Materials and Methods Cell culture Foam cell formation Cellular uptake of DiI-OxLDL In vitro cholesterol efflux assays

Size: px
Start display at page:

Download "Materials and Methods Cell culture Foam cell formation Cellular uptake of DiI-OxLDL In vitro cholesterol efflux assays"

Transcription

1 Materials and Methods Cell culture Mouse peritoneal macrophages (MPMs) were harvested from adult C57BL/6J mice (Jackson Laboratories, Sacramento, CA) and cultured as previously described. 1 J774.A1, THP-1, and HEK293 cells (American Type Culture Collection, Manassas, VA) were maintained according to the manufacturer s instructions. The differentiation of THP-1 monocytes into macrophages was induced by 167 nmol/l phorbol 12-myristate 13-acetate (Wako, Tokyo, Japan) for 48 hours. 2 Foam cell formation Foam cell formation was assessed by the methods of Oil-red-O and filipin staining which had been established in our laboratory previously. 3 Macrophages were incubated with the vehicle (DMSO), oxidized low-density lipoprotein (OxLDL) (50 g/ml), CoQ10 (Sigma-Aldrich, St Louis, MO) (1, 10, 100 M), or a combination of CoQ10 and OxLDL in RPMI 1640 medium supplemented with 10% FBS for 24 hours. After fixation by 4% paraformaldehyde, cells were stained with 0.5% Oil-red-O and hematoxylin was used as counterstaining. Density of the total cellular lipid content was determined by a microplate reader (absorbance at 540 nm) after alcohol extraction. 4 The total lipid in cells was extracted with hexane/isopropanol (3/2, vol/vol). The lipid extracts were dried under nitrogen flush, and dissolved in a solution with 90% isopropanol and 10% Triton X-100. Total cholesterol content was quantified enzymatically. For filipin staining, macrophages were treated with CoQ10 or DMSO in the presence or absence of OxLDL in RPMI 1640 medium supplemented with 1% Nutridoma for 24 hours. The cells were washed with ice-cold PBS and fixed with paraformaldehyde for 30 min at 4 C, and then maintained in PBS containing 50 µg/ml filipin for 30 min at room temperature. Fluorescent microscopy was explored to visualize cells. 5 Cellular uptake of DiI-OxLDL Macrophages pretreated with CoQ10 (1, 10, 100 M) for 24 hours were incubated with 1,1 -Dioctadecyl-3,3,3 3 -tetramethylindocarbocyanine perchlorate (DiI)-labeled human OxLDL (Intracel Corp, Rockville, Md) in RPMI 1640 medium at 37 C for 4 hours. The cells were then visualized by a fluorescence microscope (Nikon ECLIPSE TI-E). DiI was extracted by isopropanol and the fluorescence was determined at 520/564 nm. 6 In vitro cholesterol efflux assays Assays of in vitro cellular cholesterol efflux have been previously described. 7 Macrophages were labeled with 1.0 Ci/mL 3 H-cholesterol (PerkinElmer, Boston, MA) in RPMI 1640 medium supplemented with or without OxLDL (50 g/ml) for 24 hours. The cells were maintained in media supplemented with 0.1% bovine serum albumin (BSA) in the presence or absence of CoQ10 at the indicated concentrations for 24 hours. Cholesterol efflux was then initiated by medium containing 0.1% BSA in the presence or absence of apolipoprotein A-I (ApoA-I) (15 g/ml) or HDL (100 g/ml) 1

2 for 24 hours. Supernatants were collected after 24 hours and calculated as a percentage of total cell 3 H-cholesterol content (total effluxed 3 H-cholesterol + cell-derived 3 H-cholesterol). Quantitative real-time RT-PCR Total RNA isolation and mrna levels for specific genes in macrophages were performed using a Quantitative real-time polymerase chain reaction (qrt-pcr) assay. Primers sequences used were shown in Table I in the online-only Data Supplement. GAPDH mrna was used as the internal control. Primers specific for mouse and human mir-378, mir-1899, mir-185*, and mir-351 (SABiosciences, San Diego, CA) were utilized and values were normalized to U6 as a house keeping gene. Western blotting Proteins from whole-cell lysates or nuclear extracts were separated by SDS-polyacrylamide gel electrophoresis. Method for Western blot has been previously described. 7 Antibodies against ABCG1 were purchased from Abcam, scavenger receptor class B type I (SR-BI) was from Novus, and -actin was from Cell Signaling Technology. Polyclonal antibodies against ABCA1, LXR, c-jun, c-fos, Elk-1, p-elk-1, c-rel, and histone H1 were form Santa Cruz Biotechnology. Small interfering RNA (sirna) J774.A1 and THP-1 macrophages were transfected with 100 nm ABCG1 or c-jun SMARTpool sirna or sicontrol non-targeting sirna (Dharmacon, Lafayette, CO) at 40-60% confluency. The efficiency of transfection was analyzed utilizing siglo RISC-free non-targeting sirna (Dharmacon). ABCG1 mrna stability assay For mrna stability analysis, macrophages were loaded with OxLDL (50 g/ml) for 24 hours following treatment with CoQ10 (10 M), or the vehicle (DMSO) for another 24 hours. At 0, 0.5, 1.0, 1.5, 2.0, 2.5, and 3.0 hours after the addition of actinomycin D (Sigma-Aldrich) (5 g/ml), 7 total RNA from the cells was harvested. ABCG1 mrna levels at indicated time points were quantitated by qrt-pcr and normalized to the GAPDH levels. The remaining mrna was determined by contrast with the expression level of the relevant gene at the zero time point (designated 100%) when actinomycin D was added. GraphPad Prism software version 5.0 was utilized to calculate the transcript half-lives based on a one-phase exponential decay model. mirna microarray analysis J774.A1 macrophages preloaded with OxLDL (50 g/ml) for 24 hours were incubated in medium containing 0.1% BSA and COQ10 (10 M) or the vehicle (DMSO) for another 24 hours. Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA) and mirneasy mini kit (Qiagen, Hilden, Germany). RNA quality and quantity was gauged by a nanodrop spectrophotometer (ND-1000, Nanodrop Technologies), and RNA integrity was determined using gel electrophoresis. The labeling, hybridization and 2

3 scanning of isolated RNA were performed by Exiqon (Denmark) using LNA mircury array (v.16.0). Scanned images were then imported into GenePix Pro 6.0 software (Axon) for grid alignment and data extraction. The mirna expression levels were modulated with a Fold Change Filtering (treated/control) of 2.0 or more were considered as differentially expressed. mir-378 and anti-mir-378 transfection J774.A1 and THP-1 macrophages loaded with or without OxLDL as well as HEK293 were transfected with miridian mirna mimics (mir-378) or with miridian mirna inhibitors (anti-mir-378) (Dharmacon) utilizing Oligofectamine (Invitrogen) for 48 hours. Transfections of all control samples were performed using a non-targeting negative control mimic sequence (Con mir) or an inhibitor negative control sequence (Con Inh) (Dharmacon) as controls for nonensequence-specific effects in mirna experiments. 3'-UTR vector constructions and luciferase reporter assay The entire 3'-UTRs of mabcg1 (3696 nt, NM_009593) and habcg1 (850 nt, NM_004915) were cloned into EcoRV and Xba1 sites of pgl3 cm generated on the basis of the pgl3-control vector (Promega, Madison, WI), creating the pgl3-m/habcg1-wt constructs. Point mutations in the seed regions of putative mir-378 sites within the 3'-UTRs of m/h ABCG1 were performed utilizing QuikChange Multi Site-Directed Mutagenesis (Stratagene) in accordance with the manufacturer s protocol. Sequencing was used to validate all the constructs. HEK293 cells were plated into 96-well plates and cotransfected with mir-378 or Con mir (Dharmacon), 50 ng of pgl3-wt or pgl3-mutation and 50 ng of prl-tk vector (Promega) using Oligofectamine. Luciferase activity was gauged by the Dual-Luciferase Reporter Assay System (Promega), and prl-tk was used as an internal control. To evaluate the impact of CoQ10, J774.A1 and THP-1 macrophages preloaded with OxLDL (50 g/ml) were cotransfected with pgl3-wt and prl-tk in the presence or absence of CoQ10 (10 M) for 24 hours. The luciferase activity was then measured as above. Chromatin immunoprecipitation (ChIP) The ChIP assay was performed using anti-c-jun antibody (Santa Cruz Biotechnology) and the Magna ChIP-G kit (Millipore) per manufacturer's instruction. Enrichment analysis was carried out using real-time PCR with specific primers. Luciferase reporter constructs and luciferase assay Promoters of mouse and human mir-378 genes were amplified by PCR. The PCR products were separated by agarose gel electrophoresis, and then the DNA fragments isolated and cloned in the restriction enzyme digested pgl3 Basic Vector (Promega) using T4 DNA ligase (Fisher scientific). All constructs were confirmed by sequencing. Mutations were introduced into the AP-1 binding sites using QuikChange site-directed mutagenesis kit (Stratagene). J774.A1 and THP-1 macrophages were transfected with each reporter construct for 24 hours and then treated with CoQ10 for 24 hours in 3

4 the presence or absence of 12-O-tetra-decanoylphorbol-13-acetate (TPA) followed by assessment of luciferase activity. Luciferase activities were measured and normalized to the control -gal level. The luciferase activity of each construct was compared with that of the promoterless pgl3 basic vector. Mouse studies All the experiments involving the use of animals were conducted in accordance with institutional guidelines of Sun Yat-sen University. 4-week old male ApoE / mice (Jackson Laboratories, Sacramento, CA) were weaned and placed on the AIN-93G diet for another 26 weeks, at which point the mice were sacrificed (baseline, n = 12) or subjected to the following experiments. Experiment 1 The ApoE / mice fed with the AIN-93G diet were orally gavaged with CoQ10 (600 mg/kg BW) for 14 days. Half of the mice (n = 12) in 2 groups were intraperitoneally injected with thioglycollate to obtain MPMs on day 10. The residual mice were raised individually in metabolic cages during the following 48 hours, and the efficiency of in vivo macrophage RCT was quantified (see below). Experiment 2 The ApoE / mice were orally gavaged with CoQ10 (600 mg/kg BW), T (10 mg/kg BW 8 ) (Sigma-Aldrich, St Louis, MO), or vehicle (normal saline) for 4 weeks. At sacrifice, mice were fasted overnight, anesthetized with isoflurane, and exsanguinated by cardiac puncture. MPMs, hearts, and thoracic as well as abdominal aortas were collected and stored at -80ºC for further experiments. In vivo macrophage RCT assay Macrophage RCT studies were performed as described previously. 9 In brief, the ApoE / mice were intraperitoneally injected with 3 H-cholesterol-labeled and OxLDL-loaded J774.A1 macrophages. Radioactivities of 3 H-tracer in blood, liver, and feces were then monitored and converted into RCT. Blood parameters measurement Serum total CoQ10 was quantified by high-performance liquid chromatography with electrochemical detection. 10 Plasma TG and total cholesterol (TC), and HDL-C were gauged by commercial kits (BioSino Biotechnology Company, Ltd., Beijing, China). Plasma ApoA-I were measured by immunoturbidimetry. Pooled plasma samples were subjected to fast protein liquid chromatography (FPLC). 7 Individual fractions were assayed for cholesterol content. Fractions contain VLDL and chylomicra; fractions contain IDL and LDL; fractions contain HDL; and fractions contain non-lipoprotein-associated proteins. Statistical analysis Results are presented as mean ± the standard error of the mean (SEM). Data were analyzed by Student s t test or one-way ANOVA coupled with Bonferroni-Dunn post hoc test where are performed using of the SPSS for Windows software (version 13.0; 4

5 SPSS Inc, Chicago, IL). P < 0.05 was considered to be statistical significant. References 1. Wang D, Zou T, Yang Y, Yan X, Ling W. Cyanidin-3-o-beta-glucoside with the aid of its metabolite protocatechuic acid, reduces monocyte infiltration in apolipoprotein e-deficient mice. Biochem Pharmacol. 2011;82: Wang Q, Xia M, Liu C, Guo H, Ye Q, Hu Y, Zhang Y, Hou M, Zhu H, Ma J, Ling W. Cyanidin-3-o-beta-glucoside inhibits inos and cox-2 expression by inducing liver x receptor alpha activation in thp-1 macrophages. Life Sci. 2008;83: Li D, Wang D, Wang Y, Ling W, Feng X, Xia M. Adenosine monophosphate-activated protein kinase induces cholesterol efflux from macrophage-derived foam cells and alleviates atherosclerosis in apolipoprotein e-deficient mice. J Biol Chem. 2010;285: Lu KY, Ching LC, Su KH, Yu YB, Kou YR, Hsiao SH, Huang YC, Chen CY, Cheng LC, Pan CC, Lee TS. Erythropoietin suppresses the formation of macrophage foam cells: Role of liver x receptor alpha. Circulation. 2010;121: Rigamonti E, Helin L, Lestavel S, Mutka AL, Lepore M, Fontaine C, Bouhlel MA, Bultel S, Fruchart JC, Ikonen E, Clavey V, Staels B, Chinetti-Gbaguidi G. Liver x receptor activation controls intracellular cholesterol trafficking and esterification in human macrophages. Circ Res. 2005;97: Li L, Sawamura T, Renier G. Glucose enhances human macrophage lox-1 expression: Role for lox-1 in glucose-induced macrophage foam cell formation. Circ Res. 2004;94: Wang D, Xia M, Yan X, Li D, Wang L, Xu Y, Jin T, Ling W. Gut microbiota metabolism of anthocyanin promotes reverse cholesterol transport in mice via repressing mirna-10b. Circ Res. 2012;111: Levin N, Bischoff ED, Daige CL, Thomas D, Vu CT, Heyman RA, Tangirala RK, Schulman IG. Macrophage liver x receptor is required for antiatherogenic activity of lxr agonists. Arteriosclerosis, thrombosis, and vascular biology. 2005;25: Zhang Y, Zanotti I, Reilly MP, Glick JM, Rothblat GH, Rader DJ. Overexpression of apolipoprotein a-i promotes reverse transport of cholesterol from macrophages to feces in vivo. Circulation. 2003;108: Okamoto T, Fukui K, Nakamoto M, Kishi T, Okishio T, Yamagami T, Kanamori N, Kishi H, Hiraoka E. High-performance liquid chromatography of coenzyme q-related compounds and its application to biological materials. J Chromatogr. 1985;342:

Molecular Medicine. Gut Microbiota Metabolism of Anthocyanin Promotes Reverse Cholesterol Transport in Mice Via Repressing mirna-10b

Molecular Medicine. Gut Microbiota Metabolism of Anthocyanin Promotes Reverse Cholesterol Transport in Mice Via Repressing mirna-10b Molecular Medicine Gut Microbiota Metabolism of Anthocyanin Promotes Reverse Cholesterol Transport in Mice Via Repressing mirna-10b Dongliang Wang, Min Xia, Xiao Yan, Dan Li, Lei Wang, Yuxuan Xu, Tianru

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

More information

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei, Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs). MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

More information

Atherosclerosis, the major cause of morbidity and mortality

Atherosclerosis, the major cause of morbidity and mortality National Cholesterol Awareness Month Article Basic Sciences Coenzyme Q10 Promotes Macrophage Cholesterol Efflux by Regulation of the Activator Protein-1/miR-378/ ATP-Binding Cassette Transporter G1 Signaling

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine

Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Int J Clin Exp Med 2015;8(9):16374-16378 www.ijcem.com /ISSN:1940-5901/IJCEM0010359 Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Hongming Zhang

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved 1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,

More information

Supplementary Figures

Supplementary Figures MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,

More information

Table S1. Quantitative RT-PCR primers

Table S1. Quantitative RT-PCR primers Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg

More information

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

Supplemental information

Supplemental information Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental

More information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Atherosclerosis is the underlying cause of cardiovascular

Atherosclerosis is the underlying cause of cardiovascular RP5-833A20.1/miR-382-5p/NFIA Dependent Signal Transduction Pathway Contributes to the Regulation of Cholesterol Homeostasis and Inflammatory Reaction Yan-Wei Hu, Jia-Yi Zhao, Shu-Fen Li, Jin-Lan Huang,

More information

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

SUPPORTING MATREALS. Methods and Materials

SUPPORTING MATREALS. Methods and Materials SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T

More information

Supplemental Material. Results

Supplemental Material. Results Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Glucose is a ligand for the oxysterol receptor LXR Supplementary Figure 1 Schematic representation of pathways influencing glucose fate in the liver. Glucose induces insulin secretion, suppressing hepatic

More information

Ebrahim Abbasi Oshaghi 1,2

Ebrahim Abbasi Oshaghi 1,2 1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi

More information

Lipid (Oil Red O) staining Kit

Lipid (Oil Red O) staining Kit Lipid (Oil Red O) staining Kit Catalog Number KA4541 1 Kit Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

JLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200

JLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200 JLR Papers In Press. Published on October 16, 2003 as Manuscript D300024-JLR200 A method of direct measurement for the enzymatic determination of cholesterol esters Toshimi Mizoguchi 1, Toshiyuki Edano,

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Research article Related Commentary, page 1538 Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Andrew C. Li, 1 Christoph J. Binder, 2 Alejandra

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu

More information

BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE

BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE Roberta Di Benedetto Centro Nazionale per la Qualità degli Alimenti e per i Rischi Alimentari Istituto Superiore

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells Int J Clin Exp Pathol 2017;10(5):5039-5062 www.ijcep.com /ISSN:1936-2625/IJCEP0052419 Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

Supporting Information

Supporting Information Supporting Information Chlorinated Polyfluorinated Ether Sulfonates Exhibit Higher Activity towards Peroxisome Proliferator-Activated Receptors Signaling Pathways than Perfluorooctane Sulfonate Chuan-Hai

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Electronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific

Electronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Direct chemiluminescence detection of circulating

More information

Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes

Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes SUPPLEMENTAL MATERIAL Supplemental Methods Diagnosis for acute myocardial infarction Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes or more of chest pain

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin

More information

Alginic Acid Cell Entrapment: A Novel Method for Measuring In Vivo Macrophage Cholesterol

Alginic Acid Cell Entrapment: A Novel Method for Measuring In Vivo Macrophage Cholesterol Alginic Acid Cell Entrapment: A Novel Method for Measuring In Vivo Macrophage Cholesterol Homeostasis Timothy J. Sontag 1,#, Bijoy Chellan 2, Clarissa V. Bhanvadia 1,3, Godfrey S. Getz 1, Catherine A.

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University

Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University Atherosclerosis Development and the Inflammatory Response of Hepatocytes to Sesame Oil Supplementation Taylor Yohe Project Advisor: Dr. Martha A. Belury Department of Human Nutrition at the Ohio State

More information

Hepatic lipase expression in macrophages contributes to atherosclerosis in apoe-deficient and LCAT-transgenic mice

Hepatic lipase expression in macrophages contributes to atherosclerosis in apoe-deficient and LCAT-transgenic mice Hepatic lipase expression in macrophages contributes to atherosclerosis in apoe-deficient and LCAT-transgenic mice Zengxuan Nong, 1 Herminia González-Navarro, 1 Marcelo Amar, 1 Lita Freeman, 1 Catherine

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

In vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay

In vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.

More information