Research Article Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice
|
|
- Rodney McKenzie
- 6 years ago
- Views:
Transcription
1 Hindwi Pulishing Corportion Evidene-Bsed Complementry nd Alterntive Mediine, Artile ID , 14 pges eserh Artile Deffeinted Green Coffee Ben Extrt Attenutes Diet-Indued Oesity nd Insulin esistne in Mie Su Jin Song, Sen Choi, nd Tesun Prk Deprtment of ood nd Nutrition, Brin Kore 21 PLUS Projet, Yonsei University, 5 Yonsei-ro, Seodemun-gu, Seoul , epuli of Kore Correspondene should e ddressed to Tesun Prk; tsprk@yonsei..kr eeived 16 Deemer 213; Aepted 2 Mrh 214; Pulished 9 April 214 Ademi Editor: virjsinh Jdej Copyright 214 Su Jin Song et l. This is n open ess rtile distriuted under the Cretive Commons Attriution Liense, whih permits unrestrited use, distriution, nd reprodution in ny medium, provided the originl work is properly ited. This study investigted whether deffeinted green offee en extrt prevents oesity nd improves insulin resistne nd eluidted its mehnism of tion. Mle C57BL/6N mie (N = 48) were divided into six dietry groups: how diet, HD, HD-supplemented with.1%,.3%, nd.9% deffeinted green offee en extrt, nd.15% 5-ffeoylquini id. Bsed on the redution in HD-indued ody weight gin nd inrements in plsm lipids, gluose, nd insulin levels, the minimum effetive dose of green offee en extrt ppers to e.3%. Green offee en extrt resulted in downregultion of genes involved in WNT1- nd glnin-medited dipogenesis nd TL4-medited proinflmmtory pthwy nd stimultion of GLUT4 trnslotion to the plsm memrne in white dipose tissue. Tken together, deffeinted green offee en extrt ppered to reverse HD-indued ft umultion nd insulin resistne y downregulting the genes involved in dipogenesis nd inflmmtion in viserl dipose tissue. 1. Introdution Coffee is one of the most widely onsumed everges in the world, nd therefore the potentil helth onsequenes of offee onsumption re of gret puli interest. Hevy offee drinking my result in sleep disorders, hypoklemi, nd rdi rrhythmis [1 4]. At the sme time, severl epidemiologi studies hve reported tht the risk of Prkinson s disese, Alzheimer s disese, nd ertin types of ner is redued in regulr offee onsumers [5]. In ddition, offee hs reently reeived sientifi ttention s urrent epidemiologi nd in vivo studies hve reveled its helth enefits ginst oesity nd metoli disorders, espeilly type 2 dietes [6 1]. These helth dvntges re mostly derived from hlorogeni ids ontined in offee ens [11 14]. Adipogenesis is proess of mesenhyml preursor ells differentiting into dipoytes where peroxisome prolifertor-tivted reeptor γ2 (PPAγ2) nd CCAAT/ enhner-inding protein α (C/EBPα) re the mster trnsriptionl regultors [1, 15]. Downstrem trgets for PPAγ2 inlude dipoyte lipid inding protein (P2), luster of differentition 36 (36), lipoprotein lipse (LPL), nd ftty id synthse (AS), whih together indue lipid umultion nd metolism. Thus, intivtion of these dipogeni regultors my e novel wy to suppress dipogenesis nd ultimtely prevent oesity. Anotherritilspetofdiposetissueisthtitservess n endorine orgn, relesing iologilly tive dipokines. Toll-like reeptor (TL) 2 nd TL4 indue the expression of lrge numer of proinflmmtory trget genes. It ws reently disovered tht TL4 n sense free ftty ids (As) engging proinflmmtory pthwys tht led to seretion of ytokines [16]. urthermore, severl studies hve demonstrted ustive reltionship etween inflmmtion nd insulin resistne [17]. JNK, espeilly, serves s min meditor tht leds to insulin resistne y impiring GLUT4 trnslotion. Thus, reduing the A level in lood nd peripherl tissues suh s the dipose tissue nd musles might result in therpeuti effets ginst oesity y ttenuting not only dipogenesis ut lso inflmmtion nd insulin resistne.
2 2 Evidene-Bsed Complementry nd Alterntive Mediine w offee ens re rih in hlorogeni ids nd ffeine, nd their ontents in offee ens re signifintly deresed during the rosting nd deffeintion proesses [18]. Green offee en extrt used in the present study is prepred from deffeinted nd unrosted offee ens, mking it novel soure of hlorogeni ids nd eliminting the possile side effets of ffeine [1 3]. There is no report on toxiologil studies on green offee en extrt. In linil tril, deffeinted green offee en extrt indued weight loss in overweight volunteers, provided with 4 mg/dy for 6 dys [19]. Yet, further investigtion on toxi dose of green offee en extrt is required in niml models. Cho et l. reveled tht 5-ffeoylquini id (CQA), representtive hlorogeni id in green offee ens, exhiits ntioesity properties in mie fed HD [12]. Another study reported tht deffeinted green offee en extrt, delivered through drinking wter for 2 weeks, signifintly improved HD-indued insulin resistne in mie; however, the dose delivered to mie ws not lerly indited nd its moleulr mehnism on improving insulin sensitivity hs not een exmined [1]. Also, the ntioesity effet of deffeinted green offee en extrt hs not yet een reported in HD-indued oese mie. Therefore, the ims of this study were to investigte whether deffeinted green offee en extrt exerts protetive effets ginst viserl oesity nd insulinresistneinmiefedhdndtoevlutewhether these effets re derived from 5-CQA. urthermore, we explored the potentil moleulr mehnisms of the helth enefits of deffeinted green offee en extrt, fousing on the gene expression involved in dipogenesis nd insulin resistne in white dipose tissue (WAT). 2. Mterils nd Methods 2.1. Extrtion nd HPLC Anlysis of Deffeinted Green Coffee Ben Extrt. The deffeinted green offee en extrt utilized for this study ws provided y Nturex In. (Avignon, rne) under the trde nme Svetol. Svetol ws otined y extrting deffeinted rw green offee (Coffe nephor roust) ens with 3% ethnol t 7 C for 2 h. To determine 5-CQA (IUPAC numering) ontent in deffeinted green offee en extrt, HPLC nlysis ws performedvisupeloc18olumn( mm, 5 μm inner dimeter) t 4 C with flow rte of 1.4 ml/min using grdient moile phse omposed of wter (A) nd etonitrile (B). The moile phse ws 95 : 5 mixture of omponents A nd B s the initil ondition of the hromtogrphy; the smple injetion volume ws 2 μl. The sorption spetrum of 5- CQA ws monitored t 33 nm using the photodiode rry detetor Animl Cre nd Experimentl Protool. orty-eight mle C57BL/6N mie (Orient, Gyeonggi-do, epuli of Kore) were housed in stndrd ges nd pled in room where the temperture ws mintined t 23 ± 1 C, reltive humidity t 5 ± 1%, nd the light t 12 h light/drk yle. During 1-week limtiztion period, ll mie onsumed ommeril diet nd tp wter d liitum. Afterwrds, they were divided into six weight-mthed groups (n =8): the how diet (), high-ft diet (HD),.1%,.3%, nd.9% green offee en extrt-supplemented diet (G), nd.15% 5-CQA-supplemented diet () groups (Sigm, MO, USA). The HD ws omposed of 2 g of ft/kg (17 g of lrd plus 3 g of orn oil) nd 1% (w/w) holesterol. The G ws identil to the HD, exept tht it inluded.1%,.3%, or.9% green offee en extrt. The ws lso identiltothehdexeptthtitontined.15%5-cqa. The diets were given in the form of pellets for eleven weeks. ood intke of the mie ws reorded dily nd their ody weights were mesured weekly during the feeding period. At the end of the experimentl period, the nimls were nesthetized with ether following 12 h fsting period. Blood smplesweredrwnfromthedominlortintonedtaoted tue, nd plsm smples were otined y entrifugtion t 1, g for15mint4 C. Viserl ft pds from four different regions (epididyml, perirenl, mesenteri, nd retroperitonel regions) were exised, rinsed with phosphteuffered sline (PBS), nd stored t 8 Cuntilnlysis. All niml experiments dhered to the Koren ood nd Drug Administrtion (KDA) guidelines. The protools were reviewed nd pproved y the Institutionl Animl Cre nd Use Committee (IACUC) of the Yonsei Lortory Animl eserh Center (YLAC) (Permit no ). All mie were mintined in the speifi pthogen-free fility of the YLAC Histologil Anlysis. The epididyml ft pds were fixed in neutrl uffered formlin nd emedded in prffin, setioned t thiknesses of 5 μm. The tissue setions were stined with hemtoxylin nd eosin (H&E) Biohemil Anlysis. The plsm onentrtions of triglyerides (TG), A, totl holesterol (TC), nd gluose were mesured enzymtilly using ommeril kits (Bio- Clinil System, Gyeonggi-do, epuli of Kore). Plsm leptin, diponetin, interleukin-6 (IL-6), monoyte hemottrtnt protein-1 (MCP-1), nd insulin levels were nlyzed using n ELISA kit (Millipore, MA, USA). The homeostsis model ssessment of sl insulin resistne (HOMA-I) ws used to lulte n index from the produt of the fsting onentrtions of plsm gluose (mmol/l) nd insulin (pmol/l) divided y Lower HOMA-I vlues indite greter insulin sensitivity nd higher HOMA-I vlues indite insulin resistne Orl Gluose Tolerne Test. An orl gluose tolerne test (OGTT; gvge with 2 g gluose/1 ml per kg ody weight) ws performed 2 weeks efore the end of the tretment on 18 h fsted mie y dministering gluose orlly. Bloodwsolletedfromthetilveint,15,3,6,9,nd 12 min following gluose dministrtion to determine lood gluose Semiquntittive everse Trnsriptse Polymerse Chin etion (T-PC). Totl NA ws isolted from the epididyml dipose tissue of eh mouse with Trizol (Invitrogen,
3 Evidene-Bsed Complementry nd Alterntive Mediine 3 CA, USA). Of the totl NA, 4 μl wsreverse-trnsried to DNA using the Supersript II kit (Invitrogen) ording to the mnufturer sinstrutions. Tle 1 shows the forwrd () nd reverse () primer sequenes. The PC proedure ws designed s follows: 1 min t 94 C, 3 35 yles t 94 C for 3 s, 55 Cfor3s,72 C for 1 min, nd 1 min of inution t 72 C. Next, 4 μl of eh PC retion mixture ws mixed with 1μL of 6-fold-onentrted loding uffer nd then loded onto 2% grose gel ontining ethidium romide. The mna levels were normlized to the glyerldehyde- 3-phosphte dehydrogense () mna levels, whih were used s n internl ontrol Western Blot Anlysis. The epididyml dipose tissues of eh mouse were homogenized in n extrtion uffer ontining 1 mm Tris-HCl, ph 7.4, 5 mm EDTA, 5 mm sodium pyrophosphte, 5 mm N, 1 mm orthovndte, 1% Triton X-1, 1 mm phenylmethnesulfonyl fluoride, 2 μg/ml protinin, 1 μg/ml pepsttin A, nd 1 μg/ml leupeptin. The tissue homogentes were entrifuged t 1,3 g for 2 min t 4 C. The protein onentrtions of the tissue extrts were mesured vi Brdford ssy (Bio-d, CA, USA). The protein smples were seprted y SDS-PAGE nd eletrophoretilly trnsferred to nitroellulose memrnes (Amershm, Bukinghmshire, UK). The smples were inuted overnight nd hyridized with primry ntiodies (diluted 1 : 1,) t 4 C. Antiodies to the following proteins were purhsed from the indited soures: βtenin, β-tin (Snt Cruz Biotehnology, CA, USA), -Jun N-terminl kinse (JNK), p-jnk (Tyr183), insulin reeptor sustrte (IS), p-is (Ser37), protein kinse B (AKT), p- AKT(Thr38),GLUT4,nd(CellSignlingTehnology, MA, USA). The memrnes were inuted with the orresponding seondry ntiody. Next, immunoretive signls were deteted vi hemiluminesent detetion system (Amershm, Bukinghmshire, UK) nd quntified using Quntity One nlysis softwre (Bio-d) Sttistil Anlysis. The dt on ody weight gin, plsm iohemistries, nd dipoyte dimeter is expressed s the men ± SEM of 8 mie. The T-PC nd Western dt re mens from n = 8± SEM of three independent experiments (n =2, 3 per experiment) for eh group. Dt were nlyzed y one-wy nlysis of vrine (ANOVA), followed y Dunn s multiple rnge tests. P vlues <.5 were onsidered sttistilly signifint. 3. esults 3.1. HPLC Anlysis of Deffeinted Green Coffee Ben Extrt. The extrtion yield of deffeinted green offee ens ws 15%. The HPLC nlysis (igure 1) reveled tht deffeinted green offee en extrt (Svetol) ontined 16.4% 5-CQA Body nd Viserl t-pd Weights. After 11 weeks of experimentl feeding, the finl ody weight gin ws dosedependently deresed in the.1g nd.3g groups (igure 2()). ood intke did not differ mong experimentl Norm. DAD1 A, sig =33,4 ref = off (hlorogeni id\ \ D) hlorogeni id (min) igure 1: The HPLC hromtogrm of deffeinted green offee en extrt. The pek ws ssigned sed on the isoltion of 5- CQA. groups during the 11-week feeding period (igure 2()), nd the food effiieny rtio (E) ws signifintly deresed in mie fed the.3g when ompred with mie fed the HD (igure 2()). The totl viserl ft-pd weight of mie fed the HD ws redued when the mie were supplemented with.3% green offee en extrt (igures 2(d) nd 2(e)). No further redution in ody weight gin nd viserl ft-pd weight ws noted in the.9g group. Moreover,.3% green offee en extrt deresed ody weight gin nd viserl diposity s muh s.15% 5-CQA did. Bsed on the results ove,.3% ppers to e the minimum effetive dose t whih green offee en extrt redues ody weight gin nd viserl ft-pd weight. Therefore, the histologil nlysis of epididyml dipose tissue setions y H&E stining ws done with the.3g group mong the green offee en extrt supplemented groups. The stining dt showed tht the verge dipoyte dimeter ws signifintly smller in the.3g nd groups when ompred with the HD group (igures 2(f) nd 2(g)) Plsm Biohemistries. Mie fed.3g exhiited signifintly lower levels of plsm lipids, leptin, nd ytokines nd signifintly higher levels of diponetin thn those fed HD(igure 3). Yet, mie fed.9g showed no further dereses in these plsm mesures. The hnges in plsm iomrkers relted to oesity nd inflmmtion tht ourred in the.3g group were similr to those oserved with the group Gluose Utiliztion nd Insulin Sensitivity. We investigted whether green offee en extrt influened insulin sensitivity. OGTT ws performed fter 9 weeks of diet supplementtion to determine the effet of green offee en extrtnd5-cqaongluosetolerneinhd-fedmie (igure 4()). Integrted plsm gluose onentrtion, s lulted y the re under the urve (AUC), ws signifintly redued in.3g-fed mie thn in HD-fed mie (igure 4()). Moreover,.3G-fed mie demonstrted similr redution level in the integrted gluose onentrtion s -fed mie did. urthermore, when fsting plsm gluose nd insulin levels were mesured t the end
4 4 Evidene-Bsed Complementry nd Alterntive Mediine Tle 1: Primer sequenes nd PC onditions. Gene desription Primers Sequenes (5-3 ) T m ( C) Size (p) CTTGGTGTCCTTGCGCTTTA SP CTGATGGCCTCATGGAACAG TCATTCCCTGTTCTTCAGCG DKK GCATTTCCTTCAGATTGGCA TTTTGGCCACTCCTCTTCCT WNT TCCTTTTCCAACCGAAAACC GAGCCTTGATCCTGCACTGA Glnin AGTGGCTGACAGGGTCACAA CCAAGGGGGTATCCCAGTAA Gl GGCCAAACACTACCAGCGTA ATAGTGGTGCTCATGCTGGAA Gl AGGCTGGATCGAGGGTTCTA CTGAGCGCTGCAAGAAGAAC PKCδ TGGAAACTTTGATCCTGCACTGA TGGGAAGTTTTGTTGGGTCA Cy-D TCCTTGTCCAGGTAATGCCA TTCGGAATCAGCTCTGTGGA PPAγ CCATTGGGTCAGCTCTTGTG AAGGCCAAGAAGTCGGTGGA C/EBPα CCATAGTGGAAGCCTGATGC TTGCCCGAGTCAGAGAACC AS CGTCCACAATAGCTTCATAGC CTCCAAGGTTGTCCAGGGTT Leptin AAAACTCCCCACACAATGGG ATGACGTGGCAAAGAACAGC GAAGGCTCAAAGATGCCTCC ACATGAAAGTGGGAGTG P AAGTACTCTCTGACCGGATG TCTAAAGTCGATCCGCGACAT TL TACCCAGCTCGCTCACTACGT ACCTCTGCCTTCACTACAGA TL AGGGACTTCTCAACCTTCTC TGTCTCAGCCTCTTCTCATT TNα AGATGATCTGAGTGTGAGGG CCAGCAAGATGATCCCAATG MCP CTTCTTGGGGTCAGCACAGA ATGGCTAGGCTCTGTGCTTTCCT INα GGGCTCTCCAGATTTCTGCTCTG CCACAGCCCTCTCCATCAACTATAAGC INβ AGCTCTTCAACTGGAGAGCAGTTGAGG TTGCCTTCTTGGGACTGATG IL CCACGATTTCCCAGAGAACA AGAACATCATCCCTGCATCC TCCACCACCCTGTTGCTGTA SP 5: sereted frizzled-relted protein 5; DKK2: Dikkopf 2; WNT1: wingless-type MMTV integrtion site fmily, memer 1B; Gl1: glnin reeptor 1; PKCδ: proteinkinsecdelt; Cy-D: ylind; PPAγ2: peroxisome prolifertor-tivted reeptor gmm; C/EBPα: CCAAT/enhner-inding protein, lph; AS: ftty id synthse; 36: ftty id trnslose; P2: dipoyte protein2; TL: Toll-like reeptor; TNα: tumor nerosis ftor lph; IN: interferon; MCP1: monoyte hemottrtnt protein 1; IL-6: interleukin-6; : gyerldehyde-3-phosphte dehydrogense.
5 Evidene-Bsed Complementry nd Alterntive Mediine Body weight gin (g/11 wks) ood intke (g/dy) E d HD HD HD G G G () () () HD.3G Epididyml Perirenl etroperitonel Mesenteri (d) 5 Viserl ft weight (g) d d d Epididyml Perirenl etroperitonel Mesenteri Totl.9G.3G.1G HD (e) HD.3G 12 Adipoyte dimeter (μm) 1 8 (f) 6 4 HD.3G (g) igure 2: Effets of green offee en extrt nd 5-CQA supplementtion on ody weight gin, food effiieny rtio (E), nd viserl ft-pd weights of mie fed HD. Mie were fed the experimentl diets for 11 weeks. () Body weight gin, () food intke, () E, ((d), (e)) viserl ft-pd weights, (f) representtive pitures of H&E-stined ft ells from mie epididyml dipose tissue ( 1), nd (g) densitometri nlysis of dipoyte dimeter in epididyml tissue. Dt represent men ± SEM, n=8. Men vlues indited with different letters indite sttistil signifine (P <.5). E = ody weight gin for experimentl period (g)/food intke for experimentl period (g). of the feeding period,.3g group exhiited signifint redutions in plsm gluose nd insulin levels in omprison to the HD group (igures 4() nd 2(d)). Along with the plsm gluose nd insulin levels, the HOMA-I vlues indited tht insulin sensitivity ws improved signifintly in.3g group (igure 4(e)). No further dereses in these mrkers relted to gluose utiliztion nd insulin sensitivity were shown in.9g-fed mie. The effet of.3g to derese plsm gluose nd insulin levels nd to improve insulin sensitivity ws quntittively similr to tht of Expression of Genes elted to Adipogenesis. We explored the potentil mehnisms y whih green offee en extrt
6 6 Evidene-Bsed Complementry nd Alterntive Mediine Triglyeride (mm) ree ftty id (meq/l) HD G 4. HD G () () Totl holesterol (mm) HD G e Leptin (ng/ml) d HD G () (d) Adiponetin (ng/ml) d e IL-6 (pg/ml) 7. HD G. HD G (e) (f) MCP-1 (pg/ml) HD G (g) igure 3: Effets of green offee en extrt nd 5-CQA supplementtion on plsm levels of lipids, leptin, diponetin, nd proinflmmtory ytokines in mie fed HD. () TG, () A, () TC, (d) leptin, (e) diponetin, (f) IL-6, nd (g) MCP-1. Brs represent men ± SEM, n=8. Men vlues indited with different letters indite sttistil signifine (P <.5). my ttenute HD-indued dipogenesis in the epididyml diposetissueof.3g-fedmie.wefoundthtgreenoffee en extrt deresed the expression of sereted frizzledreeptor protein 5 (SP5) nd dikkopf 2 (DKK2) nd inresed expression of wingless-type MMTV integrtion site fmily 1 (WNT1) (igure 5()). Western lot nlysis indited tht β-tenin levels were signifintly elevted y green offee en extrt supplementtion (igure 5()). urthermore, green offee en extrt signifintly redued mna levels of glnin, glnin reeptor (Gl) 1, Gl2, protein kinse C (PKC) δ, ndylin-d(igure 5()). As igure 5(d) demonstrtes, the mna levels of dipogeni trnsription ftors, PPAγ2 nd C/EBPα, were signifintlydownregultedinmiefedthegreenoffeeen
7 Evidene-Bsed Complementry nd Alterntive Mediine 7 Gluose (mmol/l) OGTT Time (min) d AUC (mmol/l h) HD G.1G.9G HD.3G () () Gluose (mmol/l) Insulin (ng/ml) 1. HD G (). HD G (d) HOMA-I (mmol/l) HD G (e) igure 4: Effet of green offee en extrt nd 5-CQA supplementtion on gluose utiliztion nd insulin sensitivity in mie fed HD. () OGTT; () AUC; () gluose; (d) insulin; (e) HOMA-I. Brs represent men ± SEM, n=8. Men vlues indited with different letters indite sttistil signifine (P <.5). extrtompredwiththoseinmiefedthehd.themna levels of key dipogeni genes suh s AS, leptin, 36, nd P2 were signifintly deresed in green offee en extrt supplemented groups (igure 5(d)). Moreover, these signifint hnges in the expression of dipogeni genes tht ourred in the.3g group were similr to those oserved in the group (igure 5(d)) Expression of Inflmmtion-elted Signling Moleules. We exmined the nti-inflmmtory effets of green offee en extrt in the epididyml dipose tissue of mie mintined on the HD. Gene expression of inflmmtory meditors suh s TL2 nd TL4 ws downregulted in.3gfedmiewhenompredwithhd-fedmie(igure 6()). urthermore, immunolot results indited tht JNK phosphoryltion in G-fed mie ourred signifintly less thn in HD-fed mie (igure 6()). The expression of proinflmmtory ytokines, inluding tumor nerosis ftor (TN) α, MCP-1, interferon (IN) α, INβ, nd IL-6, in Gfed mie ws signifintly downregulted in omprison
8 8 Evidene-Bsed Complementry nd Alterntive Mediine SP5 HD.3G DKK2 WNT1 β-ctenin HD.3G eltive gene expression β-ctenin/ SP5 DKK2 WNT1.2 HD.3G HD.3G HD.3G () () Glnin Gl1 Gl2 PKCδ Cy-D HD.3G eltive gene expression Glnin Gl1 Gl2 PKCδ Cy-D HD ().3G PPAγ2 C/EBPα AS Leptin 36 P2 HD.3G eltive gene expression PPAγ2 C/EBPα AS Leptin 36 P2 HD (d).3g igure 5: Effets of green offee en extrt nd 5-CQA supplementtion on genes regulting dipogenesis in mie fed the HD. () The expression of WNT1-relted genes in the epididyml dipose tissue ws determined y T-PC nd normlized to tht of. () Protein levels of β-tenin nd in the epididyml dipose tissue were determined y Western lotting. () nd (d) The expression of glnin-relted nd dipogeni trget genes in the epididyml dipose tissue ws determined y T-PC nd normlized to tht of. Dt represent the results of three independent experiments (n =2, 3 mie per experiment). P <.5 indites sttistil signifine. Vlues re the men ± SEM, n=8for eh group.
9 Evidene-Bsed Complementry nd Alterntive Mediine 9 TL2 HD.3G p-jnk HD.3G TL4 JNK eltive gene expression TL2 TL4 p-jnk/jnk (fold hnge versus ) HD.3G HD.3G HD.3G () () TNα MCP1 INα INβ IL-6 HD.3G eltive gene expression TNα MCP1 INα INβ IL-6 HD ().3G igure 6: Effets of green offee en extrt nd 5-CQA supplementtion on the expression of gene involved in inflmmtion in mie fed HD. () The expression of TL2 nd TL4 in epididyml dipose tissue ws determined y T-PC nd normlized to tht of. () Protein levels of p-jnk nd JNK in the epididyml dipose tissue were determined y Western lotting. () The expression of proinflmmtory ytokine genes in the epididyml dipose tissue ws determined y T-PC nd normlized to tht of. Dt represent the results of three independent experiments (n =2, 3 mie per experiment). P <.5 indites sttistil signifine. Vlues re the men ± SEM, n=8 for eh group. with those in HD-fed mie (igure 6()). These signifint hnges of gene expression relted to inflmmtion exhiited in.3g-fed mie were lso shown in -fed mie (igure 6). offee en extrt-fed mie when ompred with HD-fed mie (igure 7()). Moreover,.3G ws s effetive in improving insulin sensitivity nd enhning GLUT4 trnslotiontothememrnesws(igure 7) Expression of Genes elted to Insulin esistne. We evluted the protein levels of genes involved in insulin resistne in the epididyml ft tissue of.3g-fed mie. Western lot nlysis reveled tht phosphoryltion of IS-1 (Ser37) nd AKT (Thr38) ws signifintly deresed nd inresed, respetively, in G-fed mie when ompred to HD-fed mie (igures 7() nd 7()). The mount of GLUT4 found in the memrne frtion of the epididyml dipoytes ws signifintly inresed, wheres the mount of totl ellulr GLUT4 in ytosol remined the sme in green 4. Disussion In the present study, deffeinted green offee en extrt hs demonstrted signifint weight-lowering effet in HD-fed mie. Among the green offee en extrt dosges (.1%,.3%, nd.9%),.3% green offee en extrt ws proved to e the minimum effetive dose for preventing ody weight gin, ft umultion, nd insulin resistne in mie fed the HD for 11 weeks. No further dose-dependent dereses in ody weight gin, viserl ft-pd weights, nd
10 1 Evidene-Bsed Complementry nd Alterntive Mediine p-is1 (Ser37) HD.3G p-akt (Thr38) HD.3G IS1 AKT p-is1/totl IS p-akt/totl AKT HD.3G.4 HD.3G HD.3G HD.3G () () Glut4(M) β-atin Glut4(T) HD.3G eltive protein expression Glut4(M) Glut4(T) () HD.3G igure 7: Effets of green offee en extrt nd 5-CQA supplementtion on the proteins involved in GLUT4 trnslotion in mie fed HD. Protein levels of p-is1, p-akt, plsm memrne GLUT4, nd orresponding totl proteins in the epididyml dipose tissue were determined y Western lotting. Dt represent the results of three independent experiments (n = 2, 3 mie per experiment). P <.5 indites sttistil signifine. Vlues re the men ± SEM, n=8for eh group. plsm lipids nd gluose profiles were noted t.9% green offeeenextrtdosge.thedoseof.3%greenoffeeen extrt (3 mg green offee en extrt/kg diet) in mie orresponds to pproximtely 1,46 mg/6 kg ody weight inhumnwhenlultedonthesisofnormliztionto ody surfe re s reommended y egn-shw et l. [2]. In order to otin 1.46 mg of deffeinted green offee en extrt, 9.7 grms of deffeinted green offee ens is required s lulted from its extrtion yield of 15%. Aording to Moon, the ontent of totl hlorogeni ids is redued y pproximtely 9% in drk rosted ens [18]. This implies tht 1 times more drk rosted ens (97 grms) re required to produe similr weight-reduing effets s the deffeinted green offee ens. Green offee ens re rih soure of polyphenols, espeilly hlorogeni ids. Of vriety of hlorogeni ids, 5-CQAhseenknowntoprotettissuesfromoxidtive stress,modultegluosemetolism,ndmeditentioesity effet [12, 21, 22]. In the present study, 5-CQA ws the most undnt nd tive omponent ontined in green offee en extrt nd exerted signifint weight-lowering effet in HD-fed mie (igure 1). Bsed on our ssumption tht the ntioesity effet of deffeinted green offee en extrt ws expeted to e dose dependent nd e derived from 5-CQA, the dose of 5-CQA in ws hosen to mth the mount of 5-CQA ontined in the.9g (the highest dose of deffeinted green offee en extrt). Nevertheless, weight-suppressing nd insulin-sensitizing effets of green
11 Evidene-Bsed Complementry nd Alterntive Mediine 11 SP5 WNT1 DKK2 Glnin A A GLUT4 LP ZD Gl1 Gl2 TL2 TL4 P I IS1 (Ser37) β-ctenin PKCδ P JNK AKT P EK AP-1 GLUT4 vesile β-ctenin Trget genes β-ctenin AS TC LE Leptin 36 P2 PPAγ2 Adipogenesis Cy-D C/EBPα Nuleus AP-1 Inflmmtion GLUT4 trnslotion Trget genes TNα MCP1 INα INβ IL-6 HD G igure 8: The possile moleulr mehnisms of deffeinted green offee en extrt in ttenuting dipogenesis, inflmmtion, nd insulin resistne indued y HD. Deffeinted green offee en extrt reverses HD-indued hnges in expression of genes involved in WNT1- nd glnin-medited dipogenesis sdes in the epididyml dipose tissue. The downstrem dipogeni trnsription ftors (PPAγ2 ndc/ebpα) nd their trget genes were lso suppressed y deffeinted green offee en extrt in the epididyml dipose tissue. Deffeinted green offee en extrt reverses the HD-indued hnges in the expression of genes relted to TL2/4-medited proinflmmtory signling sdes nd proteins involved in GLUT4 trnslotion in the epididyml dipose tissue. offee en extrt plteued t.3% supplementtion. The.3G (ontining.5% 5-CQA) signifintly redued ody weight gin nd improved insulin sensitivity s muh s the (ontining.15% 5-CQA) did. This effet ould e possily due to other polyphenols ontined in green offee en extrt whih exert enefiil effets ginst oesity nd insulin resistne. The extent to whih.3g deresed ody weight gin nd inresed insulin sensitivity in mie fed the HD ws lso shown in.9g. Exhiiting no further preventive effet ginst oesity nd insulin resistne in.9g, green offee en extrt seems to reh its mximum effet t 31% nd 24% redutions in ody weight gin nd fsting plsm gluose, respetively, in HD-fed mie. As food intke did not differ mong the experimentl groups, we n hypothesize tht the weight-reduing effet of green offee en extrt is medited y the inhiition of dipogenesis. Indeed, we hve onfirmed from mna expression levels tht dipogeni trget genes of PPAγ2 nd C/EBPα were downregulted in mie fed the green offee en extrt. Severl upstrem moleules suh s WNT1, glnin, firolst growth ftor 1, nd one morphogeneti proteins indue PPAγ2 nd C/EBPα [23 25]. Of the vrious upstrem moleules, the dipogeni mehnism of WNT1 hs een thoroughly reserhed oth in vivo nd in vitro [23]. WNT signling initites s WNT1, glyoprotein, inds to fizzled reeptors (ZD) nd lipoprotein-reeptor-relted protein (LP) [23]. Upon WNT1 signling tivtion, β-tenin phosphoryltion nd its susequent degrdtion re prevented [26]. Then, hypophosphorylted β-tenin umultes in the ytoplsm nd trnslotes into the nuleus, where it inds to the T-ell-speifi trnsription ftor/lymphoid-enhner-inding ftor (TC/LE) nd suppresses PPAγ2 nd C/EBPα. The WNT1 signling pthwy is suppressed y extrellulr ntgonists, suh s SP5 nd DKK2. Sereted from dipoytes, SP5 nd DKK2 inhiit WNT1 signling in dipose tissue vi n utorine/prrine mehnism (igure 8). SP5 inds nd sequesters WNT1 from ZD reeptors, wheres DKK2 inds nd disrupts LP from inding to ZD [27, 28]. Mie fed the green offee en extrt exhiited lower gene expression of SP5 nd DKK2 ompred with those fed the HD only. Trnsriptionl regultion on SP5 nd DKK2 genes hs not yet een explored in WAT. Yet, Qi et l.
12 12 Evidene-Bsed Complementry nd Alterntive Mediine hve reported tht epigeneti silening of SP5 medited y hypermethyltion uses onstitutive tivtion of WNT signling nd oloretl tumorigenesis in oloretl tumor ells [29]. Epigeneti regultion of the SP5 gene in dipose tissue hs not een reported; however, similr epigeneti silening of the SP5 gene ould possily indue WNT signling in dipose tissue. Perhps, green offee en extrt plys role in epigeneti silening of SP5, resulting in lower SP5 expression in dipose tissue ut whether it diretly or indiretly modultes its expression requires further investigtion. Glnin, 29/3-residue neuropeptide, regultes food onsumption, memory, neurogenesis, nd neuroendorine funtion y inding to reeptors in the hypothlmi regions [3]. It is well known tht glnin is expressed nd widely distriuted in the entrl nervous system. However, reent studies hve reveled tht glnin expression hs lso een oserved in peripherl tissues suh s stomh, WAT, nd tste uds [24, 31]. In our previous study, we disovered tht diet-indued oese mie exhiited the upregultion of glnin nd its reeptors in WAT [24]. As result, inresed levels of glnin tivte glnin reeptor sutypes, whih re memers of the G protein-oupled reeptor fmily. Signling properties of Gl1 nd Gl2 re somewht different, ut oth eventully led to the tivtion of EK. Upon prolonged HD onsumption, the tivtion of Gl1 inreses mitogen-tivted protein kinse (MAPK) tivity in PKC-independent mnner y oupling to Gi-type G- proteins vi Gβγ suunits nd indues extrellulr signlregulted kinses 1/2 (EK) tivtion [32]. The tivtion of Gl2, oupled to Gq/11-type G-proteins, inreses phospholipse C (PLC) tivtion. PLC leves phosphtidylinositol 4,5-isphsphte into inositol 1,4,5-triphosphte nd diyl glyerol, PKCδ tivtor. Susequently, PKCδ indues the tivtion of EK, whih inreses the expression of PPAγ2 nd C/EBPα nd promotes dipogenesis. The mna levels ofgenesinvolvedinglnin-mediteddipogenesiswere redued in mie fed green offee en extrt. Green offee en extrt ppers to suppress dipogenesis y reversing HD-indued inresed expression of glnin, its reeptors, nd dipogeni trnsription ftors. Sine leptin seretion from dipose tissues is positively orrelted with TG umultion in dipoytes, plsm leptin level is iomrker in ssessing oesity in oth experimentl nimls nd humns [33, 34]. Inrements of serum leptin levels usully our together with dipoyte hypertrophy. In the present study, HD-fed mie demonstrted higher plsm leptin levels nd lrger dipoyte size thn -fed mie. Yet, green offee en extrt seems to derese plsm leptin nd its mna expression long with the verge dipoytedimeterinhd-fedmie. Lower levels of plsm proinflmmtory ytokines suh s IL-6 nd MCP-1 were oserved in mie fed green offee en extrt when ompred with mie fed the HD. Generlly, the levels of plsm ytokines orrelte with the expression of proinflmmtory dipokines in WAT [35, 36]. Adipoytes under norml or helthy onditions referred to s len ft ells engge metoli pthwys, leving immune-responsepthwysintive[36]. However, when len ft ells re onstntly exposed to overnutrition nd store exess ft eyond ritil size, they eome ft ft ells, whih re good soure of dipokines [37]. In this modified milieu, from metoli to proinflmmtory environment, inflmmtory meditors suh s TL2 nd TL4 re hronilly expressed in dipoytes [36]. TLs ply role in the innte immune response, whih disrimintes etween self nd nonself nd tivtes proinflmmtory proesses upon stimultion vi pthogen-ssoited moleulr ptterns suh s lipopolyshrides [38]. Ativtion of TLs indues phosphoryltion of JNK nd reruitment of tivtor protein-1 (AP-1), whih ts s trnsriptionl tivtor of proinflmmtory ytokines suh s TNα, MCP1, INα, INβ, nd IL-6[16, 39 41]. Our dt reveled tht the expression of TL2 nd TL4 ws redued in mie fed the green offee en extrt when ompred with those fed the HD. This implies tht green offee en extrt my ttenute WAT from eoming HD-indued inflmed nd modified environment. eently, it ws reported tht ftty ids, prtiulrly sturted ftty ids (C14:, C16:, nd C18:), serve s lignds to TL4 [16, 4]. In the present study, mie fed the green offee en extrt exhiited lower plsm A levels when ompred with those fed HD. rom this, we suggest tht green offee en extrt my hve ttenuted tivtion of TL4-medited signling pthwy nd therefore resulted in the deresed expression of proinflmmtory ytokines, onfirmed y their mna expression levels. Colletively, we speulte tht green offee en extrt my suppress proinflmmtory responses y not only deresing the expression of TL2 nd TL4 ut lso deresing ligndinduedtl4-meditedinflmmtorysignling. sting plsm gluose nd insulin levels nd OGTT results demonstrted tht insulin sensitivity ws enhned in green offee en extrt fed mie. Improvement in insulin sensitivity ws further onfirmed y Western lot nlysis of insulin signling-relted moleules nd memrne GLUT4. Mie fed the green offee en extrt exhiited inresed phosphoryltion of AKT nd trnslotion of GLUT4 from the ytosol to the memrne when ompred with those fed HD. Whether green offee en extrt hs diret influene on GLUT4 trnslotion requires further investigtion. However, we speulte tht the enefiil effets ginst insulin resistne ould e ssoited with deresed inflmmtory responses. eent studies hve suggested tht JNK, n importnt stress sensor, plys ruil role in the regultion of HD-indued insulin resistne nd inflmmtion [36]. When WAT eomes inflmed, JNK is phosphorylted nd p-jnk intivtes IS-1 y phosphorylting its serine residue [39]. Serine phosphoryltion on IS-1 loks GLUT4 trnslotion nd therefore impirs insulin sensitivity [42]. Thus, green offee en extrt my hve reversed HDindued insulin resistne y deresing JNK tivtion nd inresing GLUT4 trnslotion. In onlusion, the present study shows tht green offee en extrt signifintly redues viserl ft-pd umultion nd improves insulin resistne in mie fed the HD t minimum effetive dose of.3% supplementtion. We suggest tht 5-CQA nd other polyphenols in green offee en extrt my ring n dditive effet in deresing
13 Evidene-Bsed Complementry nd Alterntive Mediine 13 ody weight gin nd inresing insulin sensitivity. These enefiil effets re possily due to the downregultion of genes ssoited with dipogenesis nd inflmmtion in the WAT of mie. Tken s whole, deffeinted green offee en extrt my e used s therpeuti gent tht prevents oesity nd metoli syndrome. Conflit of Interests The uthors delre tht there is no onflit of interests regrding the pulition of this pper. Aknowledgment ThisreserhwssupportedytheSCprogrm(Centerfor ood & Nutritionl Genomis: Grnt no ) of the Ntionl eserh oundtion (N) of Kore funded y the Ministry of Edution, Siene nd Tehnology. eferenes [1] A. Smith, Effets of ffeine on humn ehvior, ood nd Chemil Toxiology,vol.4,no.9,pp ,22. [2] C. C. Appel nd T. D. Myles, Cffeine-indued hypoklemi prlysis in pregnny, Ostetris & Gyneology, vol.97,no.5, prt 2, pp , 21. [3] P. W. Curtolo nd D. oertson, The helth onsequenes of ffeine, Annls of Internl Mediine, vol.98,no.5,prt1,pp , [4] M. C. Cornelis, Coffee intke, Progress in Moleulr Biology nd Trnsltionl Siene, vol. 18, pp , 212. [5] A.osso,J.Mossey,ndC..Lipp, Cffeine:neuroprotetive funtions in ognition nd Alzheimer s disese, Amerin Journl of Alzheimer s Disese & Other Dementis, vol.23,no. 5, pp , 28. [6]. M. vn Dm nd. B. Hu, Coffee onsumption nd risk of type 2 dietes: systemti review, The Journl of the Amerin Medil Assoition,vol.294,no.1,pp.97 14,25. [7] J. A. Greenerg, C. N. Boozer, nd A. Gelieter, Coffee, dietes, nd weight ontrol, The Amerin Journl of Clinil Nutrition,vol.84,no.4,pp ,26. [8] K. Tnk, S. Nishizono, S. Tmru et l., Anti-oesity nd hypotriglyeridemi properties of offee en extrt in SD rts, ood Siene nd Tehnology eserh, vol.15,no.2,pp , 29. [9] T. Murse, K. Misw, Y. Minegishi et l., Coffee polyphenols suppress diet-indued ody ft umultion y downregulting SEBP-1 nd relted moleules in C57BL/6J mie, Amerin Journl of Physiology: Endorinology nd Metolism, vol. 3, no. 1, pp. E122 E133, 211. [1] L. Ho, M. Vrghese, J. Wng et l., Dietry supplementtion with deffeinted green offee improves diet-indued insulin resistne nd rin energy metolism in mie, Nutritionl Neurosiene,vol.15,no.1,pp.37 45,212. [11] K. W. Ong, A. Hsu, nd B. K. H. Tn, Chlorogeni id stimultes gluose trnsport in skeletl musle vi AMPK tivtion: ontriutor to the enefiil effets of offee on dietes, PLoS ONE,vol.7,no.3,ArtileIDe32718,212. [12] A.-S. Cho, S.-M. Jeon, M.-J. Kim et l., Chlorogeni id exhiits nti-oesity property nd improves lipid metolism in high-ft diet-indued-oese mie, oodndchemiltoxiology,vol.48,no.3,pp ,21. [13] H. Hemmerle, H.-J. Burger, P. Below et l., Chlorogeni id nd syntheti hlorogeni id derivtives: novel inhiitors of hepti gluose-6-phosphte trnslose, Journl of Mediinl Chemistry,vol.4,no.2,pp ,1997. [14] D. V.. de Sotillo nd M. Hdley, Chlorogeni id modifies plsm nd liver onentrtions of: holesterol, triylglyerol, nd minerls in (f/f) Zuker rts, The Journl of Nutritionl Biohemistry, vol. 13, no. 12, pp , 22. [15] S. M. ngwl nd M. A. Lzr, Trnsriptionl ontrol of dipogenesis, Annul eview of Nutrition,vol.2,pp , 2. [16] H. Shi, M. V. Kokoev, K. Inouye, I. Tzmeli, H. Yin, nd J. S. lier, TL4 links innte immunity nd ftty id-indued insulin resistne, The Journl of Clinil Investigtion, vol. 116, no. 11, pp , 26. [17] H. Xu, G. T. Brnes, Q. Yng et l., Chroni inflmmtion in ft plys ruil role in the development of oesity-relted insulin resistne, The Journl of Clinil Investigtion,vol.112,no.12, pp ,23. [18] J.-K. Moon, H. S. Yoo, nd T. Shimoto, ole of rosting onditions in the level of hlorogeni id ontent in offee ens: orreltion with offee idity, Journl of Agriulturl nd ood Chemistry,vol.57,no.12,pp ,29. [19] O. Delllier, B. Lemire, nd S. Lfy, Svetol, green offee extrt, indues weight loss nd inreses the len to ft mss rtio in volunteers with overweight prolem, Phytotherpie, vol. 4, no. 4, pp , 26. [2] S. egn-shw, M. Nihl, nd N. Ahmd, Dose trnsltion from niml to humn studies revisited, The ASEB Journl, vol.22,no.3,pp ,28. [21] Z. Zho, H. S. Shin, H. Stsu, M. Totsuk, nd M. Shimizu, 5- ffeoylquini id nd ffei id down-regulte the oxidtive stress- nd TN-α-indued seretion of interleukin-8 from Co-2 ells, JournlofAgriulturlndoodChemistry, vol. 56, no. 1, pp , 28. [22] B.K.Bssoli,P.Cssoll,G..Bor-Murdetl., Chlorogeni id redues the plsm gluose pek in the orl gluose tolerne test: effets on hepti gluose relese nd glyemi, Cell Biohemistry nd untion,vol.26,no.3,pp ,28. [23] C. Christodoulides, C. Lgthu, J. K. Sethi, nd A. Vidl-Puig, Adipogenesis nd WNT signlling, Trends in Endorinology & Metolism,vol.2,no.1,pp.16 24,29. [24] A. Kim nd T. Prk, Diet-indued oesity regultes the glnin-medited signling sde in the dipose tissue of mie, Moleulr Nutrition & ood eserh, vol. 54, no. 9, pp , 21. [25] T. J. Shulz nd Y.-H. Tseng, Emerging role of one morphogeneti proteins in dipogenesis nd energy metolism, Cytokine&Growthtoreviews,vol.2,no.5-6,pp , 29. [26] X. He, A Wnt-Wnt sitution, Developmentl Cell,vol.4,no.6, pp , 23. [27] A. uh nd S. Mndrup, Lighting the ft furne without SP5, The Journl of Clinil Investigtion, vol.122,no.7,pp , 212. [28] B. Gustfson nd U. Smith, The WNT inhiitor dikkopf 1 nd one morphogeneti protein 4 resue dipogenesis in hypertrophi oesity in humns, Dietes, vol. 61, no. 5, pp , 212.
14 14 Evidene-Bsed Complementry nd Alterntive Mediine [29] J. Qi, Y.-Q. Zhu, J. Luo, nd W.-H. To, Hypermethyltion nd expression regultion of sereted frizzled-relted protein genes in oloretl tumor, World Journl of Gstroenterology,vol.12, no. 44, pp , 26. [3] I. Sr, J. unesson, I. MNmr, J. Järv, J. K. oinson, nd Ü. Lngel, Novel glnin reeptor sutype speifi lignds in feeding regultion, Neurohemistry Interntionl,vol.58,no.6, pp ,211. [31] Y.Set,S.Ktok,T.Toyono,ndK.Toyoshim, Expression of glnin nd the glnin reeptor in rt tste uds, Arhives of Histology nd Cytology,vol.69,no.4,pp ,26. [32]. Lng, A. L. Gundlh, nd B. Kofler, The glnin peptide fmily: reeptor phrmology, pleiotropi iologil tions, ndimplitionsinhelthnddisese, Phrmology & Therpeutis,vol.115,no.2,pp ,27. [33] M. Mffei, J. Hls, E. vussin et l., Leptin levels in humn nd rodent: mesurement of plsm leptin nd o NA in oese nd weight-redued sujets, Nture Mediine,vol.1,no.11,pp , [34].N.Jdej,M.C.Thounojm,U.V.mni,.V.Devkr,nd A. V. mhndrn, Anti-oesity potentil of Clerodendron glndulosum.colelefqueousextrt, Journl of Ethnophrmology,vol.135,no.2,pp ,211. [35] S.E.Shoelson,J.Lee,ndA.B.Goldfine, Inflmmtionnd insulin resistne, The Journl of Clinil Investigtion, vol. 116, no.7,pp ,26. [36] M.. Gregor nd G. S. Hotmisligil, Inflmmtory mehnisms in oesity, Annul eview of Immunology, vol.29,pp , 211. [37] S. Mittr, V. S. Bnsl, nd P. K. Bhtngr, rom gluoentri to lipoentri pproh towrds metoli syndrome, Drug Disovery Tody,vol.13,no.5-6,pp ,28. [38] C. Erridge, Endogenous lignds of TL2 nd TL4: gonists or ssistnts? Journl of Leukoyte Biology, vol. 87, no. 6, pp , 21. [39] M. T. A. Nguyen, H. Stoh, S. velyukis et l., JNK nd tumornerosisftor-α medite free ftty id-indued insulin resistne in 3T3-L1 dipoytes, The Journl of Biologil Chemistry,vol.28,no.42,pp ,25. [4] J. K. Kim, t uses TOLL-rod to onnet inflmmtion nd dietes, Cell Metolism,vol.4,no.6,pp ,26. [41] S.-J. Kim, Y. Choi, Y.-H. Choi, nd T. Prk, Oesity tivtes toll-like reeptor-medited proinflmmtory signling sdes in the dipose tissue of mie, The Journl of Nutritionl Biohemistry,vol.23,no.2,pp ,212. [42]. einstein, H. Knety, M. Z. Pp, B. Lunenfeld, nd A. Krsik, Tumor nerosis ftor-α suppresses insulin-indued tyrosine phosphoryltion of insulin reeptor nd its sustrtes, The Journl of Biologil Chemistry,vol.268,no.35,pp , 1993.
15 MEDIATOS of INLAMMATION The Sientifi World Journl Hindwi Pulishing Corportion Gstroenterology eserh nd Prtie Hindwi Pulishing Corportion Journl of Hindwi Pulishing Corportion Dietes eserh Hindwi Pulishing Corportion Hindwi Pulishing Corportion Interntionl Journl of Journl of Endorinology Immunology eserh Hindwi Pulishing Corportion Disese Mrkers Hindwi Pulishing Corportion Sumit your mnusripts t BioMed eserh Interntionl PPA eserh Hindwi Pulishing Corportion Hindwi Pulishing Corportion Journl of Oesity Journl of Ophthlmology Hindwi Pulishing Corportion Evidene-Bsed Complementry nd Alterntive Mediine Stem Cells Interntionl Hindwi Pulishing Corportion Hindwi Pulishing Corportion Journl of Onology Hindwi Pulishing Corportion Hindwi Pulishing Corportion Prkinson s Disese Computtionl nd Mthemtil Methods in Mediine Hindwi Pulishing Corportion AIDS Behviourl Neurology Hindwi Pulishing Corportion eserh nd Tretment Hindwi Pulishing Corportion Hindwi Pulishing Corportion Oxidtive Mediine nd Cellulr Longevity Hindwi Pulishing Corportion
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationResearch Article A Comparison of Inflammatory and Oxidative Stress Markers in Adipose Tissue from Weight-Matched Obese Male and Female Mice
Hindwi Pulishing Corportion Experimentl Dietes Reserh Volume 1, Artile ID 859395, 8 pges doi:1.1155/1/859395 Reserh Artile A Comprison of Inflmmtory nd Oxidtive Stress Mrkers in Adipose Tissue from Weight-Mthed
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationHydrodynamic Delivery of mil10 Gene Protects Mice From High-fat Diet-induced Obesity and Glucose Intolerance
originl rtile The Amerin Soiety of Gene & Cell Therpy Hydrodynmi Delivery of mil Gene Protets Mie From High-ft Diet-indued Oesity nd Gluose Intolerne Mingming Go, Chuno Zhng, Yongjie M, Le Bu, Linn Yn
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationGarcinia cambogia Extract Ameliorates Visceral Adiposity in C57BL/6J Mice Fed on a High-Fat Diet
Biosi. Biotehnol. Biohem., 72 (7), 1772 1780, 2008 Grini mogi Extrt Ameliortes Viserl Adiposity in C57BL/6J Mie Fed on High-Ft Diet Keun-Young KIM, Hye Nm LEE, Yun Jung KIM, nd Tesun PARK y Deprtment of
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationBritish Journal of Nutrition
British Journl of Nutrition (2014), 111, 445 451 q The Authors 2013 doi:10.1017/s0007114513002584 PUFA rtio is involved in regulting lipid metolism nd inflmmtion in pigs Yehui Dun 1,2, Fengn Li 1 *, Lili
More informationARTICLE. E. O. List & A. J. Palmer & D. E. Berryman & B. Bower & B. Kelder & J. J. Kopchick
Dietologi (2009) 52:1647 1655 DOI 10.1007/s00125-009-1402-z ARTICLE Growth hormone improves ody omposition, fsting lood gluose, gluose tolerne nd liver triylglyerol in mouse model of diet-indued oesity
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationREVIEW Study of the Formation of trans Fatty Acids in Model Oils (triacylglycerols) and Edible Oils during the Heating Process
JARQ 46 (3), 215 220 (2012) http://www.jirs.ffr.go.jp REVIEW Study of the Formtion of trns Ftty Aids in Model Oils (triylglyerols) nd Edible Oils during the Heting Proess Wkko TSUZUKI* Food Resoure Division,
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationBeta-Glucan-Rich Extract from
Evidene-Bsed Complementry nd Alterntive Mediine Volume 2013, Artile ID 185259, 10 pges http://dx.doi.org/10.1155/2013/185259 Reserh Artile Bet-Glun-Rih Extrt from Pleurotus sjor-ju (Fr.) Singer Prevents
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationErucin Exerts Anti-Inflammatory Properties in Murine Macrophages and Mouse Skin: Possible Mediation through the Inhibition of NFκB Signaling
Int. J. Mol. Si. 213, 14, 2564-2577; doi:1.339/ijms1412564 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Eruin Exerts Anti-Inflmmtory Properties in Murine
More informationResearch Article Lactobacillus plantarum LG42 Isolated from Gajami Sik-Hae Inhibits Adipogenesis in 3T3-L1 Adipocyte
Hindwi Pulishing Corportion BioMed Reserh Interntionl Volume 23, Artile ID 46927, 7 pges http://dx.doi.org/.55/23/46927 Reserh Artile Ltoillus plntrum LG42 Isolted from Gjmi Sik-He Inhiits Adipogenesis
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationFood Research & Development, CJ Cheiljedang Corporation, Seoul , Korea; s: (H.-J.K.); (B.S.M.
Int. J. Mol. Si. 214, 15, 17778-17789; doi:1.339/ijms15117778 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms The Benefiil Effets of Comined Grpe Pome nd Omij
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationSupplemental epilactose prevents metabolic disorders through uncoupling protein-1 induction in the skeletal muscle of mice fed high-fat diets
British Journl of Nutrition (215), 114, 1774 1783 The Authors 215 doi:1.117/s7114515355 Supplementl epiltose prevents metoli disorders through unoupling protein-1 indution in the skeletl musle of mie fed
More informationDifferential expression of cyclin G2, cyclin dependent kinase inhibitor 2C and peripheral myelin protein 22 genes during adipogenesis..
The Ohio Stte University From the SeletedWorks of Jiin Zhng Summer My 5, 214 Differentil expression of ylin G2, ylin dependent kinse inhiitor 2C nd peripherl myelin protein 22 genes during dipogenesis..pdf
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationAUTHOR COPY ONLY. Glycogen synthase kinase 3b mediates high glucose-induced ubiquitination and proteasome degradation of insulin receptor substrate 1
Glyogen synthse kinse 3 medites high gluose-indued uiquitintion nd protesome degrdtion of insulin reeptor sustrte 1 171 Snhu Leng, Wenshuo Zhng, Ynin Zheng, Ziv Liermn 1, Christopher J Rhodes, Hgit Eldr-Finkelmn
More informationIntervention with citrus flavonoids reverses obesity, and improves metabolic syndrome and
Intervention with itrus flvonoids reverses oesity, nd improves metoli syndrome nd theroslerosis in oese Ldlr -/- mie Authors: Amy C. Burke 1,2, Brin G. Sutherlnd 1, Dwn E. Telford 1,3, Mris R. Morrow 1,
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationDepartment of Animal Resource and Science, Dankook University, Cheonan, Choongnam, , Republic of Korea
British Journl of Nutrition (1), 115, 57575 The Authors 1 doi:1.117/s711515857 Ltoillus idophilus modultes inflmmtory tivity y regulting the TLR nd NF-κB expression in porine peripherl lood mononuler ells
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationRaina Devi Ramnath, Jia Sun, and Madhav Bhatia. Department of Pharmacology, National University of Singapore, Singapore
-3565/9/39-48 48$. THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 39, No. Copyright 9 y The Amerin Soiety for Phrmology nd Experimentl s 48684/346663 JPET 39:48 48, 9 Printed in U.S.A.
More informationSupplementary information to accompany the manuscript entitled:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementry informtion to ompny the mnusript entitled: A mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationEffect of age and moderate food restriction on insulin sensitivity in Wistar rats: role of adiposity
131 Effet of ge nd moderte food restrition on insulin sensitivity in Wistr rts: role of diposity Fernndo Esrivá, M Luí Gvete, Ysmín Fermín 1, Corli Pérez 1, Nild Gllrdo 2, Crmen Alvrez, Antonio Andrés
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationAJ PUTT. Hematology. Chemistry. Species: Canine Gender: Female Year of Birth: 2013 Client: PUTT
Speies: Cnine Gender: Femle Yer of Birth: 2013 Client: PUTT Requisition #: 9034-12 Aession #: W2152816 Aount Code: 72364 Veterinrin: CARTER Pnel/Profile: Tik Pnel Add-on Senior Profile with L 4Dx Plus
More informationAdipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
Reeived 11 Jul 1 Aepted Fe Pulished 11 Mr DOI: 1.138/nomms795 OPEN Adipose tissue NAPE-PLD ontrols ft mss development y ltering the rowning proess nd gut miroiot Luie Geurts 1, Amndine Everrd 1,, Mtthis
More informationIrisin biomarker, TSH, Trygleceriads and High Density Lipoproteins in thyroid diesase patients
Interntionl Journl of ChemTeh Reserh CODEN (USA): IJCRGG, ISSN: 0974-4290, ISSN(Online):2455-9555 Vol.10 No.2, pp 674-678, 2017 Irisin biomrker, TSH, Trygleerids nd High Density Lipoproteins in thyroid
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationAnti-diabetic effect of Cyclo-His-Pro (CHP)-enriched yeast hydrolysate in streptozotocin-induced diabetic mice
Vol. 12(35), pp. 5473-5479, 28 August, 213 DOI: 1.5897/AJB12.1556 ISSN 1684-5315 213 Ademi Journls http://www.demijournls.org/ajb Afrin Journl of Biotehnology Full Length Reserh Pper Anti-dieti effet of
More informationResearch Article Thyroid Hormone Status Interferes with Estrogen Target Gene Expression in Breast Cancer Samples in Menopausal Women
ISRN Endorinology, Artile ID 317398, 8 pges http://dx.doi.org/1.1155/14/317398 Reserh Artile Thyroid Hormone Sttus Interferes with Estrogen Trget Gene Expression in Brest Cner Smples in Menopusl Women
More informationEffect of Diets Containing Sucrose vs. D-tagatose in Hypercholesterolemic Mice
nture pulishing group ARTICLES Effet of Diets Contining Surose vs. D-tgtose in Hyperholesterolemi Mie S r B. Poli e 1, J. C l y Hr r is 2, Roert A. Lodder 1, 2 nd Lis A. Cssis 1 Effets of funtionl sweeteners
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationWhite adipose tissue overproduces the lipid-mobilizing factor zinc a2-glycoprotein in chronic kidney disease
si reserh http://www.kidney-interntionl.org & 13 Interntionl Soiety of Nephrology White dipose tissue overprodues the lipid-moilizing ftor zin -glyoprotein in hroni kidney disese Croline C. Pelletier 1,,3,5,
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationLipid Composition of Egg Yolk and Serum in Laying Hens Fed Diets Containing Black Cumin (Nigella sativa)
Interntionl Journl of Poultry Siene 5 (6): 574-578, 2006 ISSN 682-8356 Asin Network for Sientifi Informtion, 2006 Lipid Composition of Egg Yolk nd Serum in Lying Hens Fed Diets Contining Blk Cumin (Nigell
More informationTargeting TSLP With shrna Alleviates Airway Inflammation and Decreases Epithelial CCL17 in a Murine Model of Asthma
Cittion: Moleulr Therpy Nulei Aids (216), e316; doi:1.138/mtn.216.29 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn Trgeting TSLP With shrna Allevites Airwy Inflmmtion nd Dereses
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationA maternal junk food diet in pregnancy and lactation promotes an exacerbated taste for junk food and a greater propensity for obesity in rat offspring
British Journl of Nutrition (27), pge 1 of 9 q The uthors 27 doi: 1.117/S7114781237 mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity for oesity in rt
More informationInternational Journal of Pharma and Bio Sciences
Int J Phrm Bio Si 2013 Ot; 4(4): (B) 427-436 Reserh Artile BioChemistry Interntionl Journl of Phrm nd Bio Sienes ISSN 0975-6299 SILDENAFIL ALLEVIATES INSULIN SENSITIVITY VIA ATTENUATING OXIDATIVE STRESS
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationIntestine specific MTP deficiency with global ACAT2 gene ablation lowers acute cholesterol absorption with chylomicrons and high density lipoproteins
Intestine speifi MTP defiieny with glol ACAT2 gene ltion lowers ute holesterol sorption with hylomirons nd high density lipoproteins 1,2 Jhngir Iql, 1,2 Mohmed Boutjdir, 3 Lwrene L. Rudel, 1,2 M. Mhmood
More informationWhangarei District Council Class 4 Gambling Venue Policy
Whngrei Distrit Counil Clss 4 Gmling Venue Poliy April 2013 Whngrei Distrit Counil Clss 4 Gmling Venue Poliy Tle of ontents Introdution... 3 1 Ojetives of the poliy in so fr s promoted y the Gmling At
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationLIPIDOMICS OF BLOOD AND ORGANS OF RATS FED DIETS SUPPLEMENTED WITH DIFFERENT EDIBLE OILS
Animl Reserh Interntionl (215) 12(2): 2189 222 2189 LIPIDOMICS OF BLOOD AND ORGANS OF RATS FED DIETS SUPPLEMENTED WITH DIFFERENT EDIBLE OILS 1 UGBAJA, Regin Ngozi, 2 AFOLABI, Olusegun Kyode, 1 ONUNKWOR,
More informationCB1 antagonism exerts specific molecular effects on visceral and subcutaneous fat and reverses liver steatosis in diet-induced obese mice.
CB1 ntgonism exerts speifi moleulr effets on viserl nd suutneous ft nd reverses liver stetosis in diet-indued oese mie. Tony Jourdn, Louiz Djouti, Lurent Demizieux, Joseph Gresti, Bruno Vergès, Psl Degre
More informationGLP-1 oestrogen attenuates hyperphagia and protects from beta cell failure in diabetes-prone New Zealand obese (NZO) mice
Dietologi () 8:64 614 DOI.7/s1-14-3478-3 ARTICLE GLP-1 oestrogen ttenutes hyperphgi nd protets from et ell filure in dietes-prone New Zelnd oese (NZO) mie Roert W. Shwenk & Christin Bumeier & Brin Finn
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationMesozeaxanthin protects the liver and reduces cardio-metabolic risk factors in an insulin resistant rodent model
FOOD & NUTRITION RESEARCH, 217 VOL. 61, 135336 https://doi.org/1.18/16546628.217.135336 ARTICLE Mesozexnthin protets the liver nd redues rdio-metoli risk ftors in n insulin resistnt rodent model Kzim Shin,
More informationCyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK
3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture277 d 25 25 2 Time from sound onset (ms) 25 25 2 Time from sound onset (ms) Firing rte (spikes/s) Firing rte (spikes/s).8.6..2 e f g h.8.6..2 Frtion of neurons Frtion of neurons N = 53 2 2
More informationMinimum effective dose of chenic acid for gallstone patients: reduction with bedtime administration and
Gut, 1982, 23, 28-284 Minimum effetive dose of heni id for gllstone ptients: redution with bedtime dministrtion nd low holesterol diet D P MUDGL, R M KUPFER, ND T C NORTHFIELD* From the Normn Tnner Gstroenterology
More informationResearch Article TNF-α and IFN-s-Dependent Muscle Decay Is Linked to NF-κB- and STAT-1α-Stimulated Atrogin1 and MuRF1 Genes in C2C12 Myotubes
Hindwi Pulishing Corportion Meditors of Inflmmtion Volume 213, Artile ID 171437, 18 pges http://dx.doi.org/1.1155/213/171437 Reserh Artile nd IFN-s-Dependent Musle Dey Is Linked to NF-κB- nd STAT-1α-Stimulted
More informationDebasis De, 1 Kausik Chatterjee, 1 Kazi Monjur Ali, 1 Tushar Kanti Bera, 1, 2 and Debidas Ghosh Introduction
Hindwi Pulishing Corportion Evidene-Bsed Complementry nd Alterntive Mediine Volume 211, Artile ID 89287, 11 pges doi:1.1155/211/89287 Reserh Artile Antidieti Potentility of the Aqueous-Methnoli Extrt of
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationLysine enhances methionine content by modulating the expression of S-adenosylmethionine synthase
The Plnt Journl (7) 5, 85 86 doi:./j.365-33x.7.384.x ine enhnes methionine ontent y modulting the expression of S-denosylmethionine synthse Yel Hhm,, Luhu Song, Gdi Shuster nd Rhel Amir,3, Lortory of Plnt
More informationEffects of Plant Sphingolipids on Inflammatory Stress in Differentiated Caco-2 Cells
Journl of Oleo Siene Copyright 2017 y Jpn Oil Chemists Soiety doi : 10.5650/jos.ess17171 J. Oleo Si. 66, (12) 1337-1342 (2017) NOTE Effets of Plnt Sphingolipids on Inflmmtory Stress in Differentited Co-2
More informationEffect of Prebiotics Inulin and Mannan on Lipid Profile and Intestinal Micro Flora of Hypercholesterolemic Rats
J. Appl. Environ. Biol. Si., 6(8)22-31, 216 216, TextRod Pulition ISSN: 29-4274 Journl of Applied Environmentl nd Biologil Sienes www.textrod.om Effet of Preiotis Inulin nd Mnnn on Lipid Profile nd Intestinl
More informationOb/ob mice are leptin deficient and become hyperphagic,
ORIGINL RTICLE Glyerol-3-Phosphte yltrnsferse 1 Defiieny in o/o Mie Diminishes Hepti Stetosis ut Does Not Protet ginst Insulin Resistne or Oesity ngel. Wendel, 1 Lei O. Li, 1 Yue Li, 1 Gry W. Cline, 2
More informationHydrogen sulfide-induced inhibition of L-type Ca 2+ channels and insulin secretion in mouse pancreatic beta cells
Dietologi (213) 56:533 541 DOI 1.17/s125-12-286-8 ARTICLE Hydrogen sulfide-indued inhiition of L-type C 2 hnnels nd insulin seretion in mouse pnreti et ells G. Tng & L. Zhng & G. Yng & L. Wu & R. Wng Reeived:
More informationLight at night acutely impairs glucose tolerance in a time-, intensity- and wavelength-dependent manner in rats
Dietologi (21) :1 1 DOI 1.1/s12-1-22-y ARTILE Light t night utely impirs gluose tolerne in time-, intensity- nd wvelength-dependent mnner in rts Anne-Loes Opperhuizen 1,2 & Dirk J. Stenvers 2, & Remi D.
More informationToll-Like Receptor Activation during Cutaneous Allergen Sensitization Blocks Development of Asthma through IFN-Gamma-Dependent Mechanisms
ORIGINAL ARTICLE See relted ommentry on pg 874 Toll-Like Reeptor Ativtion during Cutneous Allergen Sensitiztion Bloks Development of Asthm through IFN-Gmm-Dependent Mehnisms Rit Hpkoski 1, Pii Krisol 1,
More informationThe nucleotide exchange factor SIL1 is required for glucose-stimulated insulin secretion from mouse pancreatic beta cells in vivo
Dietologi (1) 7:11 119 DOI 1.17/s1-1-33-z ARTICLE The nuleotide exhnge ftor SIL1 is required for gluose-stimulted insulin seretion from mouse pnreti et ells in vivo Arne A. Ittner & Josefine Bertz & Tse
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationThe Body Vitamin B 1 Levels of Rats Fed a Diet Containing the Minimum Requirement of Vitamin B 1 Is Reduced by Exercise
J Nutr Si Vitminol, 59, 87 92, 213 The Body Vitmin B 1 Levels of Rts Fed Diet Contining the Minimum Requirement of Vitmin B 1 Is Redued y Exerise Ktsumi Shit nd Tsutomu Fukuwtri Deprtment of Food Siene
More informationEffects of Feeding Citrus Pulp or Corn Supplements With Increasing Levels of Added Undegraded Intake Protein on the Performance of Growing Cattle
Effets of Feeding Citrus Pulp or Corn Supplements With Inresing Levels of Added Undegrded Intke Protein on the Performne of Growing Cttle Deke Alkire Todd Thrift Willim Kunkle 1 Citrus pulp-sed supplements
More informationEndogenous GIP ameliorates impairment of insulin secretion in proglucagon-deficient mice under moderate beta cell damage induced by streptozotocin
Dietologi (216) 59:1533 1541 DOI 1.17/s125-16-3935-2 ARTICLE Endogenous GIP meliortes impirment of insulin seretion in proglugon-defiient mie under moderte et ell dmge indued y streptozotoin Atsushi Iid
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationSome aspects of nutritive and sensory quality of meat of restrictively fattened chickens
Chiken met qulity: T. Komprd nd J. Zelenk Some spets of nutritive nd sensory qulity of met of restritively fttened hikens T. KOMPRDA 1 * nd J. ZELENKA 2 1 Deprtment of Food Tehnology 2 Deprtment of Animl
More informationF-FDG PET/CT for Monitoring the Response of Breast Cancer to mir-143-based Therapeutics by Targeting Tumor Glycolysis
Cittion: Moleulr Therpy Nulei Aids () 5, e57; doi:.8/mtn..7 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn F-FDG PET/CT for Monitoring the Response of Brest Cner to -Bsed Therpeutis
More informationFXR controls CHOP expression in steatohepatitis
FXR ontrols CHOP expression in stetoheptitis Cludi D. Fuhs 1, Thierry Cludel 1, Huert Shrngl, Ttjn Stojkovi nd Mihel Truner 1 1 Hns Popper Lortory of Moleulr Heptology, Division of Gstroenterology nd Heptology,
More informationIranian Food Science and Technology Research Journal Vol. 6, No. 3, Fall, 2010.
Irnin Food Siene nd Tehnology Reserh Journl Vol. 6, No. 3, Fll, 2010. rvghi.mrym@gmil.om C ( AOAC 920.87 AOAC 942.05 AOAC 962.09 AOAC 922.06 AOAC 925.10 AACC 1- Extrusion-Expelling 2- Protein Dispersiility
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationEpiphyseal growth plate growth hormone receptor signaling is decreased in chronic kidney disease related growth retardation
http://www.kidney-interntionl.org & 213 Interntionl Soiety of Nephrology Epiphysel growth plte growth hormone reeptor signling is deresed in hroni kidney disese relted growth retrdtion Ariel Troi 1, Dniel
More informationInfluence of Ad libitum or Control Feeding on the Performance of Broilers Fed Diets Low in Crude Protein 1
Interntionl Journl of Poultry Siene 4 (5): 74-79, 005 ISSN 168-8356 Asin Network for Sientifi Informtion, 005 Influene of Ad liitum or Control Feeding on the Performne of Broilers Fed Diets Low in Crude
More information