ACTH-stimulated cortisol release from head kidney of rainbow trout is modulated by glucose concentration
|
|
- Laurence Phillips
- 5 years ago
- Views:
Transcription
1 J Exp Biol Advnce Online Articles. First posted online on 17 Octoer 2012 s doi: /je Access the most recent version t ACTH-stimulted cortisol relese from hed kidney of rinow trout is modulted y glucose concentrtion Mrt Conde-Sieir 1, Ros Alvrez 2, Mrcos A. López-Ptiño 1, Jesús M. Míguez 1, Gert Flik 3, nd José L. Soengs 1 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Lortorios de 1 Fisioloxí Animl nd 2 Bioloxí Celulr, Deprtmento de Bioloxí Funcionl e Ciencis d Súde, Fcultde de Bioloxí, Universidde de Vigo, Spin. 3 Deprtment of Animl Physiology, Institute for Wter nd Wetlnd Reserch, Fculty of Science, Rdoud University Nijmegen, Nijmegen, The Netherlnds Running title: glucose ffects cortisol relese in trout Corresponding uthor: Prof. José L Soengs Lortorio de Fisioloxí Animl Fcultde de Bioloxí Edificio de Ciencis Experimentis Universidde de Vigo E Vigo Spin Tel Fx E-mil jsoengs@uvigo.es 1 Copyright (C) Pulished y The Compny of Biologists Ltd
2 Arevitions The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT 3βHSD, 3β-hydroxysteroid dehydrogense 11βH, 11β-hydroxylse ACTH, drenocorticotropic hormone CRF, corticotrophin relesing fctor GK, hexokinse IV or glucokinse (EC ) GLUT-2, glucose fcilittive trnsporter type 2 Gnt3, gustducin GSse, glycogen synthse (EC ) K ATP, ATP-dependent inwrd rectifier potssium chnnel Kir6.x-like, inwrd rectifier K + chnnel pore type 6.x-like LXR, liver X receptor P450scc, cytochrome P450 cholesterol side chin clevge PK, pyruvte kinse (EC ) StAR, steroidogenic cute regultory protein SGLT-1, sodium-glucose linked trnsporter type 1 SUR-like, sulfonylure receptor-like TH, tyrosine hydroxylse 2
3 Summry The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT To ssess the hypothesis of cortisol relese in rinow trout eing modulted y glucose levels, we first evluted cortisol relese (sl nd ACTH-regulted) y hed kidney tissue superfused with medium reflecting hypo-, normo- or hyperglycemic conditions. Next, cortisol relese from hed kidney frgments in sttic incutions ws ssessed in prllel with chnges in prmeters relted to cortisol synthesis (mrna undnce of StAR, P450scc, 3βHSD, nd 11βH) nd the GK-medited glucosensing mechnism (levels of glycogen nd glucose, ctivities of GK, GSse, nd PK, nd mrna levels of GK, GLUT-2, Kir6.x-like, nd SUR-like). We then evluted the effects of two inhiitors of glucose trnsport cytochlsin B nd phlorizin on cortisol production nd glucosensing mechnisms. The ACTH-induced relese of cortisol proved to e modulted y medium glucose concentrtion in wy tht incresed relese occurs under high glucose levels, nd decresed ACTH-stimulted cortisol relese occurs when glucose trnsport ws inhiited y cytochlsin B. The relese of cortisol cn e ssocited with incresed synthesis since enhnced mrna undnce of genes relted to cortisol synthesis ws lso noted in high glucose medium. Specific GK-immunorectivity in the cortisol producing cells (not in chromffin cells) further sustntites GK-medited glucosensing in cortisol production. In contrst, no chnges comptile with those of glucose levels nd cortisol relese/synthesis in the presence of ACTH were noted for ny other puttive glucosensor mechnisms sed on LXR, SGLT-1 or Gnt3. The results comined re the first evidence for mechnism in fish linking synthesis nd relese of non-pncretic hormone like cortisol with circulting glucose levels. The reltionship ws evident for the regulted (ACTH-dependent) pthwy nd this suggests tht under cute stress conditions glucose is importnt for the regultion of cortisol synthesis nd relese. Key words: rinow trout, hed kidney, cortisol, glucose 3
4 Introduction The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Cortisol is the min steroid produced in fish hed kidney, which hrors the interrenl cells, homologues of the mmmlin drenl zon fscicult cells. In fish, cortisol plys n importnt role in energy homeostsis, growth nd osmoregultion (Mommsen et l., 1999). The min secretgogue for cortisol is drenocorticotropic hormone (ACTH) relesed from the nterior pituitry; ACTH relese, in turn, is controlled y corticotrophin relesing fctor (CRF) produced y the hypothlmus (Wendelr Bong, 1997). The min proteins involved in the regultion of the corticosteroidogenic pthwy (Pyne nd Hles, 2004) comprise steroidogenic cute regultory (StAR) protein, cytochrome P450 cholesterol side chin clevge (P450scc), 3β-hydroxysteroid dehydrogense (3βHSD), nd 11β-hydroxylse (11βH). We demonstrted in previous studies in rinow trout hypothlmus, hindrin nd Brockmnn odies the existence of glucosensor mechnism dependent on glucokinse (GK), glucose fcilittive trnsporter type 2 (GLUT-2), nd ATP-dependent inwrd rectifier potssium chnnel (K ATP ) (see review Polkof et l., 2011). The ltter glucosensor system is djusted under stress conditions, like those ssocited with high stocking density, resulting in its inility to respond to chnges in circulting glucose levels (Conde-Sieir et l., 2010,). The djustment of glucosensor in centrl res (hypothlmus nd hindrin) under stress conditions is pprently medited y CRF since tretment with this neuropeptide ffects the sensitivity of glucosensing mechnism in wy similr to tht oserved under stress conditions (Conde-Sieir et l., 2011). In those studies we oserved very complex interction mong cortisol levels, glycemi, nd stress (Conde-Sieir et l., 2010,). Therefore, we hypothesize tht cortisol synthesis nd relese in interrenl tissue my e modulted y circulting glucose levels, i.e. tht some type of glucosensor mechnism is opertionl in interrenl cells of rinow trout, in wy similr to tht chrcterized in pncretic β-cells where the glucosensor system is relted to insulin relese. In other studies crried out in rinow trout, plsm cortisol levels decresed in situtions known to produce hypoglycemi such s food deprivtion (Pottinger et l., 2003; Polkof et l., 2007) wheres plsm cortisol levels incresed under hyperglycemic conditions such s post-feeding (Bry 1982; Hollowy et l., 1994) or exercise (Nielsen et l., 1994). A recent study crried out in zerfish provided direct evidence for reltionship etween cortisol levels nd glycemi since levels of whole ody cortisol were dependent on glucose (Powers et l., 2010). In mmmls, cortisol secretion from drenl cortex hs een lso hypothesized to e relted to 4
5 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT glycemic conditions (Andrews et l., 2002) though evidence otined to dte is not conclusive since cortisol levels do not chnge under hyperglycemic conditions lone (Andrews et l., 2002) necessitting n dditionl stress to increse (Kirschum et l., 1997). To ssess the hypothesis of glucose levels modulting cortisol relese in rinow trout, we evluted in first experiment chnges in cortisol relese (in the sence or presence of ACTH) when hed kidneys were superfused with medi mimicking conditions of hypo-, normo- nd hyperglycemic conditions (2, 4, nd 8 mm glucose, respectively) s previously descried (Polkof et l., 2007). Since chnges were noted, we crried out second experiment in which cortisol relese from hed kidney slices incuted in vitro ws evluted in prllel with chnges in prmeters relted to cortisol synthesis (mrna undnce of StAR, P450scc, 3βHSD, nd 11βH) nd to the glucosensor chrcterized in rinow trout (Polkof et l., 2011), including levels of glycogen nd glucose, ctivities of GK, glycogen synthse (GSse) nd pyruvte kinse (PK), nd mrna levels of GK, GLUT-2, inwrd rectifier K + chnnel pore type 6.-like (Kir6.x-like), nd sulfonylure receptor-like (SUR-like). Moreover, we lso evluted in the sme experiment the presence of components of ny other puttive glucose sensor mechnisms, similr to those descried in mmmls. These include 1) the electrogenic sensor (González et l., 2009), evluted y mrna undnce of sodiumglucose linked trnsporter type 1 (SGLT-1); 2) the nucler receptor sensor (Mitro et l., 2007) evluted y mrna undnce of liver X receptor (LXR); nd, 3) the tste receptor sensor (Nkgw et l., 2009), evluted y mrna undnce of gustducin (Gnt3). In third series of experiments, we evluted chnges in the sme prmeters descried in experiment 2 ut in the presence of two well known inhiitors of glucose trnsport viz. cytochlsin B (GLUT inhiitor) nd phlorizin (SGLT inhiitor). Finlly, we crried out histochemicl studies to sustntite nd loclize severl of the min components of the glucosensing in hed kidney tissue. Mterils nd methods Fish Rinow trout (Oncorhynchus mykiss Wlum) were otined from locl fish frms either in the Netherlnds (Forellenkwekerij De Keijzerserg, Blitterswijck, experiment 1) or Spin (A Estrd, experiments 2 nd 3, nd immunohistochemicl studies). Fish were mintined for 15 dys under lortory conditions nd 12:12 L:D photoperiod in 5
6 dechlorinted tp wter t 17 C. Fish mss ws 149 ± 4 g. Fish were fed once dily (10:00 h) to stiety with commercil dry fish pellets (Diq-Diproteg; proximte food nlysis ws 48% crude protein, 14% crohydrtes, 25% crude ft, nd 11.5% sh; 20.2 MJ/kg of feed). The experiments descried comply with the Guidelines of the Europen Union Council (2010/63/EU), nd of the Governments of The Netherlnds (code , Lelystd) nd Spin (RD1201/2005) for the use of nimls in reserch. Animl protocols were pproved y the Animl Cre Committees t Universities of Nijmegen nd Vigo. Experimentl design The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT We used hed kidney tissue (cknowledging the heterogeneity of the tissue) rther thn isolted interrenl cells to void the possile dedifferentition, which is usully ssocited with cell isoltion. In ddition to the convenience of collecting hed kidneys s source of cortisol producing cells, the specificities of our ssys nd histology llowed us to define our findings unequivoclly. Experiment 1. In vitro superfusion of hed kidneys t different glucose concentrtions in the sence/presence of ACTH Fish were fsted for 24h efore tretment to ensure sl hormone levels were chieved. After nesthesi with 2-phenoxyethnol (0.5% v/v), fish were scrificed y decpittion, nd hed kidneys (left nd right) were removed crefully nd plced on cheese-cloth filter in superfusion chmer gssed with 0.5% CO 2 /99.5% O 2 mixture. Tissues (pprox. 100 mg) were superfused with modified Hnks medium (92.56 mm NCl; 3.63 mm KCl, 2.81 mm NHCO 3, 0.85 mm CCl 2, 0.55 mm MgSO 4, 0.4 mm KH 2 PO 4, 0.23 mm N 2 HPO 4, 7.5 mm HEPES, 0.03% (w/v) ovine serum lumin, ph 7.15) t three different concentrtions of D-glucose: 2, 4 nd 8 mm (indictive of hypo-, normo- nd hyperglycemic conditions in rinow trout), which ws pumped through the chmers t 30 µl/min y multichnnel peristltic pump (Wtson-Mrlow, Wilmington, MA, USA). All glucose tretments were evluted in ech replicte of hed kidneys used. After 150 min, when cortisol relese hd reched stedy stte, the medium ws supplemented for 20 min with humn ACTH (Sigm, St Louis, Mo, USA) t concentrtion of 3.3x10-7 M determined in previous ssy, in greement with previous studies (Brodeur et l., 1998), except in control chmers where no ACTH ws supplied. This procedure ws repeted 8 times for ech glucose concentrtion (2, 4, nd 8 mm). Five-, ten- or thirty-minute frctions were 6
7 collected during 4 hours nd stored t -80ºC for cortisol ssy. Are under curve (AUC) ws clculted following the trpezoidl rule using the SigmPlot softwre. The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Experiment 2. In vitro incution of hed kidney tissue t different glucose concentrtions in the sence/presence of ACTH The superfusion experiments re not suitle to evlute the mechnisms involved in the reltionship etween cortisol synthesis nd relese nd glucose levels; sttic incutions were used to explore the underlying mechnisms. Every morning of n experiment, fish tht hd een fsted for 24h (to ensure sl levels of metolic hormones were chieved) were dip-netted, nesthesized with MS-222 (50 mg l 1 ) uffered to ph 7.4 with sodium icronte, weighed nd scrificed y decpittion. Hed kidneys were removed nd rinsed y immersion in modified Hnks medium. In order to hve enough mss, tissues were pooled from 3-4 fish. On ech pool, tissues were finely sliced in chilled Petri dish nd mixed, nd then plced in other Petri dishes contining 100 ml of modified Hnks medium.g -1 tissue (gssed with 0.5% CO 2 /99.5% O 2 mixture) t three different concentrtions of D-glucose: 2, 4 nd 8 mm during 1.5 hours to ensure sl levels of cortisol relese. After this time, tissue ws plced in 48-well culture pltes (25 mg of tissue in 250 µl of modified Hnks medium per well) t 2, 4 nd 8 mm of glucose lone or in the presence of 3.3.x10-7 M (3.3 x 10 5 IU) ACTH (Sigm) to ssess differences in response to glucose under constitutive (sl) nd regulted (ACTH stimulted) conditions. All glucose tretments were ssessed t the sme time in ech replicte of hed kidneys used. After 10, 30 or 60 min incution, tissues were quickly removed, snp-frozen in liquid nitrogen, nd stored t -80 C until ssyed wheres the medium ws lso tken for cortisol ssessment. The smpling times used were selected sed on the dynmics of cortisol relese oserved in experiment 1 fter ddition of ACTH. For ech experiment, 2 different sets of tissue pools (2 tretments x 3 glucose concentrtions x 3 smpling times) were used. The first set ws used to ssess enzyme ctivities (GK, GSse, nd PK) nd metolite levels (glucose nd glycogen) wheres the second set ws used for quntifiction of mrna undnce. Cortisol levels in the medium were evluted in ll smples from the two sets used. The sme procedure ws performed in 4 independent replictes per set (N=4). Experiment 3. In vitro incution of hed kidney tissue t 8 mm glucose with inhiitors of glucose trnsport in the presence of ACTH 7
8 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Smples were otined nd processed s descried in experiment 2. Tissue ws plced in 48-well culture pltes (25 mg of tissue in 250 µl of modified Hnks medium per well) t 8 mm glucose lone (control) or in the presence of 3.3.x10-7 M ACTH, or in the presence of 3.3.x10-7 M ACTH nd 10 µm cytochlsin B, or in the presence of 3.3.x10-7 M ACTH nd 1 mm phlorizin. The concentrtions of inhiitors were selected sed on previous studies on glucose trnsport in fish (Soengs nd Moon, 1995, 1998). After 10, 30 or 60 min incution, tissues were quickly removed, snp-frozen in liquid nitrogen, nd stored t -80 C until ssyed wheres the medium ws lso tken for cortisol ssessment. In ech experiment, 2 different sets of tissue pools were used. The first set ws used to ssess enzyme ctivities (GK, GSse, nd PK) nd metolite levels (glucose nd glycogen) wheres the second set ws used for quntifiction of mrna undnce. Cortisol levels in the medium were evluted in ll smples from the two sets used. The sme procedure ws performed in 4 independent replictes per set (N=4). Anlyticl procedures Cortisol mesurement In experiment 1 cortisol ws mesured y rdioimmunossy. A 96-well micro-ssy plte ws incuted overnight t 4ºC with 100 µl of cortisol ntiody (Acm, Cmridge, UK) diluted 1:2000 in coting uffer (50mM NHCO 3, 50mM N 2 CO 3, nd 0.02 % NN 3 ). After wshing with wsh uffer (100mM Tris, 0.9% NCl, nd 0.02% NN 3 ), the plte ws incuted for 1 hour t 37ºC with 100 µl of locking uffer (norml clf serum t 0.25% in wsh uffer). 10 µl of stndrds, plsm or superfusion frctions were incuted during 4 hours with 3 H-cortisol trcer (Perkin Elmer, Wlthm, MA, USA) diluted in ssy uffer (100mM Tris, 0.9% NCl, 0.02% NN 3, nd 0.1% ANS, set ph to 7.4 with HCl). This RIA ssy hd een vlidted efore for the mesurement of cortisol in culture medium (Gorissen et l., 2012). In experiments 2 nd 3 cortisol levels were mesured y ELISA using commercilly ville kit (Cymn, Ann Aror, MI, USA). Assessment of metolite levels nd enzyme ctivities Smples used (pprox. 20 mg) to ssess metolite levels were homogenized immeditely y ultrsonic disruption in 7.5 vol of ice-cooled 6% perchloric cid, nd neutrlized (using 1 mol l -1 potssium icronte). The homogente ws centrifuged, nd the superntnt used to ssy tissue metolites. Tissue glycogen levels were ssessed using the method of Keppler nd Decker (1974). Glucose otined fter glycogen rekdown (fter 8
9 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT sutrcting free glucose levels) ws determined with commercil kit (Biomérieux, Grenole, Frnce). Smples for enzyme ctivities (pprox. 25 mg) were homogenized y ultrsonic disruption with 9 vols ice-cold-uffer consisting of 50 mmol l -1 Tris (ph 7.6), 5 mmol l -1 EDTA, 2 mmol l -1 1,4-dithiothreitol, nd protese inhiitor cocktil (Sigm). The homogente ws centrifuged nd the superntnt used immeditely for enzyme ssys. Enzyme ctivities were determined using microplte reder INFINITE 200 Pro (Tecn, Männedorf, Switzerlnd) nd micropltes. Rection rtes of enzymes were determined y the increse or decrese in sornce of NAD(P)H t 340 nm. The rections were strted y the ddition of superntnt (15 µl) t pre-estlished protein concentrtion, omitting the sustrte in control wells (finl volume µl), nd llowing the rections to proceed t 20 C for pre-estlished times (3-10 min). Enzyme ctivities re expressed reltive to protein content of the smple (ctivity per mg protein). Protein ws ssyed in triplicte in homogentes using micropltes ccording to the icinchoninic cid method with ovine serum lumin (Sigm) s stndrd. GK (EC ), GSse (EC ), nd PK (EC ) ctivities were determined s descried previously (Polkof et l., 2007,2008,,c). Enzyme ctivities were ssessed t mximum rtes y preliminry tests to determine optiml sustrte concentrtions. mrna undnce nlysis y rel-time quntittive RT-PCR Totl RNA ws extrcted from tissues (pprox. 20 mg) using Trizol regent (Life Technologies, Grnd Islnd, NY, USA) nd treted with RQ1-DNAse (Promeg, Mdison, Wi, USA). Two µg totl RNA were reverse trnscried into cdna using Superscript II reverse trnscriptse (Life Technologies) nd rndom hexprimers (Life Technologies). Gene expression levels were determined y rel-time quntittive RT-PCR (q-pcr) using the icycler iq TM (BIO-RAD). Anlyses were performed on 1 µl cdna using the MAXIMA SYBR Green qpcr Mstermix (Ferments, Vilnius, Lithuni), in totl PCR rection volume of 15 µl, contining nm of ech primer. Aundnce of GK, GLUT-2, Kir6.xlike, nd SUR-like mrnas ws determined s previously descried (Polkof et l., 2008,c); mrna undnce of 3βHSD, 11βH, LXR, P450scc, SGLT-1, nd StAR ws determined s previously descried y other uthors in the sme species (Geslin nd Auperin, 2004; Geurden et l., 2007; Cruz-Grcí et l., 2009) nd mrna undnce of Gnt3 ws determined using specific primers developed for rinow trout sed on ville sequences (CU073912, Sigene dtse, INRA; courtesy of Dr. S Polkof, INRA Clermont/Theix, Frnce). Reltive quntifiction of the trget gene trnscripts ws done using elongtion 9
10 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT fctor 1α (EF1α) gene expression s reference, which ws stly expressed in this experiment. Sequences of the forwrd nd reverse primers used for ech gene expression re shown in Tle 1. Therml cycling ws initited with incution t 95 C for 15 min using hot-strt itq TM DNA polymerse ctivtion; 40 steps of PCR were performed, ech one consisting of heting t 95 C for 15s for denturing, nd t specific nneling tempertures (Tle 1) for 30s nd extension t 72 C for 30s. Following the finl PCR cycle, melting curves were systemticlly monitored (55 C temperture grdient t 0.5 C/s from 55 to 95 C) to ensure tht only one frgment ws mplified. Ech smple ws nlyzed in triplicte. All the replictes of ech smple were locted in the sme plte for ech gene to llow comprisons. We included in ll the pltes the stndrd curve (y triplicte), nd controls for NTC nd RT negtive control (y duplicte). Only efficiency vlues etween % were ccepted (the R 2 for ll the genes ssessed ws lwys higher thn 0.985). Reltive quntifiction of the trget gene trnscript with the EF1α reference gene trnscript ws mde following the Pfffl method (2001). Immunohistochemistry Fish were nesthetized with MS-222, their hed kidneys were excised, nd smll pieces were immersion-fixed in Bouin s fluid or in 4% prformldehyde in 0.1M phosphteuffered sline (PBS) t ph 7.4 for 24 h t 4ºC. Lter, pieces were prffin-emedded nd sections of 6-12 µm thick were stined using the hemtoxylin-eosin (H-E) to study the overll structure. Other hed kidney pieces were cryo-protected in 30% sucrose nd were emedded in Tissue-Tec OCT compound (Skur, Torrnce, CA, USA). Horizontl nd trnsversl sections (20 µm) were mde on cryostt. The primry ntiodies used in this study were polyclonl rit nti-gk (Snt Cruz Biotechnology, Snt Cruz, CA, USA), polyclonl rit nti-sglt-1 (Millipore, Billeric, MA, USA) nd monoclonl mouse nti-th (tyrosine hydroxylse, Millipore). The specificity of GK nd SGLT-1 ntiodies ws previously tested y western lotting (Polkof et l., 2010). Sections were processed s follows: 1) locking endogenous peroxidse ctivity with 3% H 2 O 2 for 30 min.; 2) pre-incution with 0.1% ovine serum lumin (BSA) for 1 h, to inhiit non-specific rectivity; 3) incution with nti-gk (1:100), nti-sglt-1 (1:100) nd nti-th (1:200) ntiodies overnight t room temperture in humid chmer; 4) incution with iotinylted got nti-rit IgG (GAR 1:100, Vector, Burlingme, CA, USA) for GK nd SGLT-1 nd iotinylted got nti-mouse IgG (GAM, Sigm, 1:100) for TH; 5) fter 10
11 rinsing in PBS, the tissue ws incuted with ABC-complex (Vector, 1:100); 6) the rection The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT ws developed y incution with 3,3 -diminoenzidine (DAB, Sigm, 0.003%) nd H 2 O 2 (0.01%). All dilutions were mde in PBS. Finlly, some sections were counterstined with Myer s hemtoxylin solution, dehydrted nd cover-slipped with DEPEX mounting medium. Negtive controls were run y omitting primry ntiser during incution of tissues To study co-locliztion of GK, SGLT-1 nd TH, selected sections were processed for doule immunofluorescence following the steps 1-2 s lredy descried. Then, sections were incuted in cocktil of the two ntiodies SGLT-1/TH, GK/TH (dilution lredy descried) nd then with cocktil of secondry specific ntiodies (Alex Fluor 488 GAR-conjugted nd Alex Fluor 594 GAM-conjugted, Life Technologies) diluted 1:400 in PBS. After incution, sections were wshed in PBS nd cover-slipped using Prolong Gold with DAPI (Life Technologies) to dely fluorescence fding. For co-locliztion of SGLT-1/GK, sections were incuted sequentilly with nti-sglt1, secondry ntiody (Alex Fluor 488 GARconjugted) oserved nd photogrphed. Then, the sme sections were incuted with nti- GK followed y secondry specific ntiody (Alex Fluor 594 GAR-conjugted). Slides were oserved nd photogrphed with n Olympus photomicroscope (BX51) equipped with digitl cmer (Olympus DP71). Confocl imges were cquired with spectrl lser confocl microscope Leic SP5X. Sttistics Comprisons mong groups were crried out using three-wy ANOVA with glucose concentrtion, presence/sence of ACTH, nd time s min fctors. Only in those cses where significnt effect ws noted post-hoc comprisons were crried out y Student- Newmn-Keuls test, nd differences were considered sttisticlly significnt t P<0.05. When necessry dt were log trnsformed to fulfill the conditions of the nlysis of vrince. Results Experiment 1 Significnt time, ACTH, nd glucose effects (P<0.001) were noted using three-wy ANOVA. The time course, nd the re under the curve (AUC) of the time course of cortisol relesed from hed kidney tissue displyed no mjor chnges with the increse in glucose 11
12 concentrtion in the medium when ACTH ws not present; however, in the presence of ACTH cortisol relese incresed in prllel with the increse of glucose (Fig. 1). The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Experiment 2 Cortisol relesed to the medium displyed significnt time, ACTH, nd glucose effects s well s significnt interctions (Tle 2). Levels were higher fter 60 min of incution t 2 mm glucose either in the sence or presence of ACTH, nd fter 30 min t 8 mm glucose in the presence of ACTH (Fig. 2); in the presence of ACTH higher cortisol levels were noted t 8 mm glucose fter 30 min nd t 2 mm glucose fter 60 min (Fig. 2). mrna levels of genes relted to cortisol synthesis (StAR, P450scc, 3βHSD, nd 11βH) displyed glucose, ACTH, nd time effects (Tle 2). In the sence of ACTH the 4 prmeters displyed t 8 mm glucose higher vlues t 10 min thn t 30 or 60 min of incution, nd t 2 mm glucose lower vlues were noted fter 60 min incution for StAR nd P450scc mrna levels (Fig. 3). In the presence of ACTH higher vlues were noted for the 4 prmeters fter 10 min of incution t 4 nd 8 mm glucose (Fig. 3). Levels t 8 mm glucose were higher thn those t 2 nd 4 mm glucose fter 10 min of incution in the sence of ACTH wheres in the presence of ACTH dose-dependent increse ws noted in the four prmeters ssessed (Fig. 3). Glucose levels displyed ACTH nd glucose effects, nd glycogen levels displyed glucose effects (Tle 2). Glucose levels (Fig. 4A) were higher t 8 mm glucose thn t 2 nd 4 mm glucose in the sence of ACTH wheres dose-dependent increse ws noted in the presence of ACTH. Glycogen levels (Fig. 4B) were lower t 2 mm glucose thn t 4 nd 8 mm glucose fter 10 min incution in the sence of ACTH wheres levels were higher t 8 mm glucose thn t 2 nd 4 mm glucose fter 60 min incution in the presence of ACTH. The ctivities of GK nd GSse were ffected y time nd glucose nd glucose x time interction wheres PK ctivity displyed time effects (Tle 2). GK ctivity (Fig. 5A) in the sence of ACTH incresed fter 60 min t 4 mm glucose compred with 30 min, nd fter 30 min t 8 mm glucose compred with 10 min wheres in the presence of ACTH ctivity ws higher fter 60 min t 2 nd 8 mm glucose nd lower fter 30 min t 4 mm glucose; in the sence of ACTH the ctivity ws lower t 2 mm glucose thn t 4 mm glucose fter 60 min, nd lso lower t 2 thn t 4 mm glucose fter 60 min wheres in the presence of ACTH ctivity ws lower t 2 mm glucose thn t 4 nd 8 mm glucose fter 10 nd 60 min of incution. GSse ctivity (Fig. 5B) incresed with time t 2 mm glucose in the sence of ACTH wheres ctivity decresed with time t 8 mm glucose oth in the sence or presence 12
13 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT of ACTH; the ctivity t 4 nd 8 mm glucose ws lower thn tht t 2 mm glucose fter 30 nd 60 min incution oth in the sence or presence of ACTH. PK ctivity (Fig. 5C) ws higher fter 30 min of incution t 4 mm glucose (in the sence of ACTH) or 2 mm glucose (in the presence of ACTH). mrna levels of Kir6.x-like nd SUR-like were ffected y ACTH wheres mrna levels of GK, GLUT-2, Kir6.x-like, nd SUR-like were ffected y time nd glucose (except GLUT-2 for glucose) s displyed in Tle 2. GK mrna levels (Fig. 6A) were lower fter 60 min of incution t 8 mm glucose in the sence of ACTH wheres in the presence of ACTH levels were higher fter 30 nd 60 min t 4 mm glucose nd fter 30 min t 8 mm glucose; levels t 8 mm glucose were higher thn those t 2 nd 4 mm glucose fter 15 nd 30 min of incution nd lower fter 60 min of incution in the sence of ACTH nd higher fter 30 min of incution in the presence of ACTH; moreover, levels were higher t 4 mm glucose thn t 2 mm glucose fter 10 min of incution in the sence of ACTH nd fter 30 min of incution in the presence of ACTH. GLUT-2 mrna levels (Fig. 6B) incresed fter 30 nd 60 min of incution t 2 nd 4 mm glucose oth in the sence or presence of ACTH wheres t 8 mm glucose mrna levels were higher fter 30 min incution in the sence of ACTH. Kir6.x-like mrna levels (Fig. 6C) nd SUR-like mrna levels (Fig. 6D) incresed fter 30 nd 60 min of incution t 4 nd 8 mm glucose in the sence of ACTH nd t 2 nd 4 mm glucose in the presence of ACTH; mrna levels of oth genes were higher t 2 mm glucose thn t 4 nd 8 mm glucose fter 30 nd 60 min of incution in the presence of ACTH. mrna levels of LXR nd Gnt-3 displyed no significnt effects of glucose tretment though they were ffected y time wheres SGLT-1 mrna ws ffected y ACTH, time, nd glucose (Tle 2). SGLT-1 mrna levels (Fig. 7A) incresed fter 60 min of incution t 2 nd 8 mm glucose in the sence of ACTH nd t 2 nd 4 mm glucose in the presence of ACTH; levels t 8 mm glucose were higher thn those t 2 nd 4 mm glucose in the sence of ACTH wheres levels t 2 mm glucose were higher thn those t 4 nd 8 mm glucose fter 10 nd 60 min of incution in the presence of ACTH. LXR mrna levels (Fig. 7B) were higher fter 30 nd 60 min of incution t 4 mm glucose nd fter 30 min of incution t 8 mm glucose in the sence of ACTH. Gnt3 mrna levels (Fig. 7C) incresed fter 60 min of incution t 2 nd 4 mm glucose in the sence or presence of ACTH. Experiment 3 13
14 The presence of phlorizin did not induce significnt chnges in ny of the prmeters ssessed (dt not shown). The effects of the presence of cytochlsin B on the prmeters ssessed in hed kidney t 8 mm glucose re shown in tle 3. Levels of cortisol nd glycogen nd mrna undnce of P450scc, 11 βh nd GLUT-2 tht incresed in the presence of ACTH returned to vlues similr to those of controls when cytochlsin B ws present. GSse ctivity nd GK mrna undnce decresed in tissues treted with ACTH nd cytochlsin B compred with controls nd tissues treted with ACTH lone. The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Immunohistochemicl studies In sections stined with hemtoxylin-eosin, hemtopoietic, interrenl, nd chromffin cells were esily recognizle (Fig. 8). In the res surrounding vessels we oserved interrenl (polygonl with rounded nuclei nd dense cytoplsm nd forming cords or follicles) nd chromffin (irregulr or elongted in shpe with light cytoplsm nd re rrnged in groups or cords) cells, which cn e contiguous ut re never mingled. GK immunorectivity ws present in interrenl cells ut not in chromffin cells. In contrst, SGLT-1 immunorectivity ws present in most (ut not ll) chromffin cells. In the colocliztion studies (Fig. 9) we oserved tht TH co-loclized with SGLT-1 in most cells ut never co-loclized with GK. In the cells where GK ws present we oserved co-locliztion with SGLT-1. Discussion A well estlished prdigm in stress physiology is tht corticosteroids stimulte glucose production to fuel metolic processes for reestlishing homeostsis (Wendelr Bong, 1997). However, n llosttic control of cortisol levels requires djustment of set points for cortisol production nd relese. Levels of circulting metolites like glucose could e involved in such mechnism through either inhiitory or stimultory effects. According to this model ACTH-stimulted cortisol relese from hed kidney of rinow trout ws clerly modulted y glucose concentrtion since incresing glucose levels elicited incresed cortisol relese (more cler in superfusion experiments) wheres ACTH-stimulted cortisol relese ws inhiited y the presence of cytochlsin B (n inhiitor of GLUT glucose crrier). These results pprently disgree with results otined in zerfish where cortisol levels were dependent on glucose in the sence of ACTH (Powers et l., 2010) though the study in 14
15 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT zerfish evluted chnges in whole ody content, not in medium levels s studied here nd used much higher glucose concentrtion thn tht used in the present study. Since ACTH levels increse under stress conditions in fish (Wendelr Bong 1997) our results my indicte tht the relese of cortisol in response to incresed glucose concentrtion occurs only under stress conditions. This sitution would e comprle to tht lredy reported in mmmls where n dditionl stress is needed to increse cortisol relese in response to n increse in glucose levels (Kirschum et l., 1997). However, in previous studies we oserved tht stress induced y high stocking density in rinow trout did not result in prllel response of cortisol levels in plsm to incresed glucose levels (Conde-Sieir et l., 2010,), which could e relted to the fct tht cortisol levels in plsm re the net result of relese nd rekdown s well s clernce y excretion, nd the lnce determines plsm levels. Moreover, the response of cortisol levels to chnges in glucose concentrtion could e dependent upon the type of stress nd/or exposure to ACTH. The incresed relese of cortisol from hed kidney could e relted to n enhnced production, nd therefore we evluted mrna undnce of severl genes involved in cortisol synthesis such s StAR, P450scc, 3βHSD, nd 11βH whose chnges in mrna levels re known to mirror those of cortisol relese in rinow trout (Aluru nd Vijyn 2006; Hgen et l., 2006). The presence of ACTH enhnced mrna levels of P450scc, 11βH, nd StAR under normoglycemic conditions (4 mm glucose), which is in greement with results previously otined in rinow trout (Geslin nd Auperin, 2004; Aluru nd Vijyn 2006). Furthermore, mrna levels of genes relted to cortisol synthesis incresed in generl in prllel with the increse of glucose concentrtion in the medium in the presence of ACTH thus supporting glucose modultion of ACTH-stimulted cortisol synthesis. In the sence of ACTH, only 8mM glucose ctivted these trnscripts suggesting tht sl cortisol cn modulte trnscript levels ut only under hyperglycemic conditions, which is lso in greement with the increse noted in cortisol levels under the sme condition. It is lso interesting to mention tht the modultion of glucose levels ws clerly oserved t short times of incution, 10 min, since from tht time onwrds mrna levels tended to e similr. This is proly suggesting fst regultion of gene expression, which is lter followed y chnges in cortisol itself tht showed higher levels therefter (30 min). The effect of ACTH on genes involved in cortisol synthesis ws lso mximl in those short time periods. Further support to the reltionship etween glucose levels nd cortisol synthesis comes from the results otined in the presence of cytochlsin B tht countercted the increse induced y ACTH in the mrna undnce of P450scc nd 11βH. 15
16 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Could glucosensors hve role in the connection etween incresed glucose levels nd incresed synthesis nd relese of cortisol? The est known glucosensor mechnism in mmmls, the GK-medited glucosensor (Mrty et l., 207), requires glucose uptke through the low-ffinity glucose trnsporter GLUT-2, glucose phosphoryltion y GK, nd susequent metolism of glucose through glycolysis to increse the intrcellulr ATP/ADP rtio. This leds to the closure of K ATP chnnels, memrne depolriztion, the entry of C 2+, which triggers incresed neuronl ctivity nd neurotrnsmitter secretion in rin regions nd insulin relese in pncretic β-cells. We hve chrcterized in hypothlmus, hindrin, nd Brockmnn odies (min ccumultion of pncretic endocrine tissue) of rinow trout the presence of similr GK-medited glucosensor system (see review Polkof et l., 2011). The possiility of GK-medited glucosensor system present in interrenl cells tht could relte glucose detection to cortisol relese is supported y our immunohistochemicl studies in hed kidney. In the res surrounding lood vessels we oserved two different cell types tht cn e identified s interrenl nd chromffin cells in greement with previous studies in rinow trout (Gllo nd Civinini, 2001). In chromffin cells (lso identified y TH immunorectivity) SGLT-1 ws present in 60-70% of them, nd GK ws not detected. In interrenl cells GK nd SGLT-1 were co-loclized. The presence of GK in interrenl cells provides direct evidence for reltionship etween cortisol iosynthesis nd glucosensing through glucosensor GK-relted mechnism. Therefore, we ssessed in hed kidney slices severl of the prmeters relted to GK-medited glucosensing in response to incresed glucose concentrtion. Chnges oserved in severl of those prmeters re in greement with the functioning descried in other glucosensing tissues in rinow trout (Polkof et l., 2007,,2008,,c), such s the increse in glucose nd glycogen levels, the increse of GK mrna levels or the decrese in mrna undnce of the components of the K ATP chnnel (Kir6.x-like nd SUR-like) in response to incresed glucose levels. In contrst to those prmeters, no chnges were noted in other prmeters such s GK ctivity or mrna undnce of GLUT-2, tht usully increse in response to rised glucose concentrtion in other glucosensing tissues in rinow trout (Polkof et l., 2008,,c; Conde- Sieir et l., 2010,,2011). More surprising ws the finding tht GSse ctivity tht normlly increse in glucosensor tissues of mmmls (Mrty et l., 2007) nd fish (Polkof et l., 2008,,c; Conde-Sieir et l., 2010,2011) under incresed glucose concentrtions ctully decresed in hed kidney. Further support to the presence of glucosensor mechnisms sed on GK come from the results otined when hed kidney slices were incuted in the presence of GLUT-2 16
17 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT ntgonist like cytochlsin B. Cytochlsin B tretment in the presence of ACTH reversed the response of severl prmeters (glycogen levels nd mrna undnce of GK nd GLUT- 2) to ACTH though no chnges were noted in others (even in the cse of GSse ctivity n gonistic effect ws noted). In generl, it seems tht severl of the responses of prmeters relted to glucosensing re locked y the inhiition of glucose trnsport through GLUT-2, one of the compulsory steps of glucosensing. Therefore, not ll of the components of puttive GK-medited glucosensor system seem to e opertionl s predicted from mmmlin model in hed kidney ut severl of them ctully responded to incresed glucose levels in wy similr to tht previously ddressed in other glucosensing tissues in rinow trout. The lck of response in severl prmeters could e relted to the fct tht hed kidney is heterogeneous tissue composed of lymphoid cells, interrenl cells, melnomcrophges nd chromffin cells (Wendelr Bong 1997; Mommsen et l., 1999). In fct, Hontel et l (2008) descried tht only 0.01% of cells in rinow trout hed kidneys were interrenl cells. The fct tht only few of the cells (interrenl) my possess glucosensing mechnisms relted to GK would help to explin why not so cler chnges were noted in severl prmeters since vlues otined in this study re the result of the dilution effect of different cell types ville in the tissue ssessed. The differentil expression ptterns oserved in the immunohistochemicl studies would lso support such contention. Moreover, GK is lso present in other cell types in hed kidney (such s in tuulr cells of nephrons s oserved in our immunohistochemicl studies) whose response to glucose my e different thn tht occurring in interrenl cells. We hve no explntion regrding the connection etween ctivtion of puttive GK-medited glucosensor mechnism in interrenl cells nd incresed cortisol relese. In pncretic endocrine tissue, the ctivtion of glucosensor system sed on GK induces the entry of clcium through L-type clcium chnnels resulting in susequent insulin relese. A comprle mechnism (though certinly operting through other effectors) my e present in interrenl cells of rinow trout. Other glucosensor systems descried in mmmlin rin regions nd endocrine pncres re the electrogenic sensor sed on SGLT-1 (Gonzlez et l., 2009), the nucler receptor sensor sed on LXR (Mitro et l., 2007), nd the tste receptor sensor sed on gustducin (Nkgw et l., 2009). In contrst to the GK-medited sensor, there is no cler evidence in fish regrding the presence of ny of those sensors yet, with only preliminry evidence descriing SGLT-1 in rinow trout intestine (Polkof et l., 2010). We hve evluted the response of severl prmeters relted to those puttive glucosensor systems in 17
18 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT hed kidneys of rinow trout mintined under different glucose concentrtions. The nucler receptor nd the tste receptor sensors seem to e present ut not to e opertionl under the conditions used in the present studies since no chnges were noted for mrna undnce. As for the electrogenic sensor, it could e opertionl in the sence of ACTH since incresed mrna undnce of SGLT-1 ws noted in response to incresed levels of glucose. Moreover, in our immunohistochemicl studies we oserved tht SGLT-1 co-loclized with GK in interrenl cells. However, compring the response of SGLT-1 mrna with tht of cortisol levels nd cortisol-relted genes tht minly responded to glucose in the presence of ACTH, it seems tht it is not opertionl s sensor involved in cortisol relese since in the presence of ACTH SGLT-1 mrna undnce decresed. These results re lso supported y the lck of effect of the SGLT inhiitor phlorizin on cortisol relese nd mrna levels of genes expressing proteins involved in cortisol metolism. Therefore, differentil involvement of these sensing mechnisms in constitutive nd regulted pthwys could e proposed. In summry, we demonstrte tht ACTH-induced relese of cortisol y trout hed kidney is modulted y glucose levels in wy tht incresed relese occurs under high glucose levels nd decresed relese occurs when glucose trnsport is inhiited y cytochlsin B. The relese of cortisol cn e ssocited with incresed synthesis since enhnced mrna undnce of genes relted to cortisol synthesis ws lso noted under conditions of incresed glucose. These results indicte tht glucosensor my exist in interrenl cells of rinow trout. Accordingly, we otined multiple evidence regrding the presence of glucosensor medited y GK in hed kidney, presumly in interrenl cells, since immunorectivity for GK ws lwys present in interrenl cells ut sent in chromffin cells, nd incresed glucose levels resulted in chnges in severl prmeters relted to GKmedited glucosensing similr to those lredy reported in glucosensor tissues of the sme species. In contrst, no chnges comptile with those of glucose levels nd cortisol relese/synthesis in the presence of ACTH were noted for ny other puttive glucosensor mechnisms sed on LXR, SGLT-1 or Gnt3. However, due to the heterogeneity of the tissue used cution must e tken since specific studies were not crried out in isolted interrenl cells nd, therefore, the effects oserved my e indirect not reflecting direct reltionship etween glucose levels nd steroidogenic cpcity. In this wy, mmmlin studies hve shown tht glucose cn modulte chromffin cells cpcity for ctecholmine synthesis (Piskuric et l., 2008). 18
19 The results comined re the first evidence for mechnism in fish linking synthesis nd relese of non-pncretic hormone like cortisol with circulting glucose levels, in wy comprle to tht occurring in pncretic β-cells responding to incresed glucose levels with rised insulin relese. The reltionship ws evident for the regulted (ACTH-dependent) pthwy nd this suggests tht under cute stress conditions glucose is importnt for the regultion of cortisol synthesis nd relese. A coupling of ACTH-stimulted cortisol relese to circulting glucose seems logicl s hyperglycemic stte supports the cortisol surges (nd their impct on glucose utiliztion) under cute stress conditions. The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Acknowledgements This study ws supported y reserch grnts from Spnish Ministerio de Cienci e Innovción nd Europen Fund for Regionl Development (AGL C03-03), nd Universidde de Vigo (Contrto-Progrm con grupos de investigción consoliddos) to JLS, nd Dutch ministery of Eduction, Agriculture nd Innovtion (BO project BO ) nd Europen Union (EU project "COPEWELL") to GF. M.C-S. ws recipient of predoctorl fellowship from the Ministerio de Cienci e Innovción (Progrm FPI). M.A.L-P. ws recipient of postdoctorl scholrship from Xunt de Glici (Progrm Isidro Prg Pondl). 19
20 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT References Aluru, N. nd Vijyn, M.M. (2006). Aryl hydrocron receptor ctivtion impirs cortisol response to stress in rinow trout y disrupting the rte-limiting steps in steroidogenesis. Endocrinology 147, Andrews, R.C., Herlihy, O., Livingstone, D.E.W., Andrew, R., nd Wlker, B.R. (2002). Anorml cortisol metolism nd tissue sensitivity to cortisol in ptients with glucose intolernce. J. Clin. Endocrinol. Met. 87, Brodeur, J.C., Dniel, C., Ricrd, A.C., Hontel, A. (1998). In vitro response to ACTH of the interrenl tissue of rinow trout (Oncorhynchus mykiss) exposed to cdmium. Aqut. Toxicol. 42, Bry, C. (1982). Dily vritions in plsm cortisol levels of individul femle rinow trout Slmo girdneri: evidence for post-feeding pek in well-dpted fish. Gen. Comp. Endocrinol. 48, Conde-Sieir, M., Aguilr, A.J., López-Ptiño, M.A., Míguez, J.M., nd Soengs, J.L. (2010). Stress lters food intke nd glucosensing response in hypothlmus, hindrin, liver, nd Brockmnn odies of rinow trout. Physiol. Behv. 101, Conde-Sieir, M., Agulleiro, M.J., Aguilr, A.J., Míguez, J.M., Cerdá-Reverter, J.M., nd Soengs, J.L. (2010). Effect of different glycemic conditions on gene expression of neuropeptides involved in control of food intke in rinow trout; interction with stress. J. Exp. Biol. 213, Conde-Sieir, M., Lirán-Pérez, M., López Ptiño, M,A., Míguez, J.M., nd Soengs, J.L. (2011). CRF tretment indices redjustment in glucosensing cpcity in the hypothlmus nd hindrin of rinow trout. J. Exp. Biol. 214, Cruz-Grci, L., Minghetti, M., Nvrro, I., nd Tocher, D.R. (2009). Moleculr cloning, tissue expression nd regultion of liver X receptor (LXR) trnscription fctors of Atlntic slmon (Slmo slr) nd rinow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B. 153, Gllo, V.P. nd Civinini, A. (2001). Immunohistochemicl locliztion of nnos in the hed kidney of lrvl nd juvenile rinow trout, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 124, Geslin, M. nd Auperin, B. (2004). Reltionship etween chnges in mrnas of the genes encoding steroidogenic cute regultory protein nd P450 cholesterol side chin clevge in hed kidney nd plsm levels of cortisol in response to different kinds of cute stress in the rinow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 135, Geurden, I., Armendi, M., Zmonino-Infnte, J., nd Pnsert, S. (2007). Erly feeding of crnivorous rinow trout (Oncorhynchus mykiss) with hyperglucidic diet during short period: effect on dietry glucose utiliztion in juveniles. Am. J. Physiol. Regul. Integr. Comp. Physiol. 292, R2275-R2283. González, J.A., Reimnn, F., nd Burdkov, D. (2009). Dissocition etween sensing nd metolism of glucose in sugr sensing neurones. J. Physiol. 587, Gorissen, M., Bernier, N.J., Mnuel, R., de Gelder, S., Metz, J.R., Huising, M.O., nd Flik, G. (2012) Recominnt humn leptin ttenutes stress xis ctivity in common crp (Cyprinus crpio L.). Gen. Comp. Endocrinol. 178, Hgen, I.J., Kuske, M., nd Young, G. (2006). Effects of ACTH nd camp on steroidogenic cute regultory protein nd P450 11β-hydroxylse messenger RNAs in rinow trout interrenl cells: reltionship with in vitro cortisol production. Gen. Comp. Endocrinol. 145, Hollowy, A.C., Reddy, P.K., Sheridn, M.A., nd Letherlnd, J.F. (1994). Diurnl rhythms of plsm growth hormone, somtosttin, thyroid hormones, cortisol nd glucose 20
21 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT concentrtions in rimow trout, Oncorhynchus mykiss, during progressive food deprivtion. Biol. Rhythm Res. 25, Hontel, A., Lelond, V.S., nd Chng, J.P. (2008). Purifiction nd isoltion of corticosteroidogenic cells from hed kidney of rinow trout (Oncorhynchus mykiss) for testing cell-specific effects of pesticide. Comp. Biochem. Physiol. C. 147, Keppler, D. nd Decker, K. (1974). Glycogen determintion with myloglucosidse. In: Methods of Enzymtic Anlysis. Bergmeyer, H.U. (ed.) New York: Acdemic Press, p Kirschum, C., Gonzlez Bono, E., Rohleder, N., Gessner, C., Pirke, K.M., Slvdor, A., nd Hellhmmer, D.H. (1997). Effects of fsting nd glucose lod on free cortisol responses to stress nd nicotine. J. Clin. Endocrinol. Met. 82, Mrty, N., Dllport, M., nd Thorens, B. (2007). Brin glucose sensing, counteregultion, nd energy homeostsis. Physiology 22, Mitro, N., Mk, P.A., Vrgs, L., Godio, C., Hmpton, E., Molteni, V., Kreusch, A., nd Sez, E. (2007). The nucler receptor LXR is glucose sensor. Nture 445, Mommsen, T.P., Vijyn, M.M., nd Moon, T.W. (1999). Cortisol in teleosts: dynmics, mechnisms of ction, nd metolic regultion. Re.v Fish Biol. Fisheries 9, Nkgw, Y., Ngsw, M., Ymd, S., Hr, A., Mogmi, H., Nikolkev, V.O., Lohse, M.J., Shigemur, N., Ninomiy, Y., nd Kojim, I. (2009). Sweet tste receptor expressed in pncretic β-cells ctivtes the clcium nd cyclic AMP signling systems nd stimultes insulin secretion. PLoS ONE 4, Nielsen, M.E., Boesgrd, L., Sweeting, R.M., Rosenkilde, P., nd McKeown, B.A. (1994). Plsm levels of lctte, potssium, glucose, cortisol, growth hormone nd triiodo-lthyronine in rinow trout (Oncorhynchus mykiss) during exercise t vrious levels for 24h. Cn. J. Zool. 72, Pyne, A.H. nd Hles, D.B. (2004). Overview of steroidogenic enzymes in the pthwy from cholesterol to ctive steroid hormones. Endocr. Rev. 25, Pfffl, M.W. (2001). A new mthemticl model for reltive quntifiction in rel-time RT- PCR. Nucleic Acids Res 29, e45. Piskuric, N.A., Brown, S.T., Zhng, M., nd Nurse, C.A. (2008). Glucosensing in n immortlized drenomedullry chromffin cell line: role of ATP-sensitive K + chnnels. Neurosci. Lett. 445, Polkof, S., Míguez, J.M., Moon, T.W., nd Soengs, J.L. (2007). Evidence for the presence of glucosensor in hypothlmus, hindrin, nd Brockmnn odies of rinow trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 292, R1657-R1666. Polkof, S., Míguez, J.M., nd Soengs, J.L. (2007). In vitro evidences for glucosensing cpcity nd mechnisms in hypothlmus, hindrin, nd Brockmnn odies of rinow trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 293, R1410-R1420. Polkof, S., Míguez, J.M., nd Soengs, J.L. (2008). Chnges in food intke nd glucosensing function of hypothlmus nd hindrin in rinow trout sujected to hyperglycemic or hypoglycemic conditions. J. Comp. Physiol. A. 194, Polkof, S., Míguez, J.M., nd Soengs, J.L. (2008). Dietry crohydrtes induce chnges in glucosensing cpcity nd food intke in rinow trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 295, R478-R489. Polkof, S., Pnsert, S., Plgnes-Jun, E., nd Soengs, J.L. (2008c). Altered dietry crohydrtes significntly ffect gene expression of the mjor glucosensing components in Brockmnnn odies nd hypothlmus of rinow trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 295, R1077-R
22 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Polkof, S., Álvrez, R., nd Soengs, J.L. (2010). Gut glucose metolism in rinow trout: implictions in glucose homeostsis nd glucosensing cpcity. Am. J. Physiol. Regul. Integr. Comp. Physiol. 299, R19-R32. Polkof, S., Mommsen, T.P., nd Soengs, J.L. (2011). Glucosensing nd glucose homeostsis: from fish to mmmls. Comp. Biochem. Physiol. B. 160, Pottinger, T.G., Rnd-Wever, M., nd Sumpter, J.P. (2003). Overwintering fsting nd refeeding in rinow trout: plsm growth hormone nd cortisol levels in reltion to energy moilistion. Comp. Biochem. Physiol. B. 136, Powers, J.W., Mzilu, J.K., Lin, S., nd McCe, E.R.B. (2010). The effects of hyperglycemi on drenl cortex function nd steroidogenesis in the zerfish. Mol. Gen. Met. 101, Soengs, J.L. nd Moon, T.W. (1995). Uptke nd metolism of glucose, lnine nd lctte y red lood cells of the Americn eel Anguill rostrt. J. Exp. Biol. 198, Soengs, J.L. nd Moon, T.W. (1998). Trnsport nd metolism of glucose in isolted enterocytes of the lck ullhed Ictlurus mels: Effects of diet nd hormones. J. Exp. Biol. 201, Wendelr Bong, S.E. (1997). The stress response in fish. Physiol. Rev. 77,
23 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Tle 1. Nucleotide sequences of the PCR primers used to evlute mrna undnce y RT-PCR (qpcr) Forwrd primer Reverse primer Anneling temperture ( C) EF1α GGG CAA GGG CTC TTTCAA GT CGC AAT CAG CCT GAG AGGT 60 GK GCACGGCTGAGATGCTCTTTG GCCTTGAACCCTTTGGTCCAG 60 GLUT-2 GTGGAGAAGGAGGCGCAAGT GCCACCGACACCATGGTAAA 59 Gnt3 GCAAGACGTGCTGAGGACCA ATGGCGGTGACTCCCTCAAA 60 3βHSD TCACAGGGTCAACGTCAAAG CCTCCTTCTTGGTCTTGCTG 56 11βH ATTTGCCCTGTACGAGTTGG GGATGATGATGTCTCTGACTG 56 Kir6.x-like TTGGCTCCTCTTCGCCATGT AAAGCCGATGGTCACCTGGA 60 LXR TGCAGCAGCCGTATGTGGA GCGGCGGGAGCTTCTTGTC 62 P450scc ATGCGTCAGGACACTAACAC CAGCGGTATCATCTTCAGCA 56 SGLT-1 GGGCTGAACATCTACCTTGCT CTCATAACCTCCCACCTCATTG 59 StAR CTCCTACAGACATATGAGGAAC GCCTCCTCTCCCTGCTTCAC 56 SUR-like CGAGGACTGGCCCCAGCA GACTTTCCACTTCCTGTGCGTCC 62 EF1α, elongtion fctor 1α; GK, glucokinse; GLUT-2, glucose fcilittive trnsporter type 2; Gnt3, gustducin, 3βHSD, 3β-hydroxysteroid dehydrogense; 11βH, 11β-hydroxylse; Kir6.x-like, inwrd rectifier K + chnnel pore type 6.-like; LXR, liver X receptor; P450scc, cytochrome P450 cholesterol side chin clevge; SGLT-1, sodiumglucose linked trnsporter type 1; StAR, steroidogenic cute regultory protein; SUR-like, sulfonylure receptorlike 23
24 Tle 2. P-vlues otined fter three-wy nlysis of vrince of prmeters ssessed in hed kidneys of rinow trout in experiment 3. Time (10, 30, nd 60 min), ACTH (presence nd sence), nd glucose concentrtion (2, 4, nd 8 mm) were the min fctors. Glucose x time, Glucose x ACTH, nd Time x ACTH re the first order interctions. Glucose x ACTH x Time is the second order interction. All vlues re significntly different unless noted y dsh. The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Prmeter Time ACTH Glucose Glucose Time Glucose x ACTH Time x ACTH Glucose x ACTH x Time Cortisol metolism Cortisol levels < < StAR mrna P450scc mrna βHSD mrna βH mrna < Glucosensing Glucose < <0.001 Gycogen GK ctivity < GSse ctivity < PK ctivity GK mrna GLUT-2 mrna < Kir6.x-like mrna < SUR-like mrna SGLT-1 mrna < LXR mrna Gnt-3 mrna <
25 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Tle 3. Averge vlues of cortisol levels relesed to the incution medium, prmeters relted to cortisol metolism, nd prmeters relted to glucosensing medited y GK in hed kidneys of rinow trout incuted 10, 30 nd 60 min t 15 C in modified Hnks medium contining 8 mm D-glucose lone (Control) or in the presence of 3.3.x10-7 M ACTH or in the presence of 3.3.x10-7 M ACTH nd 10 µm cytochlsin B. Results re shown s % of control vlues (control = 100%). Ech vlue is the men ± S.E.M. of 8 (cortisol) or 4 (remining prmeters) independent experiments crried out with pools of hed kidneys from 3-4 different fish. Different letters indicte significnt differences (P<0.05) mong tretments. Prmeter Control ACTH ACTH + cytochlsin B Cortisol levels ± ± ± 7.73 Cortisol metolism StAR mrna ± ± ± 12.9 P450scc mrna ± ± ± βHSD mrna ± ± ± βH mrna ± ± ± Glucosensing Glucose levels ± ± ± 3.19 Gycogen levels ± ± ± 5.55 GK ctivity ± ± ± 5.99 GSse ctivity ± ± ± 3.16 PK ctivity ± ± ± 6.79 GK mrna ± ± ± 12.1 GLUT-2 mrna ± ± ± 11.9 Kir6.x-like mrna ± ± ± 12.3 SUR-like mrna ± ± ±
26 Figure legends Fig. 1. Time course of cortisol levels (A) nd re under curve (AUC) of the time course of cortisol levels (B) relesed to the incution medium y hed kidneys of rinow trout superfused t 15 C in modified Hnks medium contining 2, 4 or 8 mm D-glucose lone or in the presence for 20 min (fter 150 min preincution) of 3.3.x10-7 M ACTH. Ech vlue is the men + S.E.M. of 8 independent experiments. % sl levels re the verge cortisol levels mesured in the incution medi once the superfusion ecme stilized (in the intervl time etween 120 nd 150 min). In B pnel: different letters indicte significnt differences (P<0.05) mong glucose concentrtion within ech tretment; *, Significntly different from group without ACTH t the sme glucose concentrtion The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Fig. 2. Time course of cortisol levels relesed to the incution medium y hed kidney slices of rinow trout incuted t 15 C in modified Hnks medium contining 2, 4 or 8 mm D- glucose lone (No ACTH) or in the presence of 3.3.x10-7 M ACTH. Ech vlue is the men + S.E.M. of 4 independent experiments. Comprisons mong groups were crried out using threewy ANOVA with glucose concentrtion, presence/sence of ACTH, nd time s min fctors. Only in those cses where significnt effect ws noted post-hoc comprisons were crried out y Student-Newmn-Keuls test. *, Significntly different from group incuted without ACTH t the sme time nd glucose concentrtion. Different letters indicte significnt differences (P<0.05) mong smpling times within ech glucose concentrtion., Significntly different from group incuted with 2 mm glucose t the sme smpling time (P<0.05); $, significntly different from group incuted with 4 mm glucose t the sme smpling time (P<0.05). Fig. 3. Time course of mrna undnce of StAR (A), P450scc (B), 3βHSD (C), nd 11βH (D) in hed kidney slices of rinow trout incuted t 15 C in modified Hnks medium contining 2, 4 or 8 mm D-glucose lone (No ACTH) or in the presence of 3.3.x10-7 M ACTH. Ech vlue is the men + S.E.M. of 4 independent experiments. Differences in mrna levels etween tretments re presented s n x-fold-chnge with respect to 2 mm glucose control (no ACTH) t 10 min. Expression results were normlised to EF1α mrna levels (mrna levels-no vrition). Further detils s in legend of Fig. 2. Fig. 4. Time course of levels of glucose (A), nd glycogen (B) in hed kidney slices of rinow trout incuted t 15 C in modified Hnks medium contining 2, 4 or 8 mm D-glucose lone (No ACTH) or in the presence of 3.3.x10-7 M ACTH. Ech vlue is the men + S.E.M. of 4 independent experiments. Further detils s in legend of Fig. 2. Fig. 5. Time course of the ctivities of GK (A), GSse (B), nd PK (C) in hed kidney slices of rinow trout incuted t 15 C in modified Hnks medium contining 2, 4 or 8 mm D- glucose lone (No ACTH) or in the presence of 3.3.x10-7 M ACTH. Ech vlue is the men + S.E.M. of 4 independent experiments. Further detils s in legend of Fig. 2. Fig. 6. Time course of mrna undnce of GK (A), GLUT-2 (B), Kir6.x-like (C), nd SURlike (D) in hed kidney slices of rinow trout incuted t 15 C in modified Hnks medium contining 2, 4 or 8 mm D-glucose lone (No ACTH) or in the presence of 3.3.x10-7 M ACTH. Ech vlue is the men + S.E.M. of 4 independent experiments. Differences in mrna levels etween tretments re presented s n x-fold-chnge with respect to 2 mm glucose control (no ACTH) t 10 min. Expression results were normlised to EF1α mrna levels (mrna levels-no vrition). Further detils s in legend of Fig
27 Fig. 7. Time course of mrna undnce of SGLT-1 (A), LXR (B), nd Gnt3 (C) in hed kidney slices of rinow trout incuted t 15 C in modified Hnks medium contining 2, 4 or 8 mm D-glucose lone (No ACTH) or in the presence of 3.3.x10-7 M ACTH. Ech vlue is the men + S.E.M. of 4 independent experiments. Differences in mrna levels etween tretments re presented s n x-fold-chnge with respect to 2 mm glucose control (no ACTH) t 10 min. Expression results were normlised to EF1α mrna levels (mrna levels-no vrition). Further detils s in legend of Fig. 2. The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Fig. 8. Histologicl sections of rinow trout hed kidney stined with H-E. The interrenl tissue is esily recognizle to e rrnged in groups or cords (A, B). The interrenl cells re positive for GK (C, D) nd SGLT-1 (E). The GK-ir lines the wll of the lood vessel (E). The chromffin cells re identified y the positive rection for TH (F). Dispersed in the hed kidney there re smll gngli nd nerve fiers lso TH-inmunorrectives (TH-ir) (results not shown). CC: chromffin cells. IE: interrenl tissue. M: melno-mcrophges. RT: renl tissue. V: lood vessel. Scle rs: 100 μm (A); 25 μm (B); 50 μm (C-F) Fig. 9. Confocl photomicrogrphs of selected doule leled sections of rinow trout hed kidney showing the distriution/colocliztion of SGLT1/TH (A-C), GK/TH (D-F) nd SGLT- 1/GK (G-I) immunorectivity. Cells showing colocliztion SGLT-1/TH nd SGLT-1/GK pper in yellow. Note in green the intense GK-ir cells in the renl tuule; these cells re lso SGLT-1-ir (results not shown). Scle rs: 25 μm 27
28 Cortisol (% sl levels) A ACTH ACTH 2 mm glucose 4 mm glucose 8 mm glucose 2 mm glucose+acth 4 mm glucose+acth 8 mm glucose+acth The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT AUC B * Time (min) * No ACTH ACTH * [Glucose] (mm) Fig.1. Conde-Sieir et l. 28
29 A Cortisol (ng.ml -1 ) NO ACTH ACTH * * [Glucose] (mm) [Glucose] (mm) [Glucose] (mm) Fig.2 Conde-Sieir et l. The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT 10 MIN * $ 30 MIN 60 MIN 0 29
30 A 8 NO ACTH ACTH 10 MIN 30 MIN 60 MIN StAR (reltive mrna undnce) * $ $ c B 8 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT P450scc (reltive mrna undnce) C 3βHSD (reltive mrna undnce) D 11βH (reltive mrna undnce) * $ * $ * * * $ * $ c * $ * $ $ [Glucose] (mm) [Glucose] (mm) [Glucose] (mm) Fig.3 Conde-Sieir et l. 30
31 A Glucose (μmol.g -1 wet weight) NO ACTH ACTH * $ * 10 MIN 30 MIN 60 MIN $ $ * $ $ $ B The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT Glycogen (μmol.glycosil units.g -1 wet weight) $ [Glucose] (mm) [Glucose] (mm) [Glucose] (mm) Fig.4 Conde-Sieir et l. 31
32 A GK ctivity (mu.mg -1 protein) NO ACTH ACTH 10 MIN 30 MIN 60 MIN $ B 25 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT GSse ctivity (mu.mg -1 protein) PK ctivity (mu.mg -1 protein) C $ c [Glucose] (mm) [Glucose] (mm) [Glucose] (mm) Fig.5 Conde-Sieir et l. 32
33 A GK (reltive mrna undnce) NO ACTH ACTH 10 MIN 30 MIN 60 MIN $ $ $ $ 0 B 15 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT GLUT-2 (reltive mrna undnce) Kir6.x-like (reltive mrna undnce) C D SUR-like (reltive mrna undnce) c * * * * * [Glucose] (mm) [Glucose] (mm) [Glucose] (mm) Fig.6 Conde-Sieir et l. 33
34 A SGLT-1 (reltive mrna undnce) NO ACTH ACTH * 10 MIN 30 MIN c 60 MIN $ * B 2.0 The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT LXR (reltive mrna undnce) C Gnt 3 (reltive mrna undnce) c [Glucose] (mm) [Glucose] (mm) [Glucose] (mm) Fig.7 Conde-Sieir et l. 34
35 A M B RT IE IE V V The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT C E IE V IE GK V D F M CC V IE GK SGLT-1 TH Fig. 8 Conde-Sieir et l 35
36 A B C SGLT-1 TH SGLT-1/TH The Journl of Experimentl Biology ACCEPTED AUTHOR MANUSCRIPT D E F GK TH GK/TH G H I SGLT-1 GK SGLT-1/GK Fig. 9 Conde-Sieir et l 36
RESEARCH ARTICLE ACTH-stimulated cortisol release from head kidney of rainbow trout is modulated by glucose concentration
55 The Journl of Experimentl iology 6, 55-567. Pulished y The Compny of iologists Ltd doi:./je.7655 RESERCH RTICLE -stimulted cortisol relese from hed kidney of rinow trout is modulted y glucose concentrtion
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationStress inhibition of melatonin synthesis in the pineal organ of rainbow trout (Oncorhynchus mykiss) is mediated by cortisol.
First posted online on 16 Jnury 2014 s 10.1242/je.087916 J Exp Biol Advnce Access Online the most Articles. recent version First t posted http://je.iologists.org/lookup/doi/10.1242/je.087916 online on
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationEffects of Sini San used alone and in combination with fluoxetine on central and peripheral 5-HT levels in a rat model of depression
Online Sumissions:http://www.journltcm.com J Trdit Chin Med 2013 Octoer 15; 33(5): 674-681 info@journltcm.com ISSN 0255-2922 2013 JTCM. All rights reserved. EXPERIMENTAL STUDY TOPIC Effects of Sini Sn
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationSupporting Information
Supporting Informtion Yun et l. 1.173/pns.1523236113 SI Mterils nd Methods Humn Sujects. All prticipnts in our study were recruited from the Center for Reproductive Medicine, Shndong Provincil Hospitl
More informationAgilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide
Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationChapter 5: The peripheral nervous system Learning activity suggested answers
Chpter 5: The peripherl nervous system Lerning ctivity suggested nswers Lerning Activity 5.1 (p. 222) 1 Briefly descrie the two min functions of the somtic nervous system. Description should refer to:
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationIGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line
originl rticle http://www.kidney-interntionl.org & 27 Interntionl Society of Nephrology IGF-1 vs insulin: Respective roles in modulting sodium trnsport vi the PI-3 kinse/sgk1 pthwy in corticl collecting
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationARTICLE. J. E. Bowe & A. Chander & B. Liu & S. J. Persaud & P. M. Jones
Dietologi (23) 56:783 79 DOI.7/s25-2-2828-2 ARTICLE The permissive effects of glucose on receptor-operted potentition of insulin secretion from mouse islets: role for ERK/2 ctivtion nd cytoskeletl remodelling
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationEvidence for facilitated lactate uptake in lizard skeletal muscle
The Journl of Experimentl Biology 24, 499 46 (2) Printed in Gret Britin The Compny of Biologists Limited 2 JEB3537 499 Evidence for fcilitted lctte uptke in lizrd skeletl muscle E. R. Donovn* nd T. T.
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationESM Table 1. Characterisation of the human non-diabetic cohort used for MRIbased assessment of pancreatic fat and insulin secretion via OGTT.
ESM Tle 1. Chrcteristion of the humn non-dietic cohort used for MRIsed ssessment of pncretic ft nd insulin secretion vi OGTT. Trit sex Medin (IQR) 86 femles, 5 mles ge (yers) 4.4 (.5-5.57) BMI (kg/m²).62
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationIrs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling
Irs-2 coordintes Igf-1 receptor-medited β-cell development nd peripherl insulin signlling Dominic J. Withers 1,2 *, Deorh J. Burks 1 *, Hether H. Towery 1, Shri L. Altmuro 1, Crrie L. Flint 1 & Morris
More informationSupporting Information. In Situ Supramolecular Assembly and Modular Modification of Hyaluronic Acid Hydrogels for 3D Cellular Engineering
Supporting Informtion In Situ Suprmoleculr Assemly nd Modulr Modifiction of Hyluronic Acid Hydrogels for 3D Cellulr Engineering Kyeng Min Prk,, Jeong-A Yng,, Hyunte Jung, c Junseok Yeom, Ji Sun Prk, d
More informationARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,
DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,
More informationAccepted 10 January 2006
The Journl of Experimentl Biology 9, - Pulished y The Compny of Biologists doi:./je. Glycerol production in rinow smelt (Osmerus mordx) my e triggered y low temperture lone nd is ssocited with the ctivtion
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationRelationship between food availability, glycerol and glycogen levels in lowtemperature challenged rainbow smelt Osmerus mordax
866 The Journl of Experimentl Biology, 866-87 Published by The Compny of Biologists 7 doi:.4/jeb.749 Reltionship between food vilbility, glycerol nd glycogen levels in lowtemperture chllenged rinbow smelt
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationAccepted 1 November 2006
149 The Journl of Experimentl Biology 21, 149-165 Pulished y The Compny of Biologists 27 doi:1.1242/je.2628 Chnges in mitochondril oxidtive cpcities during therml cclimtion of rinow trout Oncorhynchus
More informationPreliminary investigation of antimicrobial effects of pomegranate (Punica granatum L.) leathery exocarp extract against some serious phytopathogens
Preliminry investigtion of ntimicroil effects of pomegrnte (Punic grntum L.) lethery exocrp extrct ginst some serious phytopthogens Elshfie H.S. 1,*, Skr S.H. 2, Mng S.M. 1, Frisullo S. 3, Cmele I. 1 1
More informationHow adaptations of substrate utilization regulate body composition
(27) 1 6 & 27 Nture Pulishing Group All rights reserved 37-565/7 $3. www.nture.com/ijo ORIGINAL ARTICLE How dpttions of sustrte utiliztion regulte ody composition KD Hll, HL Bin nd CC Chow Lortory of Biologicl
More informationFuel use during glycogenesis in rainbow trout (Oncorhynchus mykiss Walbaum) white muscle studied in vitro
871 The Journl of Experimentl Biology 29, 871-88 Pulished y The Compny of Biologists 26 doi:1.1242/je.271 Fuel use during glycogenesis in rinow trout (Oncorhynchus mykiss Wlum) white muscle studied in
More informationEffect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows
Ksetsrt J. (Nt. Sci.) 37 : 145-149 (2003) Effect of Orl Administrtion of Propylene Glycol on Serum Glucose Concentrtions in Periprturient Diry Cows Theer Rukkwmsuk, Nrongpol Petploi, Ing-orn Preechnvinit,
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationAltered adrenal gland cholesterol metabolism in the apoe-deficient mouse
Altered drenl glnd cholesterol metolism in the poe-deficient mouse Fynne E. Thorngte,* Penelope A. Strockine,* Sndr K. Erickson, nd Dvid L. Willims 1, * Deprtment of Phrmcologicl Sciences,* University
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationOptimizing Metam Sodium Fumigation in Fine-Textured Soils
Optimizing Metm Sodium Fumigtion in Fine-Textured Soils Neil C Gudmestd University Distinguished Professor & Endowed Chir of Potto Pthology Deprtment of Plnt Pthology North Dkot Stte University Erly Dying
More informationMethamphetamine causes anorexia in Drosophila melanogaster, exhausting metabolic reserves and contributing to mortality
The Journl of Toxicologicl Sciences (J. Toxicol. Sci.) Vol.37, No.4, 773-79, 212 773 Originl Article Methmphetmine cuses norexi in Drosophil melnogster, exhusting metolic reserves nd contriuting to mortlity
More informationNot for Citation or Publication Without Consent of the Author
Not for Cittion or Puliction Without Consent of the Author AN AUTOMATED SEX PHEROMONE TRAP FOR MONITORING ADULT CM AND OFM AND THE INFLUENCE OF TRAP COLOR ON MOTH AND NON-TARGET CAPTURES Brin L. Lehmn
More informationPhysiology & Behavior
Physiology & Behvior 1 (1) 376 387 Contents lists ville t SciVerse ScienceDirect Physiology & Behvior journl homepge: www.elsevier.com/locte/ph Physiologicl nd ehviorl responses to intermittent strvtion
More informationResponses of skeletal muscle lipid metabolism in rat gastrocnemius to hypothyroidism and iodothyronine administration: a putative role for FAT/CD36
Am J Physiol Endocrinol Met 33: E1222 E1233, 212. First pulished Septemer 11, 212; doi:1.1152/jpendo.37.212. Responses of skeletl muscle lipid metolism in rt gstrocnemius to hypothyroidism nd iodothyronine
More informationMarcos A. López-Patiño, Arnau Rodríguez-Illamola, Manuel Gesto, José L. Soengas and Jesús M. Míguez*
928 The Journl of Experimentl Biology 214, 928-936 211. Pulished y The Compny of Biologists Ltd doi:1.1242/je.51516 RESEARCH ARTICLE Chnges in plsm meltonin levels nd pinel orgn meltonin synthesis following
More informationLow levels of extracellular glucose limit cardiac anaerobic metabolism in some species of fish
17. Pulished y The Compny of iologists Ltd Journl of Experimentl iology (17), 97-979 doi:1.14/je.15958 RESEARCH ARTICLE Low levels of extrcellulr glucose limit crdic neroic metolism in some species of
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationFOOD-DEPRIVATION AFFECTS SEAWATER ACCLIMATION IN TILAPIA: HORMONAL AND METABOLIC CHANGES
The Journl of Experimentl Biology 199, 7 75 (199) Printed in Gret Britin The Compny of Biologists Limited 199 JEB1 7 FOOD-DEPRIVATION AFFECTS SEAWATER ACCLIMATION IN TILAPIA: HORMONAL AND METABOLIC CHANGES
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationBritish Journal of Nutrition
British Journl of Nutrition (215), 113, 1862 1875 q The Authors 215 doi:1.117/s7114515121x Anormlities in myo-inositol metolism ssocited with type 2 dietes in mice fed high-ft diet: enefits of dietry myo-inositol
More informationAbstract. Introduction. V.I. Lushchak 1,*, T.V. Bagnyukova 1,*, J.M. Storey 2 and K.B. Storey 2
Brzilin Journl of Medicl nd Biologicl Reserch (2001) 34: 1055-1064 Effect of exercise on glycolytic enzymes in fish tissues ISSN 0100-879X 1055 Influence of exercise on the ctivity nd the distriution etween
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationInnate immune response to a H3N2 subtype swine influenza virus in newborn porcine trachea cells, alveolar macrophages, and precision-cut lung slices
Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 VETERINARY RESEARCH RESEARCH Open Access Innte immune response to H3N2 sutype swine influenz virus in neworn porcine trche cells, lveolr mcrophges, nd precision-cut
More informationAlex M. Zimmer C. Michele Nawata Chris M. Wood. than Na? influx itself, is critical to the facilitation of ammonia excretion.
DOI 10.1007/s00360-010-0488-4 ORIGINAL PAPER Physiologicl nd moleculr nlysis of the interctive effects of feeding nd high environmentl mmoni on rnchil mmoni excretion nd N + uptke in freshwter rinow trout
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationEffects of Dietary Protein and Energy on Growth Performance and Carcass Characteristics of Betong Chickens (Gallus domesticus) During Growing Period
Interntionl Journl of Poultry Science 9 (5): 468-472, 2010 ISSN 1682-8356 Asin Network for Scientific Informtion, 2010 Effects of Dietry Protein nd Energy on Growth Performnce nd Crcss Chrcteristics of
More information