Fermented Barley Extract Supplementation Maintained Antioxidative Defense Suppressing Lipopolysaccharide-Induced Inflammatory Liver Injury in Rats
|
|
- Lesley Dean
- 5 years ago
- Views:
Transcription
1 Biosi. Biotehnol. Biohem., 75 (1), , 211 Fermented Brley Extrt Supplementtion Mintined Antioxidtive Defense Suppressing Lipopolyshride-Indued Inflmmtory Liver Injury in Rts Puspo E. GIRIWONO, 1 Hitoshi SHIRAKAWA, 1;y Hideki HOKAZONO, 2 Tomoko GOTO, 1 nd Mihio KOMAI 1 1 Lortory of Nutrition, Grdute Shool of Agriulturl Siene, Tohoku University, Sendi , Jpn 2 Reserh Lortory, Snw Shurui Co., Ltd., Us , Jpn Reeived My 12, 211; Aepted July 13, 211; Online Pulition, Otoer 7, 211 [doi:1.1271/.11374] Utilizing phytohemils in treting inflmmtion is eoming vile lterntive to phrmologil tretment. We hve reported tht fermented rley extrt (FBE) effetively suppresses oxidtive stress in hronilly ethnol-fed rts. Here we report tht FBE suppressed ute inreses in oxidtive stress s response to lipopolyshride (LPS)-indued inflmmtion. Rts supplemented with FBE for 1 d showed dereses in plsm interleukin (IL)-1, IL-6, nd tumor nerosis ftor- y 25%, 34%, nd 35% respetively fter LPS hllenge. Liver dmge ws signifintly suppressed, s mrked y 44% derese in plsm lnine minotrnsferse. FBE supplementtion sustined liver ntioxidtive enzymes, tlse, glutthione peroxidse, nd superoxide dismutse, t trnsriptionl nd enzymti levels, thus suppressing oxidtive stress mrkers suh s plsm nitri oxide nd 8-hydroxy-2 -deoxygunosine, y 42% nd 23% respetively. We onluded tht tive ompounds in FBE effetively inhiited the propgtion of inflmmtion y suppressing oxidtive stress. Key words: lipopolyshride (LPS); nuler ftor kpp B (NF-B); inflmmtion; fermented rley; oxidtive stress Consumption of grins hs inresed euse of their enefiil effets in lowering the risks of rdiovsulr disese, ishemi stroke, dietes, nd metoli syndrome, in ddition to gstrointestinl ner. 1,2) Grins ontin funtionl dietry fier, vitmins, minerls, nd phytohemils tht re enefiil. Brley, in prtiulr, ontins signifint mount of phenoli ompounds, whih hve een shown to e effetive for the promotion of helth, 3 6) nd fermenttion proedures inrese the iovilility nd funtionlity of these phenoli ompounds. 7,8) These ompounds lso possess ntioxidtive properties tht n potentilly protet ginst the inreses in oxidtive stress tht hve een oserved to e involved in numer of diseses, espeilly metoli syndrome. 2,9,1) Chroni inflmmtion hs reeived prtiulr interest reently, euse it hs een linked with the progression of numerous diseses rnging from ner to insulin resistne. One of severl trnsription ftors responsile for immunologil nd ellulr stress nd inflmmtory response is nuler ftor kpp B (NF-B). Ativtion of NF-B is essentil for host defense, ut its hroni nd/or exess tivtion nd dysregultion hve een found to e involved in severl humn ners, 11) theroslerosis, 12) neurodegenertive diseses, 13) rheumtoid rthritis, 14) sthm, 15) nd inflmmtory owel disese. 16) NF-B is lso tivted y numer of stimuli, rnging from teril lipopolyshride (LPS), doule-strnded RNA, inflmmtory ytokines, ultrviolet light, retive oxygen speies (ROS), nd free sturted ftty ids. Stimultion of NF-B y proinflmmtory ytokines nd ROS would further propgte nd elerte the inflmmtory yle. Prodution of ROS ours nturlly in iologil systems nd is mintined y n evolutionrily derived ntioxidtive defense. During pthogeni nd immunologil responses, ute nd extremely high prodution of these ROS ours to initite the destrution of foreign ells nd llergens, ut unontrolled nd prolonged prodution of ROS n dversely promote extended nd hroni inflmmtion. Thus inresed onsumption of nturlly ourring ntioxidnts my help to llevite nd suppress exessive inflmmtion. Whole-mel rley flour ontins the highest onentrtion of ntioxidnts mong erels (1.9 mmol/1 g equivlent to vitmin C, FRAP ssy), s reported y Hlvorsen et l. 17) Furthermore, we hve reported tht fermented rley extrt (FBE) ws effetive in suppressing oxidtive stress in hroni ethnol feeding, 18) wheres nother study reported nti-inflmmtory tion from other fermented produts suh s rown rie nd its rn. 19) In the present study, we found tht FBE effetively suppressed LPS-indued inflmmtion through the mintenne of ntioxidtive defense. Mterils nd Methods Chemil regents. Detetion kits to ssy plsm lnine minotrnsferse (ALT), nd sprtte minotrnsferse (AST) tivities were purhsed from Wko Pure Chemils (Osk, Jpn). LPS from Esherihi oli O111:B4 (Ct #L263-1MG), used throughout the study, ws from Sigm (St. Louis, MO). All nti-oxidtive enzyme tivities, glutthione peroxidse (GPx), tlse (CAT), nd superoxide dismutse (SOD) were determined y ssy kits purhsed from y To whom orrespondene should e ddressed. Tel: ; Fx: ; E-mil: shirkh@iohem.tohoku..jp Arevitions: 8-OHdG, 8-hydroxy-2 -deoxygunosine; ALT, lnine minotrnsferse; AST, sprtte minotrnsferse; CAT, tlse; FBE, fermented rley extrt; GPx, glutthione peroxidse; IL, interleukin; LPS, lipopolyshride; NF-B, nuler ftor kpp B; NO, nitri oxide; ROS, retive oxygen speies; SOD, superoxide dismutse; TNF, tumor nerosis ftor
2 1972 P. E. GIRIWONO et l. Cymn (Ann Aror, MI). The plsm nitri oxide (NO) onentrtion ws determined with ommeril NO 2 /NO 3 Assy Kit-C II from Dojindo Lortories (Kummoto, Jpn). Before mesuring the 8- hydroxy-2 -deoxygunosine (8-OHdG) level y enzyme-linked immunosorent ssy (ELISA) (JICA, Shizuok, Jpn), plsm ws filtered using Miroon entrifugl filter units with 1, moleulr weight ut-off (Millipore, Billeri, MA) followed y 2-fold dilution. We used vitmin K-defiient diet for the se diet (TD9753), purhsed from Hrln Tekld (Mdison, WI), reonstituted with.75 mg/kg of phylloquinone (Wko Pure Chemils). Fermented rley extrt. Fermented rley extrt (FBE) ws extrted from the lees of rley fermented with rie koji strter (Aspergillus kwuhi) y the method of onventionl Jpnese rewing. This extrtion method involves deftting nd srew-pressing to seprte the liquid phse from the fermented rley fiers. The extrted liquid ws filtered through ermi filter (porosity,.2 mm) to remove solule fier. The filtrte ws then stored t 4 C nd ws used s the test smple (FBE). Anlysis of the FBE indited tht it ws omposed of proteins (17.9%), rohydrte (25.1%), lipids (.1%), minerls (2.2%), nd totl polyphenols (8.5 mg/ml). For this study, FBE ws prepred further with the ddition of sme volume of dextrin into powdered form to ese nd improve homogeniztion. Generl proedure (nimls). Mle Wistr rts, ged 8 weeks nd weighing g, were purhsed from SLC Jpn (Shizuok, Jpn). Eh group inluded six rts rndomized ording to ody weight nd housed under onstnt temperture of 23 C 2 C nd 12-h light/drk (8 2 light) yle. Groups were leled Con (sterilized sline injetion), Conþ (LPS injetion), nd 1% FBE (1% FBE supplementtion in the diet nd LPS injetion). The diet, sed on the Tekld TD 9753 ustom diet (Tle 1), ws freely given to eh group supplemented with or without 1% FBE w/w for 1 d. Distilled wter ws provided for drinking nd ws repled Tle 1. Diet Formultion The se diet ws Tekld TD 9753 re-supplemented with the AIN reommended vitmin K1 onentrtion for rodents (.75 mg/kg of diet). dily. After the feeding period, eh rt ws intrperitonelly injeted with.5 mg/kg of ody weight LPS nd fsted for 18 h nd then euthnized. The protools used in ll niml experiments were pproved y the Animl Reserh-Animl Cre Committee of the Grdute Shool of Agriulturl Sienes, Tohoku University. Plsm iohemil mrkers ssy. To determine the finl plsm ALT nd AST tivities nd lipid ontents, lood ws otined from the rts while they were under diethylether-indued nesthesi y exsnguintion vi the dominl ort. The lood ws olleted in N 2 EDTA-prepred tues, nd then entrifuged t 1;87 g for 15 min t 4 C. The plsm ws divided into liquots nd stored t 3 C. The plsm onentrtion of ytokines ws mesured using n ELISA kit for the detetion nd quntifition of interleukin (IL)-1, IL-6 nd tumor nerosis ftor (TNF)- (Quntikine ELISA, R&D Systems, Minnepolis, MN) following to the mnufturer s protool. Liver ntioxidtive enzyme tivity ssy. In previous experiments, we determined tht the optimum fsting time fter LPS hllenge to oserve signifint liver dmge nd elevted inflmmtory ytokine in rts is 18 h fter modifition. 2) At euthniztion, the livers were quikly exised, lotted, weighed, nd promptly frozen in liquid nitrogen. For nlysis not rried out on the dy, the livers were stored t 7 C. For GPx tivity,.1 g of liver ws homogenized with polytron homogenizer (Polytron, Bsel, Switzerlnd) in 5 ml of old uffer ontining 5 mm Tris HCl ph 7.5, 5 mm EDTA, nd 1 mm DTT on ie. This homogente ws then sujeted to entrifugtion t 1; g for 15 min t 4 C, fter whih the superntnt ws olleted nd ssyed for GPx. To mesure liver CAT tivity, we used homogeniztion protool similr to tht ove in old uffer ontining 5 mm potssium phosphte, ph 7., nd 1 mm EDTA. The homogente ws similrly entrifuged t 1; g for 15 min t 4 C, followed y superntnt extrtion nd ssy. To determine liver SOD tivity, the liver ws homogenized s ove in old 2 mm HEPES-NOH ph 7.2, 1 mm EGTA, nd 7 mm surose. The homogente ws entrifuged t 2; g for 5 min t 4 C nd the superntnt ws seprted. The superntnt ws further entrifuged t 1; g for 15 min t 4 C, nd then the resulting superntnt ws olleted nd ssyed for SOD tivity. Weight (g/kg) Con nd Conþ 1% FBE Soy ssy protein DL-Methionine Surose Corn strh FBE 2 Corn oil Cellulose Minerl (AIN ) Clium ronte (CCO 3 ) p-aminoenzoi id Asori id (oted) 97.5% Biotin.4.4 Vit. B12 (.1% triturtion).3.3 Clium pntothente Choline dihydrogen itrte Foli id.2.2 Inositol Niin Pyridoxine HCl Rioflvin Thimine HCl Dry Vit. A Plmitte (5 K U/g).4.4 Dry Vit. D3 (5 K U/g) Dry Vit. E Aette (5 U/g) Vit. K1 (phylloquinone) Soy protein nd surose were dded to provide equivlent mro nutrient nd lorie yield. FBE in powdered form ontins 5% dextrin, 25.1% rohydrte, 17.9% protein, 4.7% moisture, nd 2% sh. RNA preprtion nd quntittive RT-PCR. Totl RNA ws isolted from livers tht hd een stored in RNAlter (Amion Jpn, Tokyo). RNA ws extrted y tissue disruption in gunidine isothioyntesed regent (Isogen, Nippon Gene, Toym, Jpn) with ed-type homogenizer Miro Smsh MS-1 (Tomy Seiko Co., Tokyo) ording to the mnufturer s instrutions. The integrity of the isolted RNA ws exmined y grose gel eletrophoresis, nd its onentrtion ws determined on the sis of the sorne vlues t 26 nm. The DNA ws synthesized from 5 mg of totl RNA dentured with oligo-dt/ rndom primers nd 1 mm dntp (GE Helthre Biosienes, Tokyo) t 65 C. The dentured RNA ws inuted in 5 mm Tris HCl ph 8.3, 75 mm KCl, 3 mm MgCl 2,5mM DTT, 5 units of Supersript III reverse trnsriptse (Invitrogen, Crlsd, CA), nd 2 units of RNse inhiitor RNseOUT (Invitrogen). The DNA synthesis protool ws s follows: 25 C for 5 min, followed y 5 C for 6 min nd finlly 7 C for 15 min using Tkr PCR Therml yler MP (Tkr Biomedils, Shig, Jpn). Aliquots of the synthesized DNA were used s the templte for quntittive RT-PCR, whih ws performed with the ABI 73 Rel Time PCR System (Applied Biosystems, Foster City, CA) ording to the mnufturer s instrutions. To mesure the levels of trnsription, the mrna levels were first normlized to the mrna level of eukryoti elongtion ftor 1-1 (Eef11), nd then ompred with the mrna levels of the ontrols to determine reltive expression. 21) The sequenes of primers used in eh gene expression ssy re shown in Tle 2. Sttistil nlysis. Vlues re represented s the men vlue with stndrd error (SE). One-wy nlysis of vrine followed y the Fisher lest signifint differene (LSD) test ws used to evlute differenes etween groups, unless otherwise stted. SPSS version 11. (SPSS, Chigo, IL) ws used for ll dt omputtion. Sttistil signifine ws determined t p < :5 or lower.
3 Tle 2. Fermented Brley Extrt Suppresses Inflmmtion in Rts 1973 Sequenes of Primers Used for PCR Amplifition in the Quntittive RT-PCR Assy Gene 1 Forwrd primer Reverse primer Eef11 GATGGCCCCAAATTCTTGAAG GGACCATGTCAACAATTGCAG Il-1 GCTGACAGACCCCAAAAGATT ATCTGGACAGCCCAAGTCAA Il-6 AGAGGAGACTTCACAGAGGATACC AATCAGAATTGCCATTGCACAAC Tnf- TAATGCTGATTTGGTGACCAGG GTAGGGCGATTACAGTCACGG Cl2 AAGAAGCTGTAGTATTTGTCAC ATCTCACTTGGTTCTGGTC Vm1 ATGGGAAGGTGAAGACAG TAGGGAATGAGTAGATGTCCA Sele GGAAGAAAGCAAAGAAATTCG TATTTCCCATGATGCATTTGTG Nos2 ACCTTCAGGTATGCGGTATTTG CTGGTCGATGTCATGAGCAAAG Ct AGCCTCCTCAGCCTGCACT GGCTTGTGCCCTGCTTCA Sod1 GGCCGTACTATGGTGGTCCA TCCACCTTTGCCCAAGTCAT Gpx1 TGACCGACCCCAAGTACATCA AAATGTCGTTGCGGGACAC 1 Eef11, eukryoti elongtion ftor 11; Il-1, interleukin-1; Il-6, interleukin-6; Tnf-, tumor nerosis ftor-; Cl2, hemokine (C-C motif) lignd 2; Vm1, vsulr ell dhesion moleule 1; Sele, seletin e; Nos2, induile nitri oxide synthse; Ct, tlse; Sod1, ytosoli superoxide dismutse 1; Gpx1, glutthione peroxidse 1 A Plsm IL-1β B % FBE Conentrtion (pg/ml) Conentrtion (pg/ml) Plsm IL-6 1% FBE Plsm ALT tivity A 5 Ativity (IU/L) % FBE B 1 Ativity (IU/L) Plsm AST tivity 1% FBE C Plsm TNF-α Plsm NO 2/NO % FBE 1% FBE Conentrtion (pg/ml) Fig. 1. Fermented Brley Extrt (FBE) Supplementtion Suppressed Plsm Inflmmtory Cytokines nd NO Conentrtions fter Lipopolyshride (LPS) Chllenge. LPS-indued elevted primry inflmmtory ytokines interleukin (IL)-1 (A), IL-6 (B), nd tumor nerosis ftor (TNF)- (C) in the plsm were suppressed y FBE supplementtion. (D) LPS-indued inflmmtion inresed NO levels in the plsm, ut ws suppressed y FBE. All vlues re men SE; (n ¼ 6). Different letters indite signifint differene t p < :5. Ethil guidelines. We onduted the niml experiments s humnely s possile in ordne with the guidelines for ethil tretment of nimls in sientifi reserh pproved y the Animl Reserh-Animl Cre Committee of the Grdute Shool of Agriulturl Sienes, Tohoku University (no. 5-8B). Results FBE suppressed inflmmtory ytokines nd NO onentrtion in plsm A 1-d feeding durtion did not indue signifint differenes in ody weight gin, verge dily feed intke, or wter intke. For this durtion, the verge weight inrese for rts in groups Con, Conþ nd 1% FBE were 37:3 4:6 g, 33:7 4:3 g, nd 32:4 4:7 g respetively. The verge feed intke for Con, Conþ, nd 1% FBE were 9: :28 g, 8:7 :52 g, nd 9:1 :55 g respetively. We oserved in preliminry experiments tht the effetive FBE supplementtion onentrtion ws 1%, euse lower dose (4%) ws ineffetive to exert nti-inflmmtory effet, nd higher dose resulted in lower dietry intke nd dirrhe (dt not shown). As D Conentrtion (mm) Fig. 2. FBE Suppressed LPS-Indued Liver Dmge. Rts supplemented with FBE showed llevition of LPS-indued plsm lnine minotrnsferse (ALT) (A) nd sprtte minotrnsferse (AST) (B) tivities. All vlues re men SE (n ¼ 6). Different letters indite signifint differene t p < :5. oserved in Fig. 1A C, the levels of ll plsm inflmmtory ytokines were highly elevted in the LPS-hllenged groups, ut FBE supplementtion signifintly inhiited exessive expression of these ytokines. It ws lso oserved tht the FBE-supplemented group showed signifint inhiition in the plsm NO onentrtion (Fig. 1D). The redued plsm onentrtion of these inflmmtory inditors indites tht FBE effetively llevited LPS-indued inflmmtion. FBE llevited liver injury indued y LPS hllenge One of the first signs of LPS hllenge is injury to the liver, euse LPS n rrive in hepti tissue s erly s 3 min fter tretment. In the present study, we otined signifint repression of LPS-indued liver injury, s mrked y sustntil derese in plsm ALT tivity (Fig. 2A). Although the plsm AST tivity of the FBE-supplemented group did not signifintly derese, inditing other exessive tissue injury (Fig. 2B), our results indite tht speifi liver dmge ws inhiited y supplementtion of FBE. Supplementtion of FBE inhiited overexpression of the NF-B trget genes After we found evidene tht FBE exhiits hepti protetive tivity, we further investigted the hnge in gene expression of the liver to eluidte the mehnism of FBE. It ws pprent tht inflmmtory gene expression ws suppressed in the livers of the FBEsupplemented rts (Fig. 3A C) in ongruene with the repressed plsm ytokine levels. It ws lso pprent tht other NF-B trget genes were trnsriptionlly inhiited, s indited y the signifint suppression of hemokine (C-C motif) lignd (Cl2), vsulr ell
4 1974 P. E. GIRIWONO et l. A 3. Reltive expression Liver IL-1β C Reltive expression 4 2 E 5. Reltive expression G 4. Reltive expression Liver Vm1 Liver Nos2 1% FBE 1% FBE 1% FBE 1% FBE B 6. Liver IL-6 dhesion moleule 1 (Vm1), seletin e (Sele), nd induile nitri oxide synthse (Nos2) (Fig. 3D G). Reltive expression D Reltive expression Liver Cl-2 1% FBE 1% FBE Liver Sele1 F % FBE Fig. 3. FBE Supplementtion Suppressed Liver mrna Expression of Inflmmtory Genes. Rts supplemented with FBE showed deresed expression of inflmmtory genes Il-1 (A), Il-6 (B), nd Tnf- (C). Other trget genes of NF-B tivtion, notly Cl2 (D), Vm1 (E), Sele1 (F), nd Nos2 (G), were downregulted y FBE supplementtion. All vlues re men SE (n ¼ 6). Different letters indite signifint differene t p < :5. Reltive expression FBE supplementtion sustined liver nd plsm ntioxidtive defense Expression of ntioxidtive genes in the liver of LPShllenged rts ws found to e highly suppressed s result of NF-B tivtion nd susequent ROS prodution. However, it ws oserved tht these ntioxidtive genes in the livers of the FBE-supplemented rts were llevited of their otherwise downregulted trnsription, s in Conþ (Fig. 4A C). This ws presumly due to the ntioxidtive nture of FBE, s previously reported. 18) Furthermore, FBE sustined the liver enzymti tivities of GPx, CAT, nd SOD (Fig. 4D F), onsistent with the improved gene expression. This ws further evident in the signifintly improved plsm tivities of CAT nd SOD (Fig. 4G H). In ddition, the expression of Nos2, whih is lso highly expressed in the liver in ddition to the mrophges, ws suppressed fter LPS hllenge y FBE supplementtion (Fig. 3G), thus inhiiting enhned plsm NO levels, whih my indue nd propgte further systemi inflmmtion (Fig. 1D). Furthermore plsm 8-OHdG levels, nother oxidtive mrker, were signifintly deresed y FBE supplementtion (Fig. 4I). Together, these results suggest tht the ntioxidtive tivity of FBE llevites the propgtion of ROS-indued inflmmtion nd orgn dmge under LPS hllenge. Disussion Ativtion of NF-B hs een shown to e inhiited y vriety of plnt nd fruit extrts in numerous studies. Grins, suh s rley, ontin phytohemils omprle to those of fruits. In prtiulr, the polyphenols of rley nd extrts of fermented rley show potent inhiitory effet of NF-B. This effet is possily ttriutle to its ntioxidtive property. In the present study, we showed tht n extrt of fermented derivtives of rley, previously reported to inhiit oxidtive stress indued y hroni lohol onsumption, 18) prevented liver dmge in response to LPS hllenge nd sustntil oxidtive stress. Supplementtion of FBE t 1% w/w in the diet of rts for 1 d effetively suppressed the plsm levels of inflmmtory ytokines (IL-1, IL-6, nd TNF-) fter LPS hllenge. Furthermore, the plsm NO onentrtion in the FBE-supplemented rts signifintly deresed s ompred to n LPS-treted ontrol inditing ler llevition of the systemi inflmmtory response nd derese in oxidtive stress. Suppression of inflmmtory ytokines suh s IL-6 ws oserved in the mie supplemented with rley foodstuff. 22) It ws lso reported tht onsumption of grin helps to prevent inreses in the levels of plsm inflmmtory proteins suh s C-retive protein nd plsminogen tivtor inhiitor-1 in humn tril. 23) Our study orroortes these oservtions euse FBE ws extrted from whole-grin rley fter fermenttion. Additionlly, it hs een reported tht fermenttion y koji (Aspergillus wmori mut.) in nother rewing produt yielded enefiil effet in inresed ntioxidtive tion due to phenoli ids. 8) Furthermore, it ws desried tht koji fermenttion hydrolyzes ffeoylquini id nd its derivtives to form ffei id nd quini id. 8) Seondry metolites of some Aspergillus speies generted in fermenttion hve een isolted nd shown to e ntioxidnts. 24) Regrdless of the effets of fermenttion, FBE s n end produt residue should ontin n inresed onentrtion of polyphenols s ompred to the originl rley onstituents. Whether suh phenoli ids or ntioxidnts re undnt in FBE or ply mjor role in its nti-inflmmtory tion requires further study. The inflmmtory response of NF-B to stimuli suh s LPS involves signling sdes strting with the inding of LPS to TLR4, thus tivting Myd88. This in turn initites phosphoryltion of Irk1, Trf6, Tk1, nd finlly the IKK omplex. The tivtion (phosphoryltion) of IKK is ritil in the phosphoryltion of IB, leding to its protesoml degrdtion nd the nuler trnslotion of NF-B. Ativtion of NF-B expresses numerous genes tegorized s ytokines nd growth ftors (interleukins nd TNF-), dhesion moleules (Vm nd Im), nd induile Nos2, leding to inreses in NO nd oxidtive stress, nd then ours orgn injury ,25) The undne of NO ts further to tivte NF-B nd the propgtion of inflmmtion, inititing forwrd loop. It is t this point tht
5 Fermented Brley Extrt Suppresses Inflmmtion in Rts 1975 A Reltive expression Liver Ct % FBE D Ativity (nmol/min. mg protein) G Ativity (nmol/min. mg protein) Liver tlse tivity 1% FBE Plsm tlse tivity % FBE B Reltive expression E Ativity (U/mg protein) H Ativity (U/mg protein) Liver Gpx % FBE Liver SOD tivity % FBE Plsm SOD tivity 1% FBE C Reltive expression F Ativity (nmol/min. mg protein) I Conentrtion (ng/ml) Liver Sod % FBE Liver GPx tivity % FBE Plsm 8-OHdG 1% FBE Fig. 4. Antioxidtive Defense Ws Mintined in FBE-Supplemented Rts. FBE supplementtion signifintly improved LPS-indued downregultion of ntioxidtive genes tlse (Ct) (A), glutthione peroxidse 1 (Gpx1) (B), nd superoxide dismutse 1 (Sod1) (C) in the rt liver. FBE enhned the tivities of the respetive ntioxidtive enzymes: CAT (D), SOD (E), nd GPx (F) in the rt liver. It showed enhned irultory ntioxidtive defense in plsm mrked y CAT (G) nd SOD (H) tivities. These effets resulted in redued levels of oxidtive stress inditors 8-hydroxy-2 -deoxygunosine (8-OHdG) (I). All vlues re men SE (n ¼ 4{6). Different letters indite signifint differene t p < :5. supplementtion with potent ntioxidtive gents is onsidered to e vlule in inhiiting this yle. Liver gene expression in the FBE-supplemented rts indites inhiition of NF-B tivtion, s mrked y sustntil trnsriptionl suppression of inflmmtory trget genes s ompred to the non-supplemented group (Fig. 3). The ntioxidtive nture of FBE my suppress oxidtive stress derived from NO generted y LPS nd further tivtion of NF-B. In one study, FBE inhiited oxidtive stress indued y hroni lohol onsumption. 18) A study onduted y Hole et l. 2) found tht extrts from grins, inluding the Swedish rley Olve, effetively inhiited LPS-indued NF-B tivtion. The report disussed its poteny s modultor of signl trnsdution moleules in NF-B tivtion. In our experiment, the nti-inflmmtory effet of FBE might not hve influened these moleules (Myd88, Irk1, Trf6, nd Tk1), euse the expression of these genes ws not ltered y FBE supplementtion (dt not shown). We oserved signifintly enhned mrna expression of ntioxidtive enzymes nd higher tivities of them in the FBE-supplemented group (Fig. 4). These dt orrespond with our previous experiment. 18) Thus FBE shows potent enhnement of the expression of these ntioxidtive enzymes in ddition to its intrinsi ntioxidtive tivity. Upregultion of these enzymes n eliminte ROS generted y LPS tretment nd inhiit further tivtion of NF-B in the ROS NFB forwrd loop. The mehnism involved in the enhnement of these ntioxidtive enzymes y FBE my e due to tivtion of Nrf2, 26) ut further investigtion is required. Additionlly, n nti-inflmmtory effet of rley 22) nd other fermented grin produts ws reported in oloretl inflmmtory mouse model, 19) nd FBE ws reported to inhiit inflmmtory ytokines in PiClhllenged NC/Ng mie, simulting topi dermtitis. 27,28) In these studies, rley nd fermented grin produts suppressed inflmmtion vi pthwys different from NF-B inhiition, suh s interferon- nd IL-4 signling. We did not mesure the onentrtions of IL-4, IgE or the tivtion of nive T ells. Thus some of the nti-inflmmtory effet of FBE shown in this study my e medited y its involvement in pthwys other thn NF-B tivtion. In this study, we showed tht FBE ws le to suppress LPS-indued inflmmtion nd liver dmge in rts signifintly. FBE mintined signifintly lower NO onentrtion fter the onentrtion inresed exessively due to LPS hllenge, demonstrting one importnt key in preventing further inflmmtory propgtion. This effet ws hieved y n inrese in liver nd plsm ntioxidtive enzyme tivities s result of FBE supplementtion. Further investigtion is required to determine speifilly whih omponent of FBE hs highest tivity, nd whether this prtiulr omponent tivtes the trnsription of ntioxidtive genes. Aknowledgment This study ws supported in prt y the Iijim Memoril Foundtion for the Promotion of Food Siene nd Tehnology.
6 1976 P. E. GIRIWONO et l. Referenes 1) Ruidvets JB, Bongrd V, Dllongeville J, Arveiler D, Duimetière P, Perret B, Simon C, Amouyel P, nd Ferrières J, J. Epidemiol. Commun. Helth, 61, (27). 2) Hole AS, Grimmer S, Nterstd K, Jensen MR, Pur I, Johnsen SG, Blstd TR, Blomhoff R, nd Shlstrøm S, J. Agri. Food Chem., 57, (29). 3) Behll KM, Sholfield DJ, nd Hllfrish JG, Nutr. Res., 26, (26). 4) Perez-Jimenez J nd Sur-Clixto F, J. Agri. Food Chem., 53, (25). 5) Brennn CS nd Clery LJ, J. Cerel Si., 42, 1 13 (25). 6) Mttil P, Pihlv JM, nd Hellström J, J. Agri. Food Chem., 53, (25). 7) Ye XJ, Morimur S, Hn SL, Shigemtsu T, nd Kid K, Biosi. Biotehnol. Biohem., 68, (24). 8) Yoshimoto M, Kurt-Azum R, Fujii M, Hou DX, Iked K, Yoshidome T, nd Osko M, Biosi. Biotehnol. Biohem., 68, (24). 9) Heinen MM, Hughes MC, Iieele TI, Mrks JC, Green AC, nd vn der Pols JC, Eur. J. Cner, 43, (27). 1) Serfini M, Belloo R, Wolk A, nd Ekström AM, Gstroenterology, 123, (22). 11) Krin M, Co Y, Greten FR, nd Li ZW, Nt. Rev. Cner, 2, (22). 12) Vlen G, Yn ZQ, nd Hnsson GK, J. Am. Coll. Crdiol., 38, (21). 13) Mttson MP nd Cmndol S, J. Clin. Invest., 17, (21). 14) Feldmnn M, Andrekos E, Smith C, Bondeson J, Yoshimur S, Kirikidis S, Mono C, Gsprini C, Sre S, Lunderg A, Pleolog E, Horwood NJ, Brennn FM, nd Foxwell BMJ, Ann. Rheum. Dis., 61, ii13 ii18 (22). 15) Christmn JW, Sdikot RT, nd Blkwell TS, Chest, 117, (2). 16) Neurth MF, Beker C, nd Brulesu K, Gut, 43, (1998). 17) Hlvorsen BL, Holte K, Myhrstd MCW, Brikmo I, Hvttum E, Remerg SF, Wold A, Hffner K, Bugerød H, Andersen LF, Moskug JØ, Jos DR, nd Blomhoff R, J. Nutr., 132, (22). 18) Giriwono PE, Hshimoto T, Ohski Y, Shirkw H, Hokzono H, nd Komi M, Food Res. Int., 43, (21). 19) Phutthphdoong S, Ymd Y, Hirt A, Tomit H, Hr A, Limtrkul P, Iwski T, Koyshi H, nd Mori H, Onol. Rep., 23, (21). 2) Ohski Y, Shirkw H, Hiwtshi K, Furukw Y, Mizutni T, nd Komi M, Biosi. Biotehnol. Biohem., 7, (26). 21) Shirkw H, Ohski Y, Minegishi Y, Tkumi N, Ohint K, Furukw Y, Mizutni T, nd Komi M, Biohim. Biophys. At, 176, (26). 22) Knuhi O, Oshim T, Andoh A, Shioy M, nd Mitsuym K, Snd. J. Gstroenterol., 43, (28). 23) Msters RC, Liese AD, Hffner SM, Wgenkneht LE, nd Hnley AJ, J. Nutr., 14, (21). 24) Miyke Y, Ito C, Itoigw M, nd Osw T, Biosi. Biotehnol. Biohem., 71, (27). 25) Psprkis M, Nt. Rev. Immunol., 9, (29). 26) N HK nd Surh YJ, Food Chem. Toxiol., 46, (28). 27) Hokzono H, Omori T, nd Ono K, Biosi. Biotehnol. Biohem., 74, (21). 28) Iguhi T, Kwt A, Wtne T, Mzumder TK, nd Tne S, Biosi. Biotehnol. Biohem., 73, (29).
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationDepartment of Animal Resource and Science, Dankook University, Cheonan, Choongnam, , Republic of Korea
British Journl of Nutrition (1), 115, 57575 The Authors 1 doi:1.117/s711515857 Ltoillus idophilus modultes inflmmtory tivity y regulting the TLR nd NF-κB expression in porine peripherl lood mononuler ells
More informationToxicity effects of seven Cu compounds/nps in Lettuce (Lactuca sativa) and Alfalfa (Medicago sativa)
Toxiity effets of seven Cu ompounds/nps in Lettue (Ltu stiv) nd Alflf (Medigo stiv) Jie Hong, Lijun Zho, Cyren Rio, Jose R Perlt-Vide, Jorge Grde-Torresdey The University of Texs t El Pso UC-CEIN Theme
More informationIranian Food Science and Technology Research Journal Vol. 6, No. 3, Fall, 2010.
Irnin Food Siene nd Tehnology Reserh Journl Vol. 6, No. 3, Fll, 2010. rvghi.mrym@gmil.om C ( AOAC 920.87 AOAC 942.05 AOAC 962.09 AOAC 922.06 AOAC 925.10 AACC 1- Extrusion-Expelling 2- Protein Dispersiility
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationErucin Exerts Anti-Inflammatory Properties in Murine Macrophages and Mouse Skin: Possible Mediation through the Inhibition of NFκB Signaling
Int. J. Mol. Si. 213, 14, 2564-2577; doi:1.339/ijms1412564 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Eruin Exerts Anti-Inflmmtory Properties in Murine
More informationSupplementary information to accompany the manuscript entitled:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementry informtion to ompny the mnusript entitled: A mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity
More informationThe Body Vitamin B 1 Levels of Rats Fed a Diet Containing the Minimum Requirement of Vitamin B 1 Is Reduced by Exercise
J Nutr Si Vitminol, 59, 87 92, 213 The Body Vitmin B 1 Levels of Rts Fed Diet Contining the Minimum Requirement of Vitmin B 1 Is Redued y Exerise Ktsumi Shit nd Tsutomu Fukuwtri Deprtment of Food Siene
More informationMoukette et al. Biological Research (2015) 48:15 DOI /s
Moukette et l. Biologil Reserh (2015) 48:15 DOI 10.1186/s40659-015-0003-1 RESEARCH ARTICLE Open Aess In vitro ntioxidnt properties, free rdils svenging tivities of extrts nd polyphenol omposition of non-timber
More informationBioactive Constituents from Triguero Asparagus Improve the Plasma Lipid Profile and Liver Antioxidant Status in Hypercholesterolemic Rats
Int. J. Mol. Si. 213, 14, 21227-21239; doi:1.339/ijms141121227 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Biotive Constituents from Triguero Asprgus Improve
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationJOURNAL OF ENVIRONMENTAL SCIENCES 34 (2015) Available online at ScienceDirect
JOURNAL OF ENVIRONMENTAL SCIENCES 4 (5) 9 99 Aville online t www.sienediret.om SieneDiret www.journls.elsevier.om/journl-of-environmentl-sienes Effets of nitrogen dioxide nd its id mist on retive oxygen
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSupplemental epilactose prevents metabolic disorders through uncoupling protein-1 induction in the skeletal muscle of mice fed high-fat diets
British Journl of Nutrition (215), 114, 1774 1783 The Authors 215 doi:1.117/s7114515355 Supplementl epiltose prevents metoli disorders through unoupling protein-1 indution in the skeletl musle of mie fed
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationResearch Article A Comparison of Inflammatory and Oxidative Stress Markers in Adipose Tissue from Weight-Matched Obese Male and Female Mice
Hindwi Pulishing Corportion Experimentl Dietes Reserh Volume 1, Artile ID 859395, 8 pges doi:1.1155/1/859395 Reserh Artile A Comprison of Inflmmtory nd Oxidtive Stress Mrkers in Adipose Tissue from Weight-Mthed
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationHydrodynamic Delivery of mil10 Gene Protects Mice From High-fat Diet-induced Obesity and Glucose Intolerance
originl rtile The Amerin Soiety of Gene & Cell Therpy Hydrodynmi Delivery of mil Gene Protets Mie From High-ft Diet-indued Oesity nd Gluose Intolerne Mingming Go, Chuno Zhng, Yongjie M, Le Bu, Linn Yn
More informationBritish Journal of Nutrition
(1), 11, 8 87 q The Authors 1 doi:1.117/s711117x Chnges in plsm mino id profiles, growth performne nd intestinl ntioxidnt pity of piglets following inresed onsumption of methionine s its hydroxy nlogue
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationMesozeaxanthin protects the liver and reduces cardio-metabolic risk factors in an insulin resistant rodent model
FOOD & NUTRITION RESEARCH, 217 VOL. 61, 135336 https://doi.org/1.18/16546628.217.135336 ARTICLE Mesozexnthin protets the liver nd redues rdio-metoli risk ftors in n insulin resistnt rodent model Kzim Shin,
More informationRaina Devi Ramnath, Jia Sun, and Madhav Bhatia. Department of Pharmacology, National University of Singapore, Singapore
-3565/9/39-48 48$. THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 39, No. Copyright 9 y The Amerin Soiety for Phrmology nd Experimentl s 48684/346663 JPET 39:48 48, 9 Printed in U.S.A.
More informationJournal of Integrative Agriculture 2017, 16(0): Available online at ScienceDirect. , ZHU Dan-shi
Journl of Integrtive griulture 17, 1(): 345-7 ville online t www.sienediret.om SieneDiret RESERCH RTICLE Effets of thimine on Trihotheium nd lternri rots of muskmelon fruit nd the possile mehnisms involved
More informationBeta-Glucan-Rich Extract from
Evidene-Bsed Complementry nd Alterntive Mediine Volume 2013, Artile ID 185259, 10 pges http://dx.doi.org/10.1155/2013/185259 Reserh Artile Bet-Glun-Rih Extrt from Pleurotus sjor-ju (Fr.) Singer Prevents
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationToll-Like Receptor Activation during Cutaneous Allergen Sensitization Blocks Development of Asthma through IFN-Gamma-Dependent Mechanisms
ORIGINAL ARTICLE See relted ommentry on pg 874 Toll-Like Reeptor Ativtion during Cutneous Allergen Sensitiztion Bloks Development of Asthm through IFN-Gmm-Dependent Mehnisms Rit Hpkoski 1, Pii Krisol 1,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki
More informationREVIEW Study of the Formation of trans Fatty Acids in Model Oils (triacylglycerols) and Edible Oils during the Heating Process
JARQ 46 (3), 215 220 (2012) http://www.jirs.ffr.go.jp REVIEW Study of the Formtion of trns Ftty Aids in Model Oils (triylglyerols) nd Edible Oils during the Heting Proess Wkko TSUZUKI* Food Resoure Division,
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationIntervention with citrus flavonoids reverses obesity, and improves metabolic syndrome and
Intervention with itrus flvonoids reverses oesity, nd improves metoli syndrome nd theroslerosis in oese Ldlr -/- mie Authors: Amy C. Burke 1,2, Brin G. Sutherlnd 1, Dwn E. Telford 1,3, Mris R. Morrow 1,
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationARTICLE. E. O. List & A. J. Palmer & D. E. Berryman & B. Bower & B. Kelder & J. J. Kopchick
Dietologi (2009) 52:1647 1655 DOI 10.1007/s00125-009-1402-z ARTICLE Growth hormone improves ody omposition, fsting lood gluose, gluose tolerne nd liver triylglyerol in mouse model of diet-indued oesity
More informationSalinity and drought represent serious problems worldwide negatively
PERIODICUM BIOLOGORUM UDC 57:61 VOL. 11, No 3, 93 99, 1 CODEN PDBIAD ISSN 31-536 Originl sientifi pper Effets of osmoti stress on ntioxidtive system of dukweed (Lemn minor L) SANDRA RADI] BRANKA PEVALEK-KOZLINA
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationEffects of exogenous nitric oxide on cadmium toxicity and antioxidative system in perennial ryegrass
Journl of Soil Siene nd Plnt Nutrition, 218, 18 (1), 129-143 RESEARCH ARTICLE Effets of exogenous nitri oxide on dmium toxiity nd ntioxidtive system in perennil ryegrss Chen, Weifeng 1, Dong, Yunjie 1*,
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationNephroprotective and Antioxidant Effects of Parsley Plant Parts Against Gentamicin-Induced Nephrotoxicity in Rats
Ademi Journl of Nutrition 4 (3): 113-122, 2015 IN 2309-8902 IDI Pulitions, 2015 DI: 10.5829/idosi.jn.2015.4.3.10417 Nephroprotetive nd Antioxidnt Effets of Prsley Plnt Prts Aginst Gentmiin-Indued Nephrotoxiity
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationThe Protection of Anthrodia camphorata against Acute Hepatotoxicity of Alcohol in Rats
177 Journl of Food nd Drug Anlysis, Vol. 11, No. 3, 23, Pges 177-185 The Protetion of Anthrodi mphort ginst Aute Heptotoxiity of Alohol in Rts YU-YUN DAI, CHENG-HUNG CHUANG, CHIN-CHUAN TSAI, HOK-MAN SIO,
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationCombined Effects of Methionine and Kiwi Fruit on Paracetamol Induced Liver Injury
World Journl of Medil Sienes 9 (1): 01-07, 2013 ISSN 1817-3055 IDOSI Pulitions, 2013 DOI: 10.5829/idosi.wjms.2013.9.1.1129 Comined Effets of Methionine nd Kiwi Fruit on Pretmol Indued Liver Injury Rsh
More informationChemosphere 84 (2011) Contents lists available at ScienceDirect. Chemosphere. journal homepage:
Chemosphere 84 (211) 63 69 Contents lists ville t SieneDiret Chemosphere journl homepge: www.elsevier.om/lote/hemosphere Clium protets roots of Sedum lfredii H. ginst dmium-indued oxidtive stress Shengke
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationNutrition Guide. National Swine. Trace Minerals and Vitamins for Swine Diets. Introduction. Objectives. Minerals required
Ntionl Swine Nutrition Guide Tre Minerls nd Vitmins for Swine Diets Introdution Authors Dune E. Reese, University of Nersk Grethen Myers Hill, Mihign Stte University Reviewers Donnie Cmpell, DSM Nutritionl
More informationHypothermia is better than ischemic preconditioning for preventing early hepatic ischemia/reperfusion in rats
11 ORIGINAL ARTICLE Jnury-Ferury, Vol. 15 No. 1, 216: 11-12 The Offiil Journl of the Mexin Assoition of Heptology, the Ltin-Amerin Assoition for Study of the Liver nd the Cndin Assoition for the Study
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationEffect of Prebiotics Inulin and Mannan on Lipid Profile and Intestinal Micro Flora of Hypercholesterolemic Rats
J. Appl. Environ. Biol. Si., 6(8)22-31, 216 216, TextRod Pulition ISSN: 29-4274 Journl of Applied Environmentl nd Biologil Sienes www.textrod.om Effet of Preiotis Inulin nd Mnnn on Lipid Profile nd Intestinl
More informationEffects of Plant Sphingolipids on Inflammatory Stress in Differentiated Caco-2 Cells
Journl of Oleo Siene Copyright 2017 y Jpn Oil Chemists Soiety doi : 10.5650/jos.ess17171 J. Oleo Si. 66, (12) 1337-1342 (2017) NOTE Effets of Plnt Sphingolipids on Inflmmtory Stress in Differentited Co-2
More informationOZONE TREATMENT REDUCES MARKERS OF OXIDATIVE AND ENDOTHELIAL DAMAGE IN AN EXPERIMENTAL DIABETES MODEL IN RATS
Phrmologil Reserh, Vol. 44, No. 5, 21 doi:1.16/phrs.21.867, ville online t http://www.idelirry.om on OZONE TREATMENT REDUCES MARKERS OF OXIDATIVE AND ENDOTHELIAL DAMAGE IN AN EXPERIMENTAL DIABETES MODEL
More informationBritish Journal of Nutrition
British Journl of Nutrition (2014), 111, 445 451 q The Authors 2013 doi:10.1017/s0007114513002584 PUFA rtio is involved in regulting lipid metolism nd inflmmtion in pigs Yehui Dun 1,2, Fengn Li 1 *, Lili
More informationChanges in Protease Activity and Proteins in Naked Oats (Avena nuda L.) during Germination
Asin Journl of Agriulture nd Food Sienes (ISSN: 2321 1571) Chnges in Protese Ativity nd Proteins in Nked Ots (Aven nud L.) during Germintion Ling-Ling Zhng 1 nd Jin-Guo Xu *1,2 1 College of Life Sienes,
More informationEffects of Feeding Citrus Pulp or Corn Supplements With Increasing Levels of Added Undegraded Intake Protein on the Performance of Growing Cattle
Effets of Feeding Citrus Pulp or Corn Supplements With Inresing Levels of Added Undegrded Intke Protein on the Performne of Growing Cttle Deke Alkire Todd Thrift Willim Kunkle 1 Citrus pulp-sed supplements
More informationResearch Article TNF-α and IFN-s-Dependent Muscle Decay Is Linked to NF-κB- and STAT-1α-Stimulated Atrogin1 and MuRF1 Genes in C2C12 Myotubes
Hindwi Pulishing Corportion Meditors of Inflmmtion Volume 213, Artile ID 171437, 18 pges http://dx.doi.org/1.1155/213/171437 Reserh Artile nd IFN-s-Dependent Musle Dey Is Linked to NF-κB- nd STAT-1α-Stimulted
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationSupplementary Information
Supplementry Informtion A new lss of plnt lipid is essentil for protetion ginst phosphorus depletion Yozo Okzki 1, Hitomi Otsuki 1, Tomoko Nrisw 1, Mkoto Koyshi 1, Storu Swi 2, Yukiko Kmide 1, Miyko Kusno
More informationInternational Journal of Pharma and Bio Sciences
Int J Phrm Bio Si 2013 Ot; 4(4): (B) 427-436 Reserh Artile BioChemistry Interntionl Journl of Phrm nd Bio Sienes ISSN 0975-6299 SILDENAFIL ALLEVIATES INSULIN SENSITIVITY VIA ATTENUATING OXIDATIVE STRESS
More informationSpecific Immunotherapy in Atopic Dermatitis Four- Year Treatment in Different Age and Airborne Allergy Type Subgroups
At Dermtovenerol Crot 2006;14(4):230-240 CLINICAL ARTICLE Speifi Immunotherpy in Atopi Dermtitis Four- Yer Tretment in Different Age nd Airorne Allergy Type Sugroups Mgdlen Czrnek-Operz, Wojieh Silny Deprtment
More informationInfluence of Ad libitum or Control Feeding on the Performance of Broilers Fed Diets Low in Crude Protein 1
Interntionl Journl of Poultry Siene 4 (5): 74-79, 005 ISSN 168-8356 Asin Network for Sientifi Informtion, 005 Influene of Ad liitum or Control Feeding on the Performne of Broilers Fed Diets Low in Crude
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationLIPIDOMICS OF BLOOD AND ORGANS OF RATS FED DIETS SUPPLEMENTED WITH DIFFERENT EDIBLE OILS
Animl Reserh Interntionl (215) 12(2): 2189 222 2189 LIPIDOMICS OF BLOOD AND ORGANS OF RATS FED DIETS SUPPLEMENTED WITH DIFFERENT EDIBLE OILS 1 UGBAJA, Regin Ngozi, 2 AFOLABI, Olusegun Kyode, 1 ONUNKWOR,
More informationa SpringerOpen Journal
Kumr et l. SpringerPlus 213, 2:639 SpringerOpen Journl RESEARCH Open Aess Enhned glyemi ontrol, pnres protetive, ntioxidnt nd heptoprotetive effets y umelliferon-α-d-gluopyrnosyl-(2 I 1 II )-α-dgluopyrnoside
More informationProtective role of Zingiber officinale Roscoe on Aceclofenac induced oxidative stress in rat liver
Interntionl Journl of PhrmTeh Reserh CODEN (USA): IJPRIF ISSN : 974-434 Vol.2, No.1, pp 495-51, Jn-Mr 21 Protetive role of Zingier offiinle Rosoe on Aelofen indued oxidtive stress in rt liver Drr S, Bose
More informationComparative Efficacy of DL-Methionine and Herbal Methionine on Performance of Broiler Chicken
Interntionl Journl of Poultry Siene 5 (11): 1034-1039, 2006 ISSN 1682-8356 Asin Network for Sientifi Informtion, 2006 Comprtive Effiy of DL-Methionine nd Herl Methionine on Performne of Broiler Chiken
More informationResearch Article Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice
Hindwi Pulishing Corportion Evidene-Bsed Complementry nd Alterntive Mediine, Artile ID 718379, 14 pges http://dx.doi.org/1.1155/214/718379 eserh Artile Deffeinted Green Coffee Ben Extrt Attenutes Diet-Indued
More informationA. B. C. Succiniclasticum. Paraprevotella. Control DPA EPA DHA Control DPA EPA DHA a b. a a. b c.
389 Session 2: Miroil eosystem nd herivore nutrition Effet of dietry ddition of EPA, DPA nd DHA on rumen teril ommunity in ows nd ewes. An in vitro pproh Dvid Crreño 1, Álvro Belenguer 1, Eri Pinlohe 2,
More informationAntihypertensive and Antioxidant Potential of Borneol-A Natural Terpene in L- NAME Induced Hypertensive Rats
ISSN 0976 3333 Aville Online t www.ijp.info. Interntionl Journl of Phrmeutil & Biologil Arhives 2010; 1(3): 271 279. ORIGINAL RESEARCH ARTICLE Antihypertensive nd Antioxidnt Potentil of Borneol-A Nturl
More informationEffects of Lemmon Grass (Cymbopogon citratus) Leaf Meal Feed Supplement on Growth Performance of Broiler Chicks
Interntionl Journl of Poultry Siene 9 (12): 1107-1111, 2010 ISSN 1682-8356 Asin Network for Sientifi Informtion, 2010 Effets of Lemmon Grss (Cymopogon itrtus) Lef Mel Feed Supplement on Growth Performne
More informationThe microrna mir-31 inhibits CD8 + T cell function in chronic viral infection
A rt i l e s The mirorna mir-3 inhiits CD8 + T ell funtion in hroni virl infetion Howell F Moffett, Adm N R Crtwright, Hye-Jung Kim, Jernej Gode, Json Pyrdol, Trmo Äijö 3, Gustvo J Mrtinez,6, Anjn Ro,
More informationLipid Composition of Egg Yolk and Serum in Laying Hens Fed Diets Containing Black Cumin (Nigella sativa)
Interntionl Journl of Poultry Siene 5 (6): 574-578, 2006 ISSN 682-8356 Asin Network for Sientifi Informtion, 2006 Lipid Composition of Egg Yolk nd Serum in Lying Hens Fed Diets Contining Blk Cumin (Nigell
More informationEffect of Prebiotic (Fermacto) in Low Protein Diet on Performance and Carcass Characteristics of Broiler Chicks
Interntionl Journl of Poultry Siene 6 (9): 661-665, 2007 ISSN 1682-8356 Asin Network for Sientifi Informtion, 2007 Effet of Preioti (Fermto) in Low Protein Diet on Performne nd Crss Chrteristis of Broiler
More informationResearch Article The Protection of Hepatocyte Cells from the Effects of Oxidative Stress by Treatment with Vitamin E in Conjunction with DTT
Hindwi Pulishing Corportion Journl of Biomediine nd Biotehnology Volume 21, Artile ID 486267, 7 pges doi:1.1155/21/486267 Reserh Artile The Protetion of Heptoyte Cells from the Effets of Oxidtive Stress
More informationTargeting TSLP With shrna Alleviates Airway Inflammation and Decreases Epithelial CCL17 in a Murine Model of Asthma
Cittion: Moleulr Therpy Nulei Aids (216), e316; doi:1.138/mtn.216.29 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn Trgeting TSLP With shrna Allevites Airwy Inflmmtion nd Dereses
More informationAntihypertensive Efficacy of Methanol Extracts of Pisonia aculeata L. on uninephrectomized DOCA - Salt Hypertensive Rats
Int. J. Phrm. Si. Rev. Res., 44(2), My - June 217; Artile No. 48, Pges: 243-251 ISSN 976 44X Reserh Artile Antihypertensive Effiy of Methnol Extrts of Pisoni ulet L. on uninephretomized DOCA - Slt Hypertensive
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationInvestigation the Effects of Curcumin on Serum Hepatic Enzymes Activity in a Rheumatoid Arthritis Model
Investigtion the Effets of Curumin on Serum Hepti Enzymes Ativity in Rheumtoid Arthritis Model Ftemeh Aghei Borshn 1,, Mino Ilkhnipoor 1, Mohmmd Hshemi 1, Frh Frrokhi 2 1 Deprtment of Biology, Fulty of
More informationDocosapentaenoic Acid (22:5n-3) Downregulates mrna Expression of Pro-inflammatory Factors in LPS-activated Murine Macrophage Like RAW264.
Journl of Oleo Siene Copyright 217 y Jpn Oil Chemists Soiety oi : 1.565/jos.ess17111 Doospentenoi Ai (22:5n-3) Downregultes mrna Expression of Pro-inflmmtory Ftors in LPS-tivte Murine Mrophge Like RAW264.7
More informationProduction and in vivo Nutritional Evaluation of Functional Soft Cheese Supplemented with Broccoli
World Journl of Diry & Food Sienes 7 (2): 150-159, 2012 ISSN 1817-308X IDOSI Pulitions, 2012 DOI: 10.5829/idosi.wjdfs.2012.7.2.1108 Prodution nd in vivo Nutritionl Evlution of Funtionl Soft Cheese Supplemented
More informationIndian Journal of Pharmaceutical and Biological Research (IJPBR)
Indin J. Phrm. Biol. Res. 216; 4(1):63-73 Originl Reserh Artile Neuroprotetive Effet of Cinmomum zeylnium in streptozotoin indued dietes in Mie Joshi Vndn *, Kumr Arun, Kothiyl Preeti CODEN (USA): IJPB7
More informationCAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY
CAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY 1 1 2 R. K. Frnk, M. W. Vorhies, nd M. M. Chengpp Summry Cuses of dirrhe, pneumoni, nd
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationBritish Journal of Nutrition
British Journl of Nutrition (2013), 109, 394 401 q The Authors 2012 doi:10.1017/s0007114512001298 The ntioxidnt effet of -ryophyllene protets rt liver from ron tetrhloride-indued firosis y inhiiting hepti
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationExogenous catechin increases antioxidant enzyme activity and promotes flooding tolerance in tomato (Solanum lycopersicum L.)
Plnt Soil (2011) 344:213 225 DOI 10.1007/s11104-011-0741-y REGULAR ARTICLE Exogenous tehin inreses ntioxidnt enzyme tivity nd promotes flooding tolerne in tomto (Solnum lyopersium L.) Jinn-Chin Yiu & Menq-Jiu
More informationEFFECTS OF DIETARY CALCIUM LEVELS ON GROWTH-PERFORMANCE AND DIGESTIVE FUNCTION IN CATTLE FED A HIGH-FAT FINISHING DIET
EFFECTS OF DIETARY CALCIUM LEVELS ON GROWTH-PERFORMANCE AND DIGESTIVE FUNCTION IN CATTLE FED A HIGH-FAT FINISHING DIET R. A. Zinn, Y. Shen, R. Brjs, M. Montño, E. Alvrez, nd E. Rmirez Desert Reserh nd
More informationEffect of Bread Making Process on Aflatoxin Level Changes
Journl of Chemil Helth Risks (14) 4(4), 1 7 Journl of Chemil Helth Risks ORIGINAL ARTICLE Effet of Bred Mking Proess on Afltoxin Level Chnges Jfr Milni 1 *, Seyed Smn Seyed Nzri, Elmir Bmyr 1, Gisou Mleki
More informationInterdependency of Reactive Oxygen Species generating and scavenging system in salt sensitive and salt tolerant cultivars of rice
Kur et l. BMC Plnt Biology (2016) 16:131 DOI 10.1186/s12870-016-0824-2 RESEARCH ARTICLE Interdependeny of Retive Oxygen Speies generting nd svenging system in slt sensitive nd slt tolernt ultivrs of rie
More informationPartial Replacing of Concentrate Feed Mixture by Potato Processing Waste in Sheep Rations
Amerin-Eursin J. Agri. & Environ. Si., 4 (2): 156-164, 2008 ISSN 1818-6769 IDOSI Pulitions, 2008 Prtil Repling of Conentrte Feed Mixture y Potto Proessing Wste in Sheep Rtions M.A. Twil, H.A.A Omer nd
More informationSome aspects of nutritive and sensory quality of meat of restrictively fattened chickens
Chiken met qulity: T. Komprd nd J. Zelenk Some spets of nutritive nd sensory qulity of met of restritively fttened hikens T. KOMPRDA 1 * nd J. ZELENKA 2 1 Deprtment of Food Tehnology 2 Deprtment of Animl
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More information