endogenous synthesis, and efflux. Promoting cholesterol efflux from macrophages to high-density lipoprotein (HDL) to be transported to the liver for excretion, a process known as macrophage reverse cholesterol transport (RCT), has been shown to prevent or even regress atherosclerosis. 1 Several transcription factors (TFs) involved in regulating ATP-binding cassette transporters A1 (ABCA1) and G1 (ABCG1), 2 key transporters that facilitate cellular cholesterol efflux, have been discovered. 2 Among them, activation of liver X receptor α (LXRα) remarkably induces ABCA1 and ABCG1 expression and promotes macrophage RCT and established atherosclerosis regression, although it induces excess triglyceride accumulation in blood and liver. 2 Additional levels of regulatory control by small RNAs are now emerging in macrophage cholesterol homeostasis. 3 Mammalian mirnas, highly conserved noncoding small RNAs of 19 to 26 nucleotides, are key posttranscriptional regulators that contribute to the maintenance of differentiated cell phenotypes. 4 mirnas usually bind to the 3 -untranslated regions (3 -UTRs) of target mrnas, promoting mrna degradation and inhibiting translation of the protein-coding genes. 5 Recently, several mirnas that mediate macrophage cholesterol efflux have been demonstrated using cell culture and animal models 3 ; mir-33 is prominent because it promotes macrophage RCT and the regression of established atherosclerosis in low-density lipoprotein receptor deficient mice, 6 thus exemplifying mirna control of macrophage cholesterol homeostasis and atherosclerosis development. However, the identities of the mirnas mediating macrophage cholesterol efflux with natural nutrients in vivo are largely unknown, except we recently reported that protocatechuic acid promotes macrophage RCT partially by repressing mir-10b in apolipoprotein E deficient (apoe / ) mice. 7 See accompanying editorial on page 1795 Coenzyme Q10 (CoQ10), a well-known player in cellular bioenergetics, 8 has been intensively implicated in protecting Received on: November 12, 2013; final version accepted on: March 17, From the Department of Nutrition, School of Public Health, Sun Yat-Sen University (Northern Campus), Guangzhou, Guangdong Province, People s Republic of China (D.W., X.Y., M.X., Y.Y., D.L., X.L., F.S., W.L.); and Guangdong Provincial Key Laboratory of Food, Nutrition and Health, Department of Nutrition, School of Public Health, Sun Yat-Sen University (Northern Campus), Guangzhou, Guangdong Province, People s Republic of China (D.W., M.X., Y.Y., D.L., W.L.). *These authors contributed equally. The online-only Data Supplement is available with this article at Correspondence to Wenhua Ling, PhD, Department of Nutrition, School of Public Health, Sun Yat-sen University, Guangzhou , PR China. lingwh@mail.sysu.edu.cn 2014 American Heart Association, Inc. Arterioscler Thromb Vasc Biol is available at DOI: /ATVBAHA

2 Wang et al CoQ10 Promotes Macrophage Cholesterol Efflux 1861 Downloaded from by guest on April 7, 2018 Nonstandard Abbreviations and Acronyms ABCA1 ABCG1 AP apoa-i apoe / ATF CoQ10 HDL-C LXRα MPM OxLDL PKC RCT TF UTR VLDL ATP-binding cassette transporter A1 ATP-binding cassette transporter G1 activator protein apolipoprotein A-I apolipoprotein E deficient activating transcription factor coenzyme Q10 high-density lipoprotein cholesterol liver X receptor α mouse peritoneal macrophage oxidized low-density lipoprotein protein kinase C reverse cholesterol transport transcription factor untranslated region very-low-density lipoprotein against chronic diseases, especially atherosclerosis. 9 It has been proposed that antioxidation and inhibition of inflammation contribute to CoQ10-induced antiatherosclerotic effects. 10,11 Because a recent study shows that CoQ10 can reduce mir- 146a expression in human THP-1 monocytes and mouse liver, 12 we hypothesized that CoQ10 exerts its atheroprotective effects partially by promoting mirnas-mediated macrophage cholesterol efflux. We showed that CoQ10 transcriptionally suppresses mir-378 expression through activator protein-1 (AP-1), upregulates ABCG1 expression, and then promotes macrophage cholesterol efflux in vitro and in vivo. Materials and Methods Materials and Methods are available in the online-only Supplement. Results CoQ10 Promotes Macrophage Cholesterol Efflux To evaluate the inhibitory effect of CoQ10 on macrophage foam cell formation, mouse J774.A1 and human THP-1 macrophages were loaded with oxidized low-density lipoprotein (OxLDL) as cell culture models. Compared with control cells, CoQ10 significantly inhibited OxLDL-induced macrophage foam cell formation as determined by Oil Red O (Figure 1A 1D) and filipin staining (Figure IA in the online-only Data Supplement), as well as by analyzing cellular cholesterol content (Figure 1E and 1F). Importantly, CoQ10 had no obvious effect on cholesterol influx assessed by microscopic analysis and measurement of cellular 1,1 -dioctadecyl-3,3,3 3 -tetramethylindocarbocyanine perchlorate-oxldl, as well as quantitative real-time polymerase chain reaction and Western blotting analyses of scavenger receptor class A and CD36 (Figure IB and IC in the Figure 1. Coenzyme Q10 (CoQ10) modulates macrophage cholesterol homeostasis by enhancing cholesterol efflux. J774.A1 (A) and THP-1 macrophages (B) were incubated with the vehicle dimethyl sulfoxide (DMSO; control), oxidized low-density lipoprotein (OxLDL; 50 μg/ml), CoQ10, or a combination of CoQ10 and OxLDL for 24 hours. After fixation by 4% paraformaldehyde, cells were stained with Oil Red O to detect lipid accumulation, and hematoxylin was used for counterstaining. The figure is representative of 3 independent experiments (magnification 400). C and D, The density of lipid content was evaluated by alcohol extraction after staining. The absorbance at 540 nm was measured using a microplate reader. E and F, The intracellular levels of total cholesterol were analyzed by colorimetric assay kits. J774.A1 (G) and THP-1 macrophages (H) preloaded with 1.0 μci/ml 3 H-cholesterol and OxLDL were treated with CoQ10 or DMSO for 24 hours and subsequently incubated with apolipoprotein A-I (apoa-i; 15 μg/ml) or high-density lipoprotein (HDL; 100 μg/ml) for another 24 hours. Cholesterol efflux was measured as described in Materials and Methods in the online-only Data Supplement. C H, The data are the mean±sem (n=3). C F, *P<0.05 vs (CoQ10 [ ] and OxLDL [+]). G and H, *P<0.05 vs control. The data were analyzed with 1-way ANOVA and the Bonferroni Dunn post hoc test.

3 1862 Arterioscler Thromb Vasc Biol September 2014 Downloaded from by guest on April 7, 2018 online-only Data Supplement). In addition, CoQ10 cannot obviously alter the expression of genes critical to cholesterol synthesis and influx gauged by quantitative real-time polymerase chain reaction analyses of related genes (Figure ID and IE in the online-only Data Supplement). Instead, CoQ10 promoted cholesterol efflux from OxLDL-loaded macrophages to HDL but not apolipoprotein A-I (apoa-i) in a dose-dependent manner (Figure 1G and 1H). These results imply that CoQ10 inhibits macrophage foam cell formation by promoting macrophage cholesterol efflux. CoQ10 Induces ABCG1 Expression by Repressing mir-378 in Macrophages As shown in Figure 2A to 2D, CoQ10 dose dependently increased the expression of ABCG1 but not ABCA1 and scavenger receptor class B type I at the mrna and protein (quantification in Figure IIA and IIB in the online-only Data Supplement) levels in OxLDL-loaded J774.A1 and THP-1 macrophages. Because macrophages can release cellular free cholesterol to extracellular HDL by diffusion, 13 the specific role of ABCG1 in CoQ10-mediated cholesterol efflux was tested. Western blotting analysis showed that ABCG1 protein expression was effectively suppressed by small interfering RNA, but scramble small interfering RNA had no such effect (inset of Figure 2E and 2F; quantification in Figure IIC in the online-only Data Supplement). ABCG1 silencing abolished CoQ10-induced cholesterol efflux to HDL (Figure 2E and 2F). Importantly, CoQ10 had no significant effect on the transcriptional activity of ABCG1 in OxLDL-loaded macrophages (Figure IIIA and IIIB in the online-only Data Supplement). Furthermore, CoQ10 did not alter LXRα expression and transcriptional activity (Figure IIIC IIIH in the online-only Data Supplement). In contrast, CoQ10 markedly prolonged the halflives of ABCG1 mrna and restored the diminished luciferase reporter activities induced by the presence of mouse and human ABCG1 3 -UTR in 2 cells (Figure 2G 2J). Collectively, these Figure 2. Coenzyme Q10 (CoQ10) post-transcriptionally regulates ATP-binding cassette transporter G1 (ABCG1). A D, Oxidized low-density lipoprotein (OxLDL) loaded J774.A1 and THP-1 macrophages were treated with CoQ10 (1, 10, 100 μmol/l) or the vehicle (dimethyl sulfoxide [DMSO]) for 24 hours. mrna and protein expression of ATP-binding cassette transporter A1 (ABCA1), ABCG1, and scavenger receptor class B type I (SR-BI) were then determined by quantitative real-time polymerase chain reaction (qrt-pcr; A and C) and Western blotting (B and D), respectively. E and F, Cholesterol efflux to high-density lipoprotein (HDL) in OxLDL-loaded J774.A1 (E) and THP-1 macrophages (F) transfected with scrambled or ABCG1 small interfering RNA (sirna) with or without CoQ10 (10 μmol/l). Inset, Western blotting for ABCG1. OxLDL-loaded J774.A1 (G) and THP-1 macrophages (I) were treated with CoQ10 (10 μmol/l) or the vehicle (DMSO) for 24 hours. Cells were then treated with 10 μg/ml of actinomycin D, and ABCG1 mrna expression at indicated time points was quantified by qrt-pcr. OxLDL-loaded J774.A1 (H) and THP-1 macrophages (J) were cotransfected with mouse (m) and human (h) ABCG1 promoter and Renilla (for internal normalization) for 6 hours, respectively. Cells were then treated with CoQ10 (10 μmol/l) or DMSO for 12 hours, and the activity of the luciferase reporter was measured by the Dual-Luciferase Reporter Assay System. B, D, and inset of E and F are representative images of 3 independent assays. For the other panels, data are the mean±sem (n=3 6). A and C, *P<0.05 vs control. The data were analyzed with 1-way ANOVA and the Bonferroni Dunn post hoc test. E, F, H, and J, #P<0.05. The data were analyzed with Student t test.

4 Wang et al CoQ10 Promotes Macrophage Cholesterol Efflux 1863 Downloaded from by guest on April 7, 2018 results suggest that CoQ10 promotes macrophage cholesterol efflux in an ABCG1-dependent manner that is associated with enhanced ABCG1 mrna stability by its 3 -UTR sequence. To test whether mirnas, well-known regulators of mrnas destabilization by binding to 3 -UTRs of their target genes, 4 are involved in CoQ10-mediated ABCG1 mrna stability, we undertook an unbiased mirna microarray analysis. Among the 1891 mouse individual mirnas represented on the microarrays, 40 mirnas were 2-fold differentially expressed between CoQ10- and vehicle-treated J774.A1 cells (Figure IVA in the online-only Data Supplement). The quantitative real-time polymerase chain reaction analyses confirmed the upregulation and downregulation of candidate mirnas by CoQ10 in OxLDL-loaded mouse peritoneal macrophages (MPMs), J774.A1, and THP-1 macrophages (Figure IVB IVD in the online-only Data Supplement). Using several mirna target prediction databases, 4 we found that the mouse or human ABCG1 3 -UTR has 3 or 1 computationally predicted mir-378 binding sites, respectively (Figure VA and VB in the online-only Data Supplement). Sites 2 and 3 in mouse ABCG1 3 -UTR are conserved in mouse and rat, whereas site 1 in human is conserved in human and nonhuman primates (Figure VA and VB in the online-only Data Supplement). Notably, mir-378 levels were higher in aortas isolated from apoe / mice aged 30 weeks than in mice aged 15 weeks, suggesting that mir-378 plays a role in the development of atherosclerosis (Figure VC in the online-only Data Supplement). To gain insight into the effect of mir-378 on ABCG1 expression, macrophages with overexpression or inhibition of mir-378 were established by transfection with a mir-378 mimic or an antisense inhibitor of mir-378 (anti mir-378), respectively. As expected, the mir-378 mimic dose dependently increased cellular mir-378 levels in J774A.1 and THP-1 macrophages, and the concentration of the mir-378 mimic at 150 nmol/l produced a maximal increase of 14-fold (Figure VD and VE in the online-only Data Supplement). In contrast, anti mir-378 dose dependently reduced cellular mir-378 levels in 2 cells (Figure VF and VG in the online-only Data Supplement). Importantly, mir-378 repressed the expression of ABCG1 at the mrna and protein levels in a dose-dependent manner, and conversely, the inhibition of this mirna increased ABCG1 levels (Figure 3A 3H; protein quantification in Figure IID and IIE in the online-only Data Supplement). To determine the effects of mir-378 on the 3 -UTR of mouse and human ABCG1, a luciferase reporter containing the ABCG1 3 -UTR fragment with the mir-378 binding sites (wild type) or the mutant mir-378 binding sites (mutation type) was used. The mir-378 mimic dose dependently repressed mouse and human ABCG1 3 -UTR activities (Figure VH in the online-only Data Supplement). Moreover, overexpression of mir-378 suppressed the wild-type but not the mutant ABCG1 3 -UTR activity in mouse or human macrophages (Figure 3I and 3J). These results demonstrated that mir-378 directly targets ABCG1. Functional studies further showed that mir- 378 overexpression inhibited macrophage cholesterol efflux to HDL, whereas mir-378 inhibition enhanced macrophage cholesterol efflux (Figure 3K 3N). To test the role of mir-378 in CoQ10-induced macrophage cholesterol efflux (Figure 1G and 1H) and ABCG1 expression (Figure 2A 2D), OxLDL-loaded J774.A1 and THP-1 macrophages with mir-378 overexpression or inhibition were studied. As shown in Figure 4A to 4C, mir- 378 mimic could block the increase of ABCG1 expression (protein quantification in Figure IIF in the online-only Data Supplement) and HDL-mediated cholesterol efflux induced by CoQ10. Moreover, anti mir-378 could not further enhance CoQ10-induced ABCG1 expression at the protein (Figure 4A; quantification in Figure IIF in the onlineonly Data Supplement) and mrna (Figure 4D) levels and HDL-mediated cholesterol efflux (Figure 4E). These results thus suggest that CoQ10 induces ABCG1 expression by downregulating mir-378 expression and thus promotes macrophage cholesterol efflux to HDL. CoQ10 Negatively Regulates mir-378 via AP-1 To explore how CoQ10 modulates mir-378 expression, we examined a region 2 kb upstream of the transcription start site of the mir-378 primary transcript (pri-mir-378) in silico using mirgen AP-1 and the other 4 TFs, hepatocyte nuclear factor 4, Elk-1, NK2 homeobox 5, and c-rel (Table II in the online-only Data Supplement), were expected to bind to the putative promoters of mouse and human primir-378. AP-1 is composed of protein products of members of fos and jun families, which form homodimeric or heterodimeric complexes; the predominant forms of AP-1 in most cells are c-fos/c-jun heterodimers. 15 CoQ10 had no obvious effect on the expression of Elk-1, phosphorylated Elk-1, and c-rel, whereas hepatocyte nuclear factor 4 and NK2 homeobox 5 were undetectable in OxLDL-loaded J774. A1 and THP-1 macrophages treated with or without CoQ10 (data not shown). However, CoQ10 remarkably reduced the expression of the AP-1 component c-jun (but not c-fos) at the protein and mrna levels (left panels of Figure 5A and 5B; Figure VIA VID in the online-only Data Supplement; protein quantification in Figure IIG and IIH in the onlineonly Data Supplement). Activation of AP-1 by 12-O-tetradecanoylphorbol-13-acetate, a known stimulator for AP-1, increased mir-378 expression (Figure 5A and 5B, right), and conversely, AP-1 inhibition by c-jun small interfering RNA reduced mir-378 expression (Figure VIE and VIF in the online-only Data Supplement). Furthermore, c-jun silencing increased ABCG1 protein expression in macrophages, whereas this was not observed in macrophages cotransfected with 150 nmol/l mir-378 (Figure 5C and 5D; protein quantification in Figure III in the online-only Data Supplement). Importantly, CoQ10 restored 12-O-tetra-decanoylphorbol- 13-acetate induced mir-378 expression (Figure 5A and 5B, right), whereas CoQ10 had no obvious effect on the mir-378 level in macrophages knockdown of c-jun (Figure VIE and VIF in the online-only Data Supplement). These results suggest that CoQ10 reduces mir-378 expression by inhibiting AP-1, thus leading to increment of its target gene ABCG1. We next performed chromatin immunoprecipitation and luciferase reporter assays to assess the potential transactivation of the mir-378 gene by AP-1. Chromatin immunoprecipitation assays showed that AP-1 directly bound to the putative-binding sites of mouse and human pri-mir-378 at 37 and 531, respectively (Figure 5E and 5F). Luciferase

5 1864 Arterioscler Thromb Vasc Biol September 2014 Downloaded from by guest on April 7, 2018 Figure 3. mir-378 directly targets the 3 -untranslated region (3 -UTR) of ATP-binding cassette transporter G1 (ABCG1). A D, Oxidized low-density lipoprotein (OxLDL) loaded J774.A1 and THP-1 macrophages were transfected with control mir (Con mir; 150 nmol/l) or the indicated concentrations of mir-378 for 48 hours. ABCG1 mrna and protein expression were then determined by quantitative realtime polymerase chain reaction (qrt-pcr; A and C) and Western blotting (B and D). qrt-pcr (E and G) and Western blotting (F and H) analyses of mouse and human ABCG1 in OxLDL-loaded J774.A1 and THP-1 macrophages transfected with Con mir (150 nmol/l) or mir-378 (150 nmol/l) in the presence or absence of a control inhibitor (Con Inh,150 nmol/l) or anti mir-378 (150 nmol/l). I and J, The mir-378 target sites in mouse and human ABCG1 are shown in the right panels of I and J. Mutants were generated in the mouse and human ABCG1 3 -UTR seed regions, as indicated. HEK293 cells were cotransfected with Con mir (40 nmol/l) or mir-378 (40 nmol/l), either 50 ng of pgl-3-wild-type (WT) or pgl3-mutant and 50 ng of prl-tk for 48 hours, as described in Materials and Methods in the online-only Data Supplement. Luciferase reporter activities were then measured by the Dual-Luciferase Reporter Assay System. Cholesterol efflux to HDL from OxLDL-loaded J774.A1 (K and L) and THP-1 macrophages (M and N) transfected with the indicated concentrations of Con mir or mir-378, or Con Inh or anti mir-378. B, D, F, and H, Representative images of 3 independent assays. A, C, E, and G, The data are expressed as the mean±sem of fold of either Con mir (A and C) or Con mir and Con Inh (E and G; n=3). *P<0.05 vs Con mir or Con mir and Con Inh, 1-way ANOVA coupled with the Bonferroni Dunn post hoc test. I and J, The data are expressed as the mean percentage of the 3 -UTR activity of Con mir±sem (n=3). #P<0.05, Student t test. K N, The data are the mean±sem (n=3 6). *P<0.05 vs Con mir or Con Inh, 1-way ANOVA coupled with the Bonferroni Dunn post hoc test. reporter assays showed that AP-1 activation induced by 12-O-tetra-decanoylphorbol-13-acetate increased transactivation of the mir-378 gene with the putative-binding sites of mouse and human pri-mir-378 at 37 and 531, respectively (Figure 5G and 5H, left). After c-jun silencing in macrophages, AP-1 mediated transactivation of the mir-378 gene was remarkably attenuated (Figure 5G and 5H, right), which is consistent with the concept that AP-1 directly targeted the downstream mir-378. In addition, CoQ10 reduced mouse and human mir-378-promoter driven luciferase activity in cells treated with 12-O-tetra-decanoylphorbol-13-acetate or not but not with mutant or deleted AP-1 binding sites (Figure 5G and 5H, left). These data suggest that CoQ10 ameliorates the binding of AP-1 to the putative promoter region of pri-mir-378, thus decreases the mir-378 level. CoQ10 Enhances Macrophage RCT In Vivo To test whether the in vitro findings on macrophage cholesterol efflux by CoQ10 could be extended into in vivo circumstances, 30-week-old male apoe / mice were orally gavaged once daily with CoQ10 (600 mg/kg body weight [BW]) for 14 days. CoQ10 treatment resulted in higher serum CoQ10 concentrations by 50-fold (Figure 6A). CoQ10 treatment decreased c-jun (Figure 6B; left panel of Figure VIIA in the online-only Data Supplement; protein quantification in Figure IIJ in the online-only Data Supplement) and mir-378 (Figure 6C) expression and increased ABCG1 expression (Figure 6D; right panel of Figure VIIA in the online-only Data Supplement; protein quantification in Figure IIJ in the online-only Data Supplement) in mouse aortas. Furthermore, MPMs isolated from mice treated with CoQ10 for 14 days

6 Wang et al CoQ10 Promotes Macrophage Cholesterol Efflux 1865 Downloaded from by guest on April 7, 2018 Figure 4. mir-378 regulates coenzyme Q10 (CoQ10) induced macrophage cholesterol efflux. Oxidized low-density lipoprotein (OxLDL) loaded J774.A1 and THP-1 macrophages were transfected with either a control mir (Con mir, 150 nmol/l) or mir-378 (40 or 150 nmol/l), or a control inhibitor (Con Inh, 150 nmol/l) or anti mir-378 (150 nmol/l) for 24 hours. Cells were then treated with CoQ10 (10 μmol/l) or the vehicle (dimethyl sulfoxide [DMSO]) for another 24 hours. ATP-binding cassette transporter G1 (ABCG1) protein and mrna expression were determined by Western blotting (A) and quantitative real-time polymerase chain reaction (B and D), respectively. The 3 H-cholesterol labeled and OxLDL-loaded J774.A1 and THP-1 macrophages were transfected with either Con mir or mir-378 (C), or Con Inh or anti mir-378 (E) for 24 hours. Cells were then treated with CoQ10 or DMSO for another 24 hours, and cholesterol efflux to high-density lipoprotein (HDL) was determined. A, Representative images of 6 independent assays. B E, The data are expressed as the mean±sem of fold of either Con mir or Con Inh (n=6). *P<0.05 vs CoQ10, Student t test. NS indicates not significant. had lower levels of c-jun (Figure 6E; left panel of Figure VIIB in the online-only Data Supplement; protein quantification in Figure IIK in the online-only Data Supplement) and mir-378 (Figure 6F), which were associated with increased ABCG1 expression (Figure 6G; right panel of Figure VIIB in the online-only Data Supplement; protein quantification in Figure IIK in the online-only Data Supplement) and enhanced cholesterol efflux ability to HDL (Figure 6H). In keeping with ex vivo studies, CoQ10-treated apoe / mice had increased 3 H tracer levels in feces at 48 hours and in plasma at 6 and 24 hours but showed no significant effect on 3 H tracer recovery in the liver or plasma at 48 hours (Figure 6I). To identify whether alteration of ABCG1 expression is modulated by mir-378 in vivo, we performed a time-course experiment in isolated MPMs correlating with the pharmacokinetics of CoQ10 in apoe / mice. Within 0 to 24 hours of CoQ10 intervention, we observed that the peak serum CoQ10 level occurred at 4 hours; however, the mir-378 level started to decline at 6 hours, with the strongest reduction at 10 hours, and retained the lower level until 24 hours. Conversely, ABCG1 mrna expression began to increase at 8 hours, reached its peak at 12 hours, and sustained that level for 24 hours (Figure 6J). Together, the lag response of ABCG1 to mir-378 indicates that CoQ10 may attenuate the mir-378 level and subsequently induce ABCG1 expression. CoQ10 Inhibits the Progression of Atherosclerosis In Vivo To examine the effect of CoQ10 on atherogenesis, male apoe / mice at 30 weeks were either euthanized (baseline) or subjected to treatments of the vehicle, CoQ10, or T (a known agonist for LXR) for 4 weeks. As demonstrated by Oil Red O staining (Figure 7A) and total cellular lipid (Figure 7B) and cholesterol (Figure 7C) assays, isolated MPMs from CoQ10-fed mice had a decreased level of macrophage foam cell formation compared with control mice. Both the atherosclerotic plaque size in the aortic sinus and whole aorta cholesterol levels showed decline in CoQ10-treated mice (Figure 7D 7F) compared with control mice, whereas no significant changes were observed compared with testing mice before CoQ10 intervention (baseline). Furthermore, CoQ10- treated apoe / mice displayed elevated protein (Figure 7G; quantification in Figure IIL and IIM in the online-only Data Supplement) and mrna (Figure VIIC and VIID in the online-only Data Supplement) expression of ABCG1 in aortas and MPMs. The plasma lipid profile revealed that

7 1866 Arterioscler Thromb Vasc Biol September 2014 Downloaded from by guest on April 7, 2018 Figure 5. Coenzyme Q10 (CoQ10) regulates mir-378 through activator protein-1 (AP-1). A and B, Left, Oxidized low-density lipoprotein (OxLDL) loaded J774.A1 (A) and THP-1 macrophages (B) were treated with CoQ10 or the vehicle (dimethyl sulfoxide [DMSO]) for 24 hours. The protein expression of c-jun and c-fos was then determined by Western blotting. Right, OxLDL-loaded J774.A1 (A) and THP-1 macrophages (B) were treated with 12-O-tetra-decanoylphorbol-13-acetate (TPA; 50 nmol/l) or PBS control in the presence or absence of CoQ10 (10 μmol/l) for 24 hours. The mir-378 contents were then determined by quantitative real-time polymerase chain reaction. C and D, Western blotting analysis of ATP-binding cassette transporter G1 (ABCG1) expression in OxLDL-loaded J774.A1 (C) and THP-1 macrophages (D) transfected with scrambled or c-jun small interfering RNA (sirna) in the presence or absence of control mir (Con mir; 150 nmol/l) or mir-378 (150 nmol/l) for 48 hours. E and F, Top, mouse and human putative promoter elements of the mir-378 gene. The schematic diagram represents 2 potential binding sites. Bottom, Densitometry analysis of chromatin immunoprecipitation gels in OxLDL-loaded J774.A1 (E) and THP-1 macrophages (F) treated with TPA or PBS in the presence or absence of CoQ10 for 24 hours. Left, Luciferase reporter activities in J774.A1 (G) and THP-1 macrophages (H) transfected with a series of luciferase constructs containing fulllength or truncated promoter elements of mouse or human mir-378 with wild-type putative AP-1 binding sites or mutant-binding sites. After transfection, cells were treated with TPA or PBS in the presence or absence of CoQ10 for 24 hours. Right, Luciferase activities in J774.A1 (G) and THP-1 macrophages (H) cotransfected with c-jun sirna and the luciferase reporter construct bearing the mouse or human mir-378 promoter. Left panels of A and B, as well as C and D, are representative images of 3 independent assays. Right panels of A and B, The data are the mean±sem (n=3). #P<0.05, Student t test. Lower panels of E and F, and left panels of G and H, The data are the mean±sem (n=3). *P<0.05 vs control, #P<0.05 vs (control+tpa), Student t test. Right panels of G and H, The data are the mean±sem (n=3). *P<0.05 vs scramble sirna, Student t test. CoQ10 decreased plasma total cholesterol and total triglyceride, as well as elevated HDL-C and apoa-i levels (Table III in the online-only Data Supplement). Furthermore, fast protein liquid chromatography analyses showed that CoQ10 reduced cholesterol content in the very LDL (VLDL) fraction (Figure VIIE in the online-only Data Supplement). In addition, T treated mice showed promoted regression of endogenous foam cell formation and established atherosclerosis (Figure 7A 7F). Moreover, T increased ABCG1 protein (Figure 7G; quantification in Figure IIL and IIM in the online-only Data Supplement) and mrna (Figure VIIC and VIID in the online-only Data Supplement) expression in aortas and MPMs, as well as in plasma triglyceride level (Table III in the online-only Data Supplement), which were consistent with recent studies. 16 Together, these observations indicate that CoQ10 reduces the progression but does not promote the regression of atherosclerosis in vivo. Discussion Although both antioxidative and anti-inflammatory functions contribute to the antiatherosclerotic effect of CoQ10, it is still unknown whether the promotion of macrophage RCT is involved. Here, we provide novel findings that CoQ10 promotes macrophage RCT through a previously undescribed

8 Wang et al CoQ10 Promotes Macrophage Cholesterol Efflux 1867 Downloaded from by guest on April 7, 2018 Figure 6. Coenzyme Q10 (CoQ10) promotes macrophage reverse cholesterol transport (RCT) in vivo. A G, Thirtyweek-old male apolipoprotein E deficient (apoe / ) mice were orally gavaged with CoQ10 (600 mg/kg BW) or the vehicle (normal saline) once daily for 14 days. The blood samples were collected 4 hours after CoQ10 treatment at day 14. Serum CoQ10 concentrations were then determined by high-performance liquid chromatography with electrochemical detection (A). c-jun and c-fos protein expression (B), mir-378 content (C), and protein expression of ATP-binding cassette transporter A1 (ABCA1), ATPbinding cassette transporter G1 (ABCG1), and scavenger receptor class B type I (SR-BI; D) in aortas isolated from CoQ10- or the vehicle-treated apoe / mice were determined by Western blotting and quantitative real-time polymerase chain reaction (qrt-pcr). The aortas were pooled with 4 mice in each group. Thioglycollate-elicited mouse peritoneal macrophages (MPMs) were obtained for the qrt-pcr and Western blotting analyses of cellular c-jun and c-fos protein (E) expression, mir-378 contents (F), ABCA1, ABCG1, and SR-BI protein expression levels (G), and cholesterol efflux to apolipoprotein A-I (apoa-i) and high-density lipoprotein (HDL; H). Isolated MPMs were pooled with 4 mice in each group. The method of injection of thioglycollate to obtain MPMs is described in Materials and Methods in the online-only Data Supplement. I, Thirty-week-old male apoe / mice were orally gavaged with CoQ10 (600 mg/kg BW) or the vehicle once daily for 14 days. On day 12, 3 H-cholesterol labeled and oxidized low-density lipoprotein (OxLDL) loaded MPMs (typically cells at cpm per mouse) were intraperitoneally injected into the mice. After cell injection, blood at 6, 24, and 48 hours, liver at 48 hours (after the animals were euthanized), and feces within the 48-hour experimental period were collected for the analysis of macrophage RCT. 3 H-cholesterol recovery in the feces, liver, and plasma were measured. J, Four-hour fasted apoe / mice that were intraperitoneally injected with thioglycollate were orally treated with CoQ10 (600 mg/kg BW) for 0 to 24 hours. Serum CoQ10 concentrations, cellular mir-378, and ABCG1 mrna expression levels in isolated MPMs were quantified (n=6). The results of serum CoQ10 levels are the mean±sem. The results for mir-378 contents and ABCG1 mrna levels are the mean±sem of fold of the control (untreated mice served as controls), which was set to 1. B, D, E, and G, Representative images of 3 independent assays. A, The data are the mean±sem (n=12). *P<0.05 vs control, Student t test. C, F, and H, The data are the mean±sem (n=3). *P<0.05 vs control, #P<0.05, Student t test. I, The data are the mean±sem (n=12). #P<0.05, Student t test. AP-1/miR-378/ABCG1 pathway in apoe / mice, thus contributing to the inhibition of established atherosclerosis progression. Because the atheroprotective or proatherosclerotic role of ABCG1 in atherosclerosis was observed in animal studies, 17,18 it is hard to tell whether the atheroprotective effect of CoQ10 in humans is partially explained by its capacity for accelerating ABCG1-mediated macrophage cholesterol efflux. Nevertheless, these observations suggest that CoQ10 is a promising candidate for atherosclerotic therapy in humans. The concept that the enhancement of macrophage RCT could prevent the progression or even induce regression of atherosclerosis is attractive. Among several potential therapeutic approaches, LXR agonism is most conceptually attractive because it increases both ABCA1 and ABCG1 expression, promotes macrophage cholesterol efflux in vitro 19 and macrophage RCT in vivo, 20 and thus induces the regression of atherosclerosis in mice. 16 However, LXR agonists contribute to hepatic steatosis, as well as elevated plasma triglyceride in animal models. 2 In this regard, it is still difficult to generalize this approach to humans. The current study demonstrated that CoQ10 could significantly promote macrophage RCT and inhibit the progression of established atherosclerosis without adverse effects. Moreover, CoQ10 decreased plasma VLDL cholesterol levels in mice. Although increased plasma VLDL cholesterol is positively related with atherosclerosis development, whether reduction of plasma VLDL cholesterol enables to inhibit the progression of the formed atherosclerotic plaque remained unclear. 21 Consistent with other studies, 16 we evidenced that the LXR agonist T promotes RCT leading to atherosclerosis regression accompanied with hypertriglyceridemia. Reduction of VLDL cholesterol in mice treated with CoQ10 might partially contribute to the inhibition of atherosclerosis. However, the promotion of macrophage RCT might be a significant factor responsible for the inhibitory effect on the formed atherosclerosis progression. Because CoQ10 is highly safe for use as a dietary supplement, 22 it is reasonable to expand the clinical usage of CoQ10 for patients with atherosclerotic lesions in addition to those with heart failure. 9 We found that CoQ10 induces ABCG1 expression in an LXRα-independent manner. Instead, CoQ10 regulates the cholesterol efflux from murine- and human-derived macrophages by downregulating mir-378, which directly targets the 3 -UTRs of ABCG1 mrna. Numerous studies have shown that mirna expression is tightly spatial and temporal. 4 In that context, it is necessary to explore whether mir-378 has a physiological role in atherosclerotic development. We found that mir-378 levels are elevated in aortas during the progression of atherosclerosis in apoe / mice. This finding indicated that mir-378 plays a role in atherosclerosis development. Consistent with this speculation, CoQ10 inhibited the progression of atherosclerosis concomitantly with reduced aortic mir-378 levels.

9 1868 Arterioscler Thromb Vasc Biol September 2014 Downloaded from by guest on April 7, 2018 Figure 7. Coenzyme Q10 (CoQ10) inhibits endogenous foam cell formation and the progression of atherosclerosis in vivo. Male 30-week-old apolipoprotein E deficient (apoe / ) mice were euthanized (baseline) or subjected to oral gavage of CoQ10 (600 mg/kg BW), T (10 mg/kg BW), or the vehicle (normal saline; control) once daily for 4 weeks. Four days before euthanasia, mice (n=12 per group) were intraperitoneally injected with thioglycollate to obtain mouse peritoneal macrophages (MPMs) for Oil Red O staining (A), analyses of total lipid content (B), and total cholesterol content (C). D and E, Representative Oil Red O staining of aortic sinus lesion (D) and quantification of the aortic sinus lesion area (E). F, Total cholesterol content in the thoracic and abdominal aorta. G, Western blotting analyses of ATP-binding cassette transporter G1 (ABCG1) protein expression in aortas and MPMs isolated from baseline, the vehicle-, CoQ10-, or T treated apoe / mice. The aortas and MPMs were pooled with 4 mice in each group, respectively. H, A unified paradigm depicting the role of CoQ10 in promoting macrophage cholesterol efflux in vitro and in vivo. A and G, Representative images of 3 independent assays. D, Representative images of 12 independent experiments. B, C, and F, The data are the mean±sem (n=3). E, The data are the mean±sem (n=12). *P<0.05 vs control, #P<0.05 vs baseline, 1-way ANOVA coupled with the Bonferroni Dunn post hoc test. NS indicates not significant. Moreover, using a time-course experiment assay in mice, we found sequential changes: first, CoQ10 appeared in the serum, then the macrophage mir-378 level decreased; last, ABCG1 expression increased. These phenomena imply that mir-378 might be a novel candidate for promoting macrophage cholesterol efflux and inhibiting atherosclerosis development in vivo. Recent studies have suggested that a single mirna may target >100 mrnas, whereas a single mrna could be regulated by different mirnas. 4 This may be the case of ABCG1, which has >100 potential mirna candidates located in its 3 -UTR (3.7 kb for mouse and 0.9 kb for human) according to mirna target prediction databases. 4 To date, several mirnas, including mir-33 and mir-10b, have been experimentally shown to regulate ABCG1 expression. 7,23 Accordingly, we showed that CoQ10 selectively inhibits mir-378 via downregulation of ABCG1 expression in macrophages. Given a recent study showing that mir-33 and mir-144 cooperatively mediate ABCA1 activity by binding to their respective locations in the ABCA1 3 -UTR, 24 it is possible that other mirnas are required for CoQ10-induced ABCG1 expression. We found that CoQ10 could remarkably upregulate and downregulate the expression of 40 different mirnas by 2-fold. Further studies are needed to discriminate the role of mir-378 from the other mirnas in CoQ10-induced ABCG1 expression and macrophage cholesterol efflux. Although functional studies indicate that mirnas participate in the regulation of cholesterol efflux and the development of atherosclerosis, there is still little known about the molecular mechanisms for mirna expression. Understanding mirna transcription is important for developing new antiatherosclerotic drugs that modulate mirna expression. It has been proposed that 90% of reported TF-binding sites are embedded within 800-bp regions upstream of the transcription start site for pri-mirnas. 25 In the current study, we examined a region 2 kb upstream of the transcription start site of pri-mir-378 in silico 14 and showed that 5 TFs are predicted to bind to the putative promoters of mouse and human pri-mir-378. Subsequently, chromatin immunoprecipitation

10 Wang et al CoQ10 Promotes Macrophage Cholesterol Efflux 1869 Downloaded from by guest on April 7, 2018 and luciferase reporter assays showed that only c-jun, a component of AP-1, is involved in CoQ10-induced regulation of mir-378. Our findings thus provide a third TF regulating mir-378 expression in addition to peroxisome proliferator activated receptor γ and myogenic differentiation 1. 26,27 However, it should be noted that mirna expression usually reflects an integrated consequence of interrelated signals on mirna transcription, 25 thus raising the possibility that other TFs may also be involved in CoQ10-mediated transcriptional modulation of the mir-378 gene. How CoQ10 inhibits c-jun expression in OxLDL-loaded macrophages is still unclear. Previous studies have shown that c-jun belongs to an immediate-early gene and could be rapidly induced at the transcriptional level. 15,28 Specifically, c-jun/activating TF 2 (ATF-2) heterodimers are the major positive transcriptional complex for c-jun transcription. 29 c-jun N-terminal kinase and p38 (2 subfamilies of mitogen-activated protein kinase families) are known to phosphorylate c-jun and ATF-2, which enhances the transcriptional activity of these heterodimers, thereby promoting c-jun transcription. 30 However, it seems to be unlikely that CoQ10 reduces c-jun expression by this manner. For example, JNK and p38 have been shown to participate in OxLDL-induced macrophage-derived foam cell formation by increasing OxLDL uptake and increasing CD36 expression, respectively. 31,32 In contrast, our current findings revealed that CoQ10 cannot alter OxLDL uptake or increasing CD36 expression in either mouse- or human-derived macrophages. Recently, Lau et al 33 reported that the transcriptional activity of ATF-2 can be mediated by protein kinase C-ε (PKC-ε), 1 novel isozymes of PKC. Activation of PKC-ε phosphorylates ATF-2 and increases its transcriptional activity, whereas inhibition of PKC-ε attenuates its transcriptional activity through enabling ATF-2 nuclear export and localization at the mitochondria. Those novel findings suggest that alerting PKC-ε activity and the structure and function of mitochondria might mediate the transcriptional activity of ATF-2. Because CoQ10 is a known factor in maintaining mitochondrion function, 9 it is possible that CoQ10 inhibits c-jun expression through attenuating the transcriptional activity of ATF-2 by altering mitochondrion function. Tsai et al 34 demonstrated that CoQ10 could inhibit PKC-α/β, 2 other isozymes of PKC, in OxLDL-loaded human umbilical vein endothelial cells via regulating AMP-activated protein kinase activity. Therefore, it is also possible that PKC-ε inhibition might be responsible for CoQ10-induced effect on c-jun expression in OxLDL-loaded macrophages. Nevertheless, further investigations are needed to explore the precise mechanisms for the inhibitory effect of CoQ10 on c-jun expression. Atherosclerosis is characterized by excessive cholesterol accumulation in the arterial wall with a strong inflammatory component. 35 Consequently, strategies aimed at both modulating cholesterol removal and inflammation have been brought forward as reasonable targets in limiting the development of atherosclerosis. 35 In addition to the anti-inflammatory property of CoQ10, our present study showed that CoQ10 initially alters AP-1, a known TF-inducing inflammation response, 36 and then regulates macrophage cholesterol efflux by reducing mir-378 expression. Likewise, McGillicuddy et al 37 reported that inflammation could impair macrophage RCT. These data indicate that AP-1 might be a potential molecule that mediates the interaction of inflammation response and macrophage cholesterol efflux. Because the integrated rate of macrophage RCT is mediated by several factors, the increased ABCG1 expression in macrophages may not be wholly responsible for CoQ10-induced effect. Other factors in blood, liver, intestine, and even lymphatic vasculature also might be involved. 1,38 CoQ10 treatment increased the levels of plasma HDL-C. However, plasma HDL-C levels may not always faithfully reflect the rate of macrophage RCT. 1 Moreover, apoe / mice have little HDL-C to begin with, and the subtle changes to HDL-C levels are thus likely not meaningful evidence of increased macrophage RCT. 7 Notably, CoQ10 treatment increased plasma apoa-i levels. If the effect of CoQ10 on plasma apoa-i levels results from the increment in its biosynthesis and secretion from the liver and small intestine, it would be expected that apoa-i is another factor facilitating CoQ10-induced effect on macrophage RCT. 39 Nevertheless, the precise mechanisms for the stimulatory effect of CoQ10 on macrophage RCT require further investigations. In conclusion, we propose the following model for CoQ10-induced promotion of macrophage RCT in vivo (Figure 7H): CoQ10 inhibits AP-1 and further reduces mir-378 expression, which increases the expression of ABCG1 in mouse and human macrophages and thus facilitates macrophage cholesterol efflux in vitro and in vivo. This contributes to reduced progression of atherosclerosis in mice. Because other studies suggested that mir-378 is implicated in lipid metabolism and angiogenesis, 40,41 our findings thus suggest that CoQ10 and mir-378 are promising candidates for atherosclerosis prevention and treatment. Acknowledgments mirna microarray experiments were performed by KangChen Biotech, Shanghai, China. Sources of Funding This work was supported by grants from the National Natural Science Foundation of China ( and ), Natural Science Foundation of Guangdong Province (S ), Research Fund for the Doctoral Program of Higher Education of China ( ), and the Nutrition Research Foundation of By-Health (TY ). None. Disclosures References 1. Rosenson RS, Brewer HB Jr, Davidson WS, Fayad ZA, Fuster V, Goldstein J, Hellerstein M, Jiang XC, Phillips MC, Rader DJ, Remaley AT, Rothblat GH, Tall AR, Yvan-Charvet L. Cholesterol efflux and atheroprotection: advancing the concept of reverse cholesterol transport. Circulation. 2012;125: Beaven SW, Tontonoz P. Nuclear receptors in lipid metabolism: targeting the heart of dyslipidemia. Annu Rev Med. 2006;57: Moore KJ, Rayner KJ, Suárez Y, Fernández-Hernando C. micrornas and cholesterol metabolism. Trends Endocrinol Metab. 2010;21: Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136: Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:

11 1870 Arterioscler Thromb Vasc Biol September 2014 Downloaded from by guest on April 7, Rayner KJ, Sheedy FJ, Esau CC, Hussain FN, Temel RE, Parathath S, van Gils JM, Rayner AJ, Chang AN, Suarez Y, Fernandez-Hernando C, Fisher EA, Moore KJ. Antagonism of mir-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis. J Clin Invest. 2011;121: Wang D, Xia M, Yan X, Li D, Wang L, Xu Y, Jin T, Ling W. Gut microbiota metabolism of anthocyanin promotes reverse cholesterol transport in mice via repressing mirna-10b. Circ Res. 2012;111: Bentinger M, Brismar K, Dallner G. The antioxidant role of coenzyme Q. Mitochondrion. 2007;7(Suppl):S41 S Littarru GP, Tiano L. Clinical aspects of coenzyme Q10: an update. Curr Opin Clin Nutr Metab Care. 2005;8: Lee BJ, Huang YC, Chen SJ, Lin PT. Coenzyme Q10 supplementation reduces oxidative stress and increases antioxidant enzyme activity in patients with coronary artery disease. Nutrition. 2012;28: Lee BJ, Huang YC, Chen SJ, Lin PT. Effects of coenzyme Q10 supplementation on inflammatory markers (high-sensitivity C-reactive protein, interleukin-6, and homocysteine) in patients with coronary artery disease. Nutrition. 2012;28: Schmelzer C, Kitano M, Rimbach G, Niklowitz P, Menke T, Hosoe K, Döring F. Effects of ubiquinol-10 on microrna-146a expression in vitro and in vivo. Mediators Inflamm. 2009;2009: Rothblat GH, Phillips MC. High-density lipoprotein heterogeneity and function in reverse cholesterol transport. Curr Opin Lipidol. 2010;21: Alexiou P, Vergoulis T, Gleditzsch M, Prekas G, Dalamagas T, Megraw M, Grosse I, Sellis T, Hatzigeorgiou AG. mirgen 2.0: a database of microrna genomic information and regulation. Nucleic Acids Res. 2010;38(Database issue):d137 D Shaulian E, Karin M. AP-1 as a regulator of cell life and death. Nat Cell Biol. 2002;4:E131 E Verschuren L, de Vries-van der Weij J, Zadelaar S, Kleemann R, Kooistra T. LXR agonist suppresses atherosclerotic lesion growth and promotes lesion regression in apoe*3leiden mice: time course and mechanisms. J Lipid Res. 2009;50: Tarling EJ. Expanding roles of ABCG1 and sterol transport. Curr Opin Lipidol. 2013;24: Meurs I, Lammers B, Zhao Y, Out R, Hildebrand RB, Hoekstra M, Van Berkel TJ, Van Eck M. The effect of ABCG1 deficiency on atherosclerotic lesion development in LDL receptor knockout mice depends on the stage of atherogenesis. Atherosclerosis. 2012;221: Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, Tontonoz P. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl Acad Sci U S A. 2000;97: Naik SU, Wang X, Da Silva JS, Jaye M, Macphee CH, Reilly MP, Billheimer JT, Rothblat GH, Rader DJ. Pharmacological activation of liver X receptors promotes reverse cholesterol transport in vivo. Circulation. 2006;113: Nicholls SJ, Tuzcu EM, Brennan DM, Tardif JC, Nissen SE. Cholesteryl ester transfer protein inhibition, high-density lipoprotein raising, and progression of coronary atherosclerosis: insights from ILLUSTRATE (Investigation of Lipid Level Management Using Coronary Ultrasound to Assess Reduction of Atherosclerosis by CETP Inhibition and HDL Elevation). Circulation. 2008;118: Hidaka T, Fujii K, Funahashi I, Fukutomi N, Hosoe K. Safety assessment of coenzyme Q10 (CoQ10). Biofactors. 2008;32: Rayner KJ, Suárez Y, Dávalos A, Parathath S, Fitzgerald ML, Tamehiro N, Fisher EA, Moore KJ, Fernández-Hernando C. MiR-33 contributes to the regulation of cholesterol homeostasis. Science. 2010;328: Ramírez CM, Rotllan N, Vlassov AV, et al. Control of cholesterol metabolism and plasma high-density lipoprotein levels by microrna-144. Circ Res. 2013;112: Megraw M, Baev V, Rusinov V, Jensen ST, Kalantidis K, Hatzigeorgiou AG. MicroRNA promoter element discovery in Arabidopsis. RNA. 2006;12: John E, Wienecke-Baldacchino A, Liivrand M, Heinäniemi M, Carlberg C, Sinkkonen L. Dataset integration identifies transcriptional regulation of microrna genes by PPARγ in differentiating mouse 3T3-L1 adipocytes. Nucleic Acids Res. 2012;40: Gagan J, Dey BK, Layer R, Yan Z, Dutta A. MicroRNA-378 targets the myogenic repressor MyoR during myoblast differentiation. J Biol Chem. 2011;286: Angel P, Hattori K, Smeal T, Karin M. The jun proto-oncogene is positively autoregulated by its product, Jun/AP-1. Cell. 1988;55: Hai T, Curran T. Cross-family dimerization of transcription factors Fos/ Jun and ATF/CREB alters DNA binding specificity. Proc Natl Acad Sci U S A. 1991;88: Whitmarsh AJ, Davis RJ. Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways. J Mol Med (Berl). 1996;74: Zhao M, Liu Y, Wang X, New L, Han J, Brunk UT. Activation of the p38 MAP kinase pathway is required for foam cell formation from macrophages exposed to oxidized LDL. APMIS. 2002;110: Rahaman SO, Lennon DJ, Febbraio M, Podrez EA, Hazen SL, Silverstein RL. A CD36-dependent signaling cascade is necessary for macrophage foam cell formation. Cell Metab. 2006;4: Lau E, Kluger H, Varsano T, Lee K, Scheffler I, Rimm DL, Ideker T, Ronai ZA. PKCε promotes oncogenic functions of ATF2 in the nucleus while blocking its apoptotic function at mitochondria. Cell. 2012;148: Tsai KL, Chen LH, Chiou SH, Chiou GY, Chen YC, Chou HY, Chen LK, Chen HY, Chiu TH, Tsai CS, Ou HC, Kao CL. Coenzyme Q10 suppresses oxldl-induced endothelial oxidative injuries by the modulation of LOX-1-mediated ROS generation via the AMPK/PKC/ NADPH oxidase signaling pathway. Mol Nutr Food Res. 2011;55(Suppl 2):S227 S Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 2005;352: Schonthaler HB, Guinea-Viniegra J, Wagner EF. Targeting inflammation by modulating the Jun/AP-1 pathway. Ann Rheum Dis. 2011;70(Suppl 1):i109 i McGillicuddy FC, de la Llera Moya M, Hinkle CC, Joshi MR, Chiquoine EH, Billheimer JT, Rothblat GH, Reilly MP. Inflammation impairs reverse cholesterol transport in vivo. Circulation. 2009;119: Martel C, Li W, Fulp B, Platt AM, Gautier EL, Westerterp M, Bittman R, Tall AR, Chen SH, Thomas MJ, Kreisel D, Swartz MA, Sorci-Thomas MG, Randolph GJ. Lymphatic vasculature mediates macrophage reverse cholesterol transport in mice. J Clin Invest. 2013;123: Zhang Y, Zanotti I, Reilly MP, Glick JM, Rothblat GH, Rader DJ. Overexpression of apolipoprotein A-I promotes reverse transport of cholesterol from macrophages to feces in vivo. Circulation. 2003;108: Gerin I, Bommer GT, McCoin CS, Sousa KM, Krishnan V, MacDougald OA. Roles for mirna-378/378* in adipocyte gene expression and lipogenesis. Am J Physiol Endocrinol Metab. 2010;299:E198 E Lee DY, Deng Z, Wang CH, Yang BB. MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. Proc Natl Acad Sci U S A. 2007;104: Significance Coenzyme Q10 is often prescribed for patients with heart failure. Although antioxidative, anti-inflammatory, and cellular bioenergetic functions of coenzyme Q10 contribute to its beneficial effect, it remains unclear whether other mechanisms are involved. In the present study, we demonstrated that coenzyme Q10 greatly inhibits established atherosclerosis progression and enhances macrophage reverse cholesterol transport, a critical pathway in combating atherosclerosis, through a previously undescribed activator protein-1/microrna-378/atp-binding cassette transporter G1 signaling pathway in apolipoprotein E deficient mice. Our novel data support the notion that coenzyme Q10 could be implicated in protection of atherosclerotic cardiovascular diseases not limited to heart failure. Furthermore, microrna-378 seems to be a promising candidate for the therapy of atherosclerosis.

12 Downloaded from by guest on April 7, 2018 Coenzyme Q10 Promotes Macrophage Cholesterol Efflux by Regulation of the Activator Protein-1/miR-378/ATP-Binding Cassette Transporter G1 Signaling Pathway Dongliang Wang, Xiao Yan, Min Xia, Yan Yang, Dan Li, Xinrui Li, Fenglin Song and Wenhua Ling Arterioscler Thromb Vasc Biol. 2014;34: ; originally published online March 27, 2014; doi: /ATVBAHA Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX Copyright 2014 American Heart Association, Inc. All rights reserved. Print ISSN: Online ISSN: The online version of this article, along with updated information and services, is located on the World Wide Web at: Data Supplement (unedited) at: Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online at:

13 Supplemental Material Supplemental Table I. Sequences of primers for real-time quantitative PCR Gene Species Forward primer (5' to 3') Reverse primer (5' to 3') ABCA1 mouse GGACTTGCCTTGTTCCGAGAG GCTGCCACATAACTGATAGCGA ABCA1 human ACCCACCCTATGAACAACATGA GAGTCGGGTAACGGAAACAGG ABCG1 mouse CTCCATCGTCTGTACCATCC CTCCATCGTCTGTACCATCC ABCG1 human ATTCAGGGACCTTTCCTATTCGG CTCACCACTATTGAACTTCCCG SR-BI mouse GGCTGCTGTTTGCTGCG GCTGCTTGATGAGGGAGGG SR-BI human ACTTCTGGCATTCCGATCAGT ACGAAGCGATAGGTGGGGAT SR-A mouse ATGACAGAGAATCAGAGG CCCTCTGTCTCCCTTTTC SR-A human CCAGGGACATGGAATGCAA CCAGTGGGACCTCGATCTCC CD-36 mouse CAGCCCAATGGAGCCATC CAGCGTAGATAGACCTGC CD-36 human GAGAACTGTTATGGGGCTAT TTCAACTGGAGAGGCAAAGG SREBP1 mouse ACTTCCCTGGCCTATTTGACC GGCATGGACGGGTACATCTT SREBP1 human CAAGGCCATCGACTACATT TTGCTTTTGTGGACAGCAGT SREBP2 mouse GTGGAGCAGTCTCAACGTCA TGGTAGGTCTCACCCAGGAG SREBP2 human AGGAGAACATGGTGCTGA TAAAGGAGAGGCACAGGA HMGCR mouse CTTGTGGAATGCCTTGTGATTG AGCCGAAGCAGCACATGAT HMGCR human GTCATTCCAGCCAAGGTTGT GGGACCACTTGCTTCCATTA LDLR mouse GGTACTGGCACAACAACTTGGG GCCAATCGACTCACGGGTTCAG LDLR human CAGATATCATCAACGAAGC CCTCTCACACCAGTTCACTCC LXRα mouse GAGCCGACAGAGCTTCGTC GCGTGCTCCCTTGATGACA LXRα human ACACCTACATGCGTCGCAAG GACGAGCTTCTCGATCATGCC c-jun mouse AGCCTACCAACGTGAGTGCT AGAACGGTCCGTCACTTCAC c-jun human TGACTGCAAAGATGGAAACG CAGGGTCATGCTCTGTTTCA c-fos mouse GCCCAGTGAGGAATATCTGGA ATCGCAGATGAAG CTCTGGT c-fos human GAGAGCTGGTAGTTAGTAGCATGTT GA AATTCCAATAATGAACCCAATAGAT TAGTTA mouse GCAGGCTTAAGAAGTGCTTC GGCTGCTGTCCTCGTAGCTT human TGTCCCGACAGATCACCTC CACTCAACGAGAACCAGCAG ELK-1 mouse TGCTCCCCACACATACCTTGA ACTGGACGGAAACTGGAAGGA ELK-1 human TTGGAGGCCTGTCTGGAGGCTGAA AGCTCTTCCGATTTCAGGTTTGGG NKX2-5 mouse GACAGGTACCGCTGTTGCTT AGCCTACGGTGACCCTGAC NKX2-5 human AAGAGCTGTGCGCGCTGCAGAA ATCTTGACCTGCGTGGACGTG c-rel mouse CTGGAGCCTGTGACAGTGAA GAGTGTTCCCGCTGAGAAAG c-rel human GGAAAAGACTGCAGAGACGG ATTGGGTTCGAGACAACAGG GAPDH mouse GGCAGCTTCGGCACATATTTC CCAGGGTTATAGTCCTTCTCGT GAPDH human CTCACCGGATGCACCAATGTT CGCGTTGCTCACAATGTTCAT 1

14 Supplemental Table II. Potential promoter binding of TFs in the transactivation of mir-378 genes in J774 and THP-1 macrophages Mature mirnas Chromosome (strand) TFs Transfac id TF motif and distance from TSS mmu-mir (-) AP-1 V$AP1_Q2 tgtgagtcacc (-37) HNF-4 V$HNF4_01 ctaagagaaaagttcatag (-157) ELK-1 V$ELK1_01 aatacaggatgttcca (-1463) NKX2-5 V$NKX25_01 tcaagtg (-1018) c-rel V$CREL_01 GGAAAtccca (-203) hsa-mir (+) AP-1 V$AP1_Q4 aattagtcact (-531) aattagtcact (-579) HNF-4 V$HNF4_01 ctaagagaaaagttcatag (-160) ctaagagaaaagttcatag (-181) ctaagagaaaagttcatag (-229) ctaagagaaaagttcatag (-360) ELK-1 V$ELK1_02 cagaccggaaatac (-122) NKX2-5 V$NKX25_02 caattaag (-670) V$NKX25_01 tcaagtg (-751) tcaagtg (-897) c-rel V$CREL_01 GGAAAtccca (-95) 2

15 Supplemental Table III. Plasma lipid profile and ApoA-I levels in ApoE / mice from different groups Groups n TC (mg/dl) TG (mg/dl) HDL-C (mg/dl) ApoA-I (mg/dl) Control ± ± ± ± 1.2 CoQ ± 34 * 87 ± 3.3 * 36.3 ± 3.5 * 16.4 ± 0.9 * T ± ± 7.4 * 29.4 ± ± 1.4 The data were the means ± SEM from the indicated numbers of male ApoE / mice in each group. * The means in the same column as an asterisk differ from the control group, P <

16 Supplemental Figure I. CoQ10 reduces OxLDL-induced lipid accumulation in macrophages. A, Mouse J774.A1 macrophages were treated with the vehicle (DMSO), OxLDL (50 g/ml), CoQ10 (10 M), or a combination of CoQ10 and OxLDL for 24 hours. Cells were then fixed with paraformaldehyde and stained with filipin. The figure is representative of 4 independent experiments (magnification 400, upper panel). The density of lipid content was evaluated by alcohol extraction after staining, and fluorescent signals were quantified (lower panel). B, J774.A1 macrophages were treated with CoQ10 or DMSO in the presence or absence of OxLDL for 24 hours. Cells were then incubated with DiI-OxLDL for another 4 hours. Representative images under fluorescence microscopy are shown (magnification 400, upper panel). DiI was extracted by isopropanol, and the fluorescence was determined at 520/564 nm (lower panel). C, Western blotting (upper panel) and qrt-pcr (lower panel) analyses of SR-A and CD36 protein and mrna expression in J774.A1 macrophages treated with DMSO, CoQ10, OxLDL, or a combination of CoQ10 and OxLDL for 24 hours. D and E, qrt-pcr analyses of ACAT1 and HSL (D), SREBP1, SREBP2, HMGCR, and LDLR (E) in J774.A1 macrophages treated with CoQ10 or DMSO in the presence of OxLDL for 24 hours. The upper panels of C are representative images of 3 independent assays. Lower panels of A to C, as well as D and E, The results are the mean ± SEM. n = 3. * P < 0.05 vs. [CoQ10 (-) and OxLDL (+)], one-way ANOVA coupled with the Bonferroni-Dunn post hoc test. 4

17 Supplemental Figure II. Quantification of protein expression in vitro and in vivo. A and B, Quantification of ABCA1, ABCG1, and SR-BI protein (relative to -actin) in OxLDL-loaded J774.A1 (A) and THP-1 macrophages (B) treated with CoQ10 (1, 10, 100 M) or the vehicle (DMSO) for 24 hours. Data correspond to Western blotting in Figure 2B and 2D. C, Quantification of ABCG1 protein in OxLDL-loaded J774.A1 and THP-1 macrophages transfected with scrambled or ABCG1 sirna with or without CoQ10 (10 M). Data correspond to Western blotting in the inset of Figure 2E and 2F. D, Quantification of mouse and human ABCG1 protein in OxLDL-loaded J774.A1 and THP-1 macrophages transfected with Con mir (150 nm) or the indicated concentrations of mir-378 for 48 hours. Data correspond to Western blotting in Figure 3B and 3D. E, Quantification of ABCG1 protein in OxLDL-loaded J774.A1 and THP-1 macrophages transfected with Con mir (150 nm) or mir-378 (150 nm) in the presence or absence of a control inhibitor (Con Inh,150 nm) or anti-mir-378 (150 nm). Data correspond to Western blotting in Figure 3F and 3H. F, OxLDL-loaded J774.A1 and THP-1 macrophages were transfected with either a control mir (Con mir, 150 nm) or mir-378 (40 or 150 nm), or a control inhibitor (Con Inh, 150 nm) or anti-mir-378 (150 nm) for 24 hours. Cells were then treated with CoQ10 (10 M) or the vehicle (DMSO) for another 24 hour. The ABCG1 protein expression was then quantified. Data correspond to Western blotting in Figure 4A. G and H, Quantification of ABCG1 protein in OxLDL-loaded J774.A1 (G) and THP-1 macrophages (H) treated with CoQ10 or the vehicle (DMSO) for 24 hours. Data correspond to Western blotting in left panels of Figure 5A and B. I, Quantification of ABCG1 protein in OxLDL-loaded J774.A1 and THP-1 macrophages transfected with scrambled or c-jun sirna in the presence or absence of Con mir (150 nm) or mir-378 (150 nm) for 48 hours. Data correspond to Western blotting in left panels of Figure 5C and D. J and K, 5

18 Thirty-week-old male ApoE / mice were orally gavaged with CoQ10 (600 mg/kg BW) or the vehicle (normal saline) once daily for 14 days. The protein expressions of c-jun, c-fos, ABCA1, ABCG1, and SR-BI in aortas and thioglycollate-elicited MPMs isolated from CoQ10- or the vehicle-treated ApoE / mice were then quantified. The aortas and MPMs were pooled with 4 mice in each group. Data correspond to Western blotting in Figure 6B, D, E, and G. L and M, Male 30-week-old ApoE / mice were sacrificed (Baseline) or subjected to oral gavage of CoQ10 (600 mg/kg BW), T (10 mg/kg BW), or the vehicle (normal saline) (Control) once daily for 4 weeks. The ABCG1 protein expressions in aortas and MPMs isolated from Baseline, the vehicle-, CoQ10-, or T treated ApoE / mice were then quantified. The aortas and MPMs were pooled with 4 mice in each group, respectively. Data correspond to Western blotting in Figure 7G. F, The data are the mean ± SEM. n = 6. * P < 0.05 vs. CoQ10, Student s t test. NS indicates not significant. For the other panels, data are the mean ± SEM. n = 3. A, B, G, and H, * P < 0.05 vs. Control, one-way ANOVA coupled with the Bonferroni-Dunn post hoc test. C, * P < 0.05 vs. Ctr si, Student s t test. D and E, * P < 0.05 vs. Con mir or Con mir and Con Inh, one-way ANOVA coupled with the Bonferroni-Dunn post hoc test. I, * P < 0.05 vs. Ctr si, # P < 0.05 vs. (Con mir + c-jun si), Student s t test. J and K, * P < 0.05 vs. Control, Student s t test. L and M, * P < 0.05 vs. Control, one-way ANOVA coupled with Bonferroni-Dunn post hoc test. 6

19 Supplemental Figure III. CoQ10 does not transcriptionally induce ABCG1 in macrophages. A and B, OxLDL-loaded J774.A1 (A) and THP-1 macrophages (B) were cotransfected with human ABCG1 promoter and Renilla (for internal normalization) followed by the vehicle (DMSO), CoQ10 (1, 10, 100 M) or T (1 M) treatment for 24 hours. Cellular lysate was then used to determine the activity of firefly and Renilla luciferases. C to F, qrt-pcr and Western blot analyses of LXR mrna (C and D) and protein (E and F) levels in nuclear extract in OxLDL-loaded 7

20 J774.A1 and THP-1 macrophages treated with CoQ10 or DMSO for 24 hours. G and H, OxLDL-loaded J774.A1 (G) and THP-1 macrophages (H) were transfected with a luciferase reporter plasmid containing the liver X receptor element upstream of the thymidine kinase promoter (LXRE-tk-Luc) (kindly provided by David J. Mangelsdorf, University of Texas Southwestern Medical Center) in the presence of -galactosidase ( -gal) as a reference plasmid. Twelve hours after transfection, cells were treated with CoQ10 or DMSO for 24 h. Luciferase and -gal activities were then determined in the cell lysates. E and F, Representative images of 3 independent assays. For the other panels, results are the mean ± SEM. n = 3 to 6. The data were analyzed by one-way ANOVA and the Bonferroni-Dunn post hoc test. 8

21 Supplemental Figure IV. CoQ10 decreases mir-378 expression in macrophages. A, Heat map of 40 mirnas differentially expressed in OxLDL-loaded J774.A1 macrophages treated with CoQ10 (10 M) or the vehicle (DMSO) for 24 hours. Scale of relative intensity (log 2 ) is shown, upper heat map. Green indicates expression levels below control macrophages and red indicates expression levels greater than control macrophages. B to D, qrt-pcr analysis of mirnas differentially expressed in OxLDL-loaded MPMs (B), J774.A1 (C), and THP-1 (D) macrophages treated with CoQ10 or DMSO for 24 hours. The data are the mean ± SEM. n = 3 to 6. * P < 0.05 vs. Control, Student s t test. 9