Fermented Barley Extract Supplementation Maintained Antioxidative Defense Suppressing Lipopolysaccharide-Induced Inflammatory Liver Injury in Rats

Transcription

1 Biosi. Biotehnol. Biohem., 75 (1), , 211 Fermented Brley Extrt Supplementtion Mintined Antioxidtive Defense Suppressing Lipopolyshride-Indued Inflmmtory Liver Injury in Rts Puspo E. GIRIWONO, 1 Hitoshi SHIRAKAWA, 1;y Hideki HOKAZONO, 2 Tomoko GOTO, 1 nd Mihio KOMAI 1 1 Lortory of Nutrition, Grdute Shool of Agriulturl Siene, Tohoku University, Sendi , Jpn 2 Reserh Lortory, Snw Shurui Co., Ltd., Us , Jpn Reeived My 12, 211; Aepted July 13, 211; Online Pulition, Otoer 7, 211 [doi:1.1271/.11374] Utilizing phytohemils in treting inflmmtion is eoming vile lterntive to phrmologil tretment. We hve reported tht fermented rley extrt (FBE) effetively suppresses oxidtive stress in hronilly ethnol-fed rts. Here we report tht FBE suppressed ute inreses in oxidtive stress s response to lipopolyshride (LPS)-indued inflmmtion. Rts supplemented with FBE for 1 d showed dereses in plsm interleukin (IL)-1, IL-6, nd tumor nerosis ftor- y 25%, 34%, nd 35% respetively fter LPS hllenge. Liver dmge ws signifintly suppressed, s mrked y 44% derese in plsm lnine minotrnsferse. FBE supplementtion sustined liver ntioxidtive enzymes, tlse, glutthione peroxidse, nd superoxide dismutse, t trnsriptionl nd enzymti levels, thus suppressing oxidtive stress mrkers suh s plsm nitri oxide nd 8-hydroxy-2 -deoxygunosine, y 42% nd 23% respetively. We onluded tht tive ompounds in FBE effetively inhiited the propgtion of inflmmtion y suppressing oxidtive stress. Key words: lipopolyshride (LPS); nuler ftor kpp B (NF-B); inflmmtion; fermented rley; oxidtive stress Consumption of grins hs inresed euse of their enefiil effets in lowering the risks of rdiovsulr disese, ishemi stroke, dietes, nd metoli syndrome, in ddition to gstrointestinl ner. 1,2) Grins ontin funtionl dietry fier, vitmins, minerls, nd phytohemils tht re enefiil. Brley, in prtiulr, ontins signifint mount of phenoli ompounds, whih hve een shown to e effetive for the promotion of helth, 3 6) nd fermenttion proedures inrese the iovilility nd funtionlity of these phenoli ompounds. 7,8) These ompounds lso possess ntioxidtive properties tht n potentilly protet ginst the inreses in oxidtive stress tht hve een oserved to e involved in numer of diseses, espeilly metoli syndrome. 2,9,1) Chroni inflmmtion hs reeived prtiulr interest reently, euse it hs een linked with the progression of numerous diseses rnging from ner to insulin resistne. One of severl trnsription ftors responsile for immunologil nd ellulr stress nd inflmmtory response is nuler ftor kpp B (NF-B). Ativtion of NF-B is essentil for host defense, ut its hroni nd/or exess tivtion nd dysregultion hve een found to e involved in severl humn ners, 11) theroslerosis, 12) neurodegenertive diseses, 13) rheumtoid rthritis, 14) sthm, 15) nd inflmmtory owel disese. 16) NF-B is lso tivted y numer of stimuli, rnging from teril lipopolyshride (LPS), doule-strnded RNA, inflmmtory ytokines, ultrviolet light, retive oxygen speies (ROS), nd free sturted ftty ids. Stimultion of NF-B y proinflmmtory ytokines nd ROS would further propgte nd elerte the inflmmtory yle. Prodution of ROS ours nturlly in iologil systems nd is mintined y n evolutionrily derived ntioxidtive defense. During pthogeni nd immunologil responses, ute nd extremely high prodution of these ROS ours to initite the destrution of foreign ells nd llergens, ut unontrolled nd prolonged prodution of ROS n dversely promote extended nd hroni inflmmtion. Thus inresed onsumption of nturlly ourring ntioxidnts my help to llevite nd suppress exessive inflmmtion. Whole-mel rley flour ontins the highest onentrtion of ntioxidnts mong erels (1.9 mmol/1 g equivlent to vitmin C, FRAP ssy), s reported y Hlvorsen et l. 17) Furthermore, we hve reported tht fermented rley extrt (FBE) ws effetive in suppressing oxidtive stress in hroni ethnol feeding, 18) wheres nother study reported nti-inflmmtory tion from other fermented produts suh s rown rie nd its rn. 19) In the present study, we found tht FBE effetively suppressed LPS-indued inflmmtion through the mintenne of ntioxidtive defense. Mterils nd Methods Chemil regents. Detetion kits to ssy plsm lnine minotrnsferse (ALT), nd sprtte minotrnsferse (AST) tivities were purhsed from Wko Pure Chemils (Osk, Jpn). LPS from Esherihi oli O111:B4 (Ct #L263-1MG), used throughout the study, ws from Sigm (St. Louis, MO). All nti-oxidtive enzyme tivities, glutthione peroxidse (GPx), tlse (CAT), nd superoxide dismutse (SOD) were determined y ssy kits purhsed from y To whom orrespondene should e ddressed. Tel: ; Fx: ; E-mil: shirkh@iohem.tohoku..jp Arevitions: 8-OHdG, 8-hydroxy-2 -deoxygunosine; ALT, lnine minotrnsferse; AST, sprtte minotrnsferse; CAT, tlse; FBE, fermented rley extrt; GPx, glutthione peroxidse; IL, interleukin; LPS, lipopolyshride; NF-B, nuler ftor kpp B; NO, nitri oxide; ROS, retive oxygen speies; SOD, superoxide dismutse; TNF, tumor nerosis ftor

2 1972 P. E. GIRIWONO et l. Cymn (Ann Aror, MI). The plsm nitri oxide (NO) onentrtion ws determined with ommeril NO 2 /NO 3 Assy Kit-C II from Dojindo Lortories (Kummoto, Jpn). Before mesuring the 8- hydroxy-2 -deoxygunosine (8-OHdG) level y enzyme-linked immunosorent ssy (ELISA) (JICA, Shizuok, Jpn), plsm ws filtered using Miroon entrifugl filter units with 1, moleulr weight ut-off (Millipore, Billeri, MA) followed y 2-fold dilution. We used vitmin K-defiient diet for the se diet (TD9753), purhsed from Hrln Tekld (Mdison, WI), reonstituted with.75 mg/kg of phylloquinone (Wko Pure Chemils). Fermented rley extrt. Fermented rley extrt (FBE) ws extrted from the lees of rley fermented with rie koji strter (Aspergillus kwuhi) y the method of onventionl Jpnese rewing. This extrtion method involves deftting nd srew-pressing to seprte the liquid phse from the fermented rley fiers. The extrted liquid ws filtered through ermi filter (porosity,.2 mm) to remove solule fier. The filtrte ws then stored t 4 C nd ws used s the test smple (FBE). Anlysis of the FBE indited tht it ws omposed of proteins (17.9%), rohydrte (25.1%), lipids (.1%), minerls (2.2%), nd totl polyphenols (8.5 mg/ml). For this study, FBE ws prepred further with the ddition of sme volume of dextrin into powdered form to ese nd improve homogeniztion. Generl proedure (nimls). Mle Wistr rts, ged 8 weeks nd weighing g, were purhsed from SLC Jpn (Shizuok, Jpn). Eh group inluded six rts rndomized ording to ody weight nd housed under onstnt temperture of 23 C 2 C nd 12-h light/drk (8 2 light) yle. Groups were leled Con (sterilized sline injetion), Conþ (LPS injetion), nd 1% FBE (1% FBE supplementtion in the diet nd LPS injetion). The diet, sed on the Tekld TD 9753 ustom diet (Tle 1), ws freely given to eh group supplemented with or without 1% FBE w/w for 1 d. Distilled wter ws provided for drinking nd ws repled Tle 1. Diet Formultion The se diet ws Tekld TD 9753 re-supplemented with the AIN reommended vitmin K1 onentrtion for rodents (.75 mg/kg of diet). dily. After the feeding period, eh rt ws intrperitonelly injeted with.5 mg/kg of ody weight LPS nd fsted for 18 h nd then euthnized. The protools used in ll niml experiments were pproved y the Animl Reserh-Animl Cre Committee of the Grdute Shool of Agriulturl Sienes, Tohoku University. Plsm iohemil mrkers ssy. To determine the finl plsm ALT nd AST tivities nd lipid ontents, lood ws otined from the rts while they were under diethylether-indued nesthesi y exsnguintion vi the dominl ort. The lood ws olleted in N 2 EDTA-prepred tues, nd then entrifuged t 1;87 g for 15 min t 4 C. The plsm ws divided into liquots nd stored t 3 C. The plsm onentrtion of ytokines ws mesured using n ELISA kit for the detetion nd quntifition of interleukin (IL)-1, IL-6 nd tumor nerosis ftor (TNF)- (Quntikine ELISA, R&D Systems, Minnepolis, MN) following to the mnufturer s protool. Liver ntioxidtive enzyme tivity ssy. In previous experiments, we determined tht the optimum fsting time fter LPS hllenge to oserve signifint liver dmge nd elevted inflmmtory ytokine in rts is 18 h fter modifition. 2) At euthniztion, the livers were quikly exised, lotted, weighed, nd promptly frozen in liquid nitrogen. For nlysis not rried out on the dy, the livers were stored t 7 C. For GPx tivity,.1 g of liver ws homogenized with polytron homogenizer (Polytron, Bsel, Switzerlnd) in 5 ml of old uffer ontining 5 mm Tris HCl ph 7.5, 5 mm EDTA, nd 1 mm DTT on ie. This homogente ws then sujeted to entrifugtion t 1; g for 15 min t 4 C, fter whih the superntnt ws olleted nd ssyed for GPx. To mesure liver CAT tivity, we used homogeniztion protool similr to tht ove in old uffer ontining 5 mm potssium phosphte, ph 7., nd 1 mm EDTA. The homogente ws similrly entrifuged t 1; g for 15 min t 4 C, followed y superntnt extrtion nd ssy. To determine liver SOD tivity, the liver ws homogenized s ove in old 2 mm HEPES-NOH ph 7.2, 1 mm EGTA, nd 7 mm surose. The homogente ws entrifuged t 2; g for 5 min t 4 C nd the superntnt ws seprted. The superntnt ws further entrifuged t 1; g for 15 min t 4 C, nd then the resulting superntnt ws olleted nd ssyed for SOD tivity. Weight (g/kg) Con nd Conþ 1% FBE Soy ssy protein DL-Methionine Surose Corn strh FBE 2 Corn oil Cellulose Minerl (AIN ) Clium ronte (CCO 3 ) p-aminoenzoi id Asori id (oted) 97.5% Biotin.4.4 Vit. B12 (.1% triturtion).3.3 Clium pntothente Choline dihydrogen itrte Foli id.2.2 Inositol Niin Pyridoxine HCl Rioflvin Thimine HCl Dry Vit. A Plmitte (5 K U/g).4.4 Dry Vit. D3 (5 K U/g) Dry Vit. E Aette (5 U/g) Vit. K1 (phylloquinone) Soy protein nd surose were dded to provide equivlent mro nutrient nd lorie yield. FBE in powdered form ontins 5% dextrin, 25.1% rohydrte, 17.9% protein, 4.7% moisture, nd 2% sh. RNA preprtion nd quntittive RT-PCR. Totl RNA ws isolted from livers tht hd een stored in RNAlter (Amion Jpn, Tokyo). RNA ws extrted y tissue disruption in gunidine isothioyntesed regent (Isogen, Nippon Gene, Toym, Jpn) with ed-type homogenizer Miro Smsh MS-1 (Tomy Seiko Co., Tokyo) ording to the mnufturer s instrutions. The integrity of the isolted RNA ws exmined y grose gel eletrophoresis, nd its onentrtion ws determined on the sis of the sorne vlues t 26 nm. The DNA ws synthesized from 5 mg of totl RNA dentured with oligo-dt/ rndom primers nd 1 mm dntp (GE Helthre Biosienes, Tokyo) t 65 C. The dentured RNA ws inuted in 5 mm Tris HCl ph 8.3, 75 mm KCl, 3 mm MgCl 2,5mM DTT, 5 units of Supersript III reverse trnsriptse (Invitrogen, Crlsd, CA), nd 2 units of RNse inhiitor RNseOUT (Invitrogen). The DNA synthesis protool ws s follows: 25 C for 5 min, followed y 5 C for 6 min nd finlly 7 C for 15 min using Tkr PCR Therml yler MP (Tkr Biomedils, Shig, Jpn). Aliquots of the synthesized DNA were used s the templte for quntittive RT-PCR, whih ws performed with the ABI 73 Rel Time PCR System (Applied Biosystems, Foster City, CA) ording to the mnufturer s instrutions. To mesure the levels of trnsription, the mrna levels were first normlized to the mrna level of eukryoti elongtion ftor 1-1 (Eef11), nd then ompred with the mrna levels of the ontrols to determine reltive expression. 21) The sequenes of primers used in eh gene expression ssy re shown in Tle 2. Sttistil nlysis. Vlues re represented s the men vlue with stndrd error (SE). One-wy nlysis of vrine followed y the Fisher lest signifint differene (LSD) test ws used to evlute differenes etween groups, unless otherwise stted. SPSS version 11. (SPSS, Chigo, IL) ws used for ll dt omputtion. Sttistil signifine ws determined t p < :5 or lower.

3 Tle 2. Fermented Brley Extrt Suppresses Inflmmtion in Rts 1973 Sequenes of Primers Used for PCR Amplifition in the Quntittive RT-PCR Assy Gene 1 Forwrd primer Reverse primer Eef11 GATGGCCCCAAATTCTTGAAG GGACCATGTCAACAATTGCAG Il-1 GCTGACAGACCCCAAAAGATT ATCTGGACAGCCCAAGTCAA Il-6 AGAGGAGACTTCACAGAGGATACC AATCAGAATTGCCATTGCACAAC Tnf- TAATGCTGATTTGGTGACCAGG GTAGGGCGATTACAGTCACGG Cl2 AAGAAGCTGTAGTATTTGTCAC ATCTCACTTGGTTCTGGTC Vm1 ATGGGAAGGTGAAGACAG TAGGGAATGAGTAGATGTCCA Sele GGAAGAAAGCAAAGAAATTCG TATTTCCCATGATGCATTTGTG Nos2 ACCTTCAGGTATGCGGTATTTG CTGGTCGATGTCATGAGCAAAG Ct AGCCTCCTCAGCCTGCACT GGCTTGTGCCCTGCTTCA Sod1 GGCCGTACTATGGTGGTCCA TCCACCTTTGCCCAAGTCAT Gpx1 TGACCGACCCCAAGTACATCA AAATGTCGTTGCGGGACAC 1 Eef11, eukryoti elongtion ftor 11; Il-1, interleukin-1; Il-6, interleukin-6; Tnf-, tumor nerosis ftor-; Cl2, hemokine (C-C motif) lignd 2; Vm1, vsulr ell dhesion moleule 1; Sele, seletin e; Nos2, induile nitri oxide synthse; Ct, tlse; Sod1, ytosoli superoxide dismutse 1; Gpx1, glutthione peroxidse 1 A Plsm IL-1β B % FBE Conentrtion (pg/ml) Conentrtion (pg/ml) Plsm IL-6 1% FBE Plsm ALT tivity A 5 Ativity (IU/L) % FBE B 1 Ativity (IU/L) Plsm AST tivity 1% FBE C Plsm TNF-α Plsm NO 2/NO % FBE 1% FBE Conentrtion (pg/ml) Fig. 1. Fermented Brley Extrt (FBE) Supplementtion Suppressed Plsm Inflmmtory Cytokines nd NO Conentrtions fter Lipopolyshride (LPS) Chllenge. LPS-indued elevted primry inflmmtory ytokines interleukin (IL)-1 (A), IL-6 (B), nd tumor nerosis ftor (TNF)- (C) in the plsm were suppressed y FBE supplementtion. (D) LPS-indued inflmmtion inresed NO levels in the plsm, ut ws suppressed y FBE. All vlues re men SE; (n ¼ 6). Different letters indite signifint differene t p < :5. Ethil guidelines. We onduted the niml experiments s humnely s possile in ordne with the guidelines for ethil tretment of nimls in sientifi reserh pproved y the Animl Reserh-Animl Cre Committee of the Grdute Shool of Agriulturl Sienes, Tohoku University (no. 5-8B). Results FBE suppressed inflmmtory ytokines nd NO onentrtion in plsm A 1-d feeding durtion did not indue signifint differenes in ody weight gin, verge dily feed intke, or wter intke. For this durtion, the verge weight inrese for rts in groups Con, Conþ nd 1% FBE were 37:3 4:6 g, 33:7 4:3 g, nd 32:4 4:7 g respetively. The verge feed intke for Con, Conþ, nd 1% FBE were 9: :28 g, 8:7 :52 g, nd 9:1 :55 g respetively. We oserved in preliminry experiments tht the effetive FBE supplementtion onentrtion ws 1%, euse lower dose (4%) ws ineffetive to exert nti-inflmmtory effet, nd higher dose resulted in lower dietry intke nd dirrhe (dt not shown). As D Conentrtion (mm) Fig. 2. FBE Suppressed LPS-Indued Liver Dmge. Rts supplemented with FBE showed llevition of LPS-indued plsm lnine minotrnsferse (ALT) (A) nd sprtte minotrnsferse (AST) (B) tivities. All vlues re men SE (n ¼ 6). Different letters indite signifint differene t p < :5. oserved in Fig. 1A C, the levels of ll plsm inflmmtory ytokines were highly elevted in the LPS-hllenged groups, ut FBE supplementtion signifintly inhiited exessive expression of these ytokines. It ws lso oserved tht the FBE-supplemented group showed signifint inhiition in the plsm NO onentrtion (Fig. 1D). The redued plsm onentrtion of these inflmmtory inditors indites tht FBE effetively llevited LPS-indued inflmmtion. FBE llevited liver injury indued y LPS hllenge One of the first signs of LPS hllenge is injury to the liver, euse LPS n rrive in hepti tissue s erly s 3 min fter tretment. In the present study, we otined signifint repression of LPS-indued liver injury, s mrked y sustntil derese in plsm ALT tivity (Fig. 2A). Although the plsm AST tivity of the FBE-supplemented group did not signifintly derese, inditing other exessive tissue injury (Fig. 2B), our results indite tht speifi liver dmge ws inhiited y supplementtion of FBE. Supplementtion of FBE inhiited overexpression of the NF-B trget genes After we found evidene tht FBE exhiits hepti protetive tivity, we further investigted the hnge in gene expression of the liver to eluidte the mehnism of FBE. It ws pprent tht inflmmtory gene expression ws suppressed in the livers of the FBEsupplemented rts (Fig. 3A C) in ongruene with the repressed plsm ytokine levels. It ws lso pprent tht other NF-B trget genes were trnsriptionlly inhiited, s indited y the signifint suppression of hemokine (C-C motif) lignd (Cl2), vsulr ell

4 1974 P. E. GIRIWONO et l. A 3. Reltive expression Liver IL-1β C Reltive expression 4 2 E 5. Reltive expression G 4. Reltive expression Liver Vm1 Liver Nos2 1% FBE 1% FBE 1% FBE 1% FBE B 6. Liver IL-6 dhesion moleule 1 (Vm1), seletin e (Sele), nd induile nitri oxide synthse (Nos2) (Fig. 3D G). Reltive expression D Reltive expression Liver Cl-2 1% FBE 1% FBE Liver Sele1 F % FBE Fig. 3. FBE Supplementtion Suppressed Liver mrna Expression of Inflmmtory Genes. Rts supplemented with FBE showed deresed expression of inflmmtory genes Il-1 (A), Il-6 (B), nd Tnf- (C). Other trget genes of NF-B tivtion, notly Cl2 (D), Vm1 (E), Sele1 (F), nd Nos2 (G), were downregulted y FBE supplementtion. All vlues re men SE (n ¼ 6). Different letters indite signifint differene t p < :5. Reltive expression FBE supplementtion sustined liver nd plsm ntioxidtive defense Expression of ntioxidtive genes in the liver of LPShllenged rts ws found to e highly suppressed s result of NF-B tivtion nd susequent ROS prodution. However, it ws oserved tht these ntioxidtive genes in the livers of the FBE-supplemented rts were llevited of their otherwise downregulted trnsription, s in Conþ (Fig. 4A C). This ws presumly due to the ntioxidtive nture of FBE, s previously reported. 18) Furthermore, FBE sustined the liver enzymti tivities of GPx, CAT, nd SOD (Fig. 4D F), onsistent with the improved gene expression. This ws further evident in the signifintly improved plsm tivities of CAT nd SOD (Fig. 4G H). In ddition, the expression of Nos2, whih is lso highly expressed in the liver in ddition to the mrophges, ws suppressed fter LPS hllenge y FBE supplementtion (Fig. 3G), thus inhiiting enhned plsm NO levels, whih my indue nd propgte further systemi inflmmtion (Fig. 1D). Furthermore plsm 8-OHdG levels, nother oxidtive mrker, were signifintly deresed y FBE supplementtion (Fig. 4I). Together, these results suggest tht the ntioxidtive tivity of FBE llevites the propgtion of ROS-indued inflmmtion nd orgn dmge under LPS hllenge. Disussion Ativtion of NF-B hs een shown to e inhiited y vriety of plnt nd fruit extrts in numerous studies. Grins, suh s rley, ontin phytohemils omprle to those of fruits. In prtiulr, the polyphenols of rley nd extrts of fermented rley show potent inhiitory effet of NF-B. This effet is possily ttriutle to its ntioxidtive property. In the present study, we showed tht n extrt of fermented derivtives of rley, previously reported to inhiit oxidtive stress indued y hroni lohol onsumption, 18) prevented liver dmge in response to LPS hllenge nd sustntil oxidtive stress. Supplementtion of FBE t 1% w/w in the diet of rts for 1 d effetively suppressed the plsm levels of inflmmtory ytokines (IL-1, IL-6, nd TNF-) fter LPS hllenge. Furthermore, the plsm NO onentrtion in the FBE-supplemented rts signifintly deresed s ompred to n LPS-treted ontrol inditing ler llevition of the systemi inflmmtory response nd derese in oxidtive stress. Suppression of inflmmtory ytokines suh s IL-6 ws oserved in the mie supplemented with rley foodstuff. 22) It ws lso reported tht onsumption of grin helps to prevent inreses in the levels of plsm inflmmtory proteins suh s C-retive protein nd plsminogen tivtor inhiitor-1 in humn tril. 23) Our study orroortes these oservtions euse FBE ws extrted from whole-grin rley fter fermenttion. Additionlly, it hs een reported tht fermenttion y koji (Aspergillus wmori mut.) in nother rewing produt yielded enefiil effet in inresed ntioxidtive tion due to phenoli ids. 8) Furthermore, it ws desried tht koji fermenttion hydrolyzes ffeoylquini id nd its derivtives to form ffei id nd quini id. 8) Seondry metolites of some Aspergillus speies generted in fermenttion hve een isolted nd shown to e ntioxidnts. 24) Regrdless of the effets of fermenttion, FBE s n end produt residue should ontin n inresed onentrtion of polyphenols s ompred to the originl rley onstituents. Whether suh phenoli ids or ntioxidnts re undnt in FBE or ply mjor role in its nti-inflmmtory tion requires further study. The inflmmtory response of NF-B to stimuli suh s LPS involves signling sdes strting with the inding of LPS to TLR4, thus tivting Myd88. This in turn initites phosphoryltion of Irk1, Trf6, Tk1, nd finlly the IKK omplex. The tivtion (phosphoryltion) of IKK is ritil in the phosphoryltion of IB, leding to its protesoml degrdtion nd the nuler trnslotion of NF-B. Ativtion of NF-B expresses numerous genes tegorized s ytokines nd growth ftors (interleukins nd TNF-), dhesion moleules (Vm nd Im), nd induile Nos2, leding to inreses in NO nd oxidtive stress, nd then ours orgn injury ,25) The undne of NO ts further to tivte NF-B nd the propgtion of inflmmtion, inititing forwrd loop. It is t this point tht

5 Fermented Brley Extrt Suppresses Inflmmtion in Rts 1975 A Reltive expression Liver Ct % FBE D Ativity (nmol/min. mg protein) G Ativity (nmol/min. mg protein) Liver tlse tivity 1% FBE Plsm tlse tivity % FBE B Reltive expression E Ativity (U/mg protein) H Ativity (U/mg protein) Liver Gpx % FBE Liver SOD tivity % FBE Plsm SOD tivity 1% FBE C Reltive expression F Ativity (nmol/min. mg protein) I Conentrtion (ng/ml) Liver Sod % FBE Liver GPx tivity % FBE Plsm 8-OHdG 1% FBE Fig. 4. Antioxidtive Defense Ws Mintined in FBE-Supplemented Rts. FBE supplementtion signifintly improved LPS-indued downregultion of ntioxidtive genes tlse (Ct) (A), glutthione peroxidse 1 (Gpx1) (B), nd superoxide dismutse 1 (Sod1) (C) in the rt liver. FBE enhned the tivities of the respetive ntioxidtive enzymes: CAT (D), SOD (E), nd GPx (F) in the rt liver. It showed enhned irultory ntioxidtive defense in plsm mrked y CAT (G) nd SOD (H) tivities. These effets resulted in redued levels of oxidtive stress inditors 8-hydroxy-2 -deoxygunosine (8-OHdG) (I). All vlues re men SE (n ¼ 4{6). Different letters indite signifint differene t p < :5. supplementtion with potent ntioxidtive gents is onsidered to e vlule in inhiiting this yle. Liver gene expression in the FBE-supplemented rts indites inhiition of NF-B tivtion, s mrked y sustntil trnsriptionl suppression of inflmmtory trget genes s ompred to the non-supplemented group (Fig. 3). The ntioxidtive nture of FBE my suppress oxidtive stress derived from NO generted y LPS nd further tivtion of NF-B. In one study, FBE inhiited oxidtive stress indued y hroni lohol onsumption. 18) A study onduted y Hole et l. 2) found tht extrts from grins, inluding the Swedish rley Olve, effetively inhiited LPS-indued NF-B tivtion. The report disussed its poteny s modultor of signl trnsdution moleules in NF-B tivtion. In our experiment, the nti-inflmmtory effet of FBE might not hve influened these moleules (Myd88, Irk1, Trf6, nd Tk1), euse the expression of these genes ws not ltered y FBE supplementtion (dt not shown). We oserved signifintly enhned mrna expression of ntioxidtive enzymes nd higher tivities of them in the FBE-supplemented group (Fig. 4). These dt orrespond with our previous experiment. 18) Thus FBE shows potent enhnement of the expression of these ntioxidtive enzymes in ddition to its intrinsi ntioxidtive tivity. Upregultion of these enzymes n eliminte ROS generted y LPS tretment nd inhiit further tivtion of NF-B in the ROS NFB forwrd loop. The mehnism involved in the enhnement of these ntioxidtive enzymes y FBE my e due to tivtion of Nrf2, 26) ut further investigtion is required. Additionlly, n nti-inflmmtory effet of rley 22) nd other fermented grin produts ws reported in oloretl inflmmtory mouse model, 19) nd FBE ws reported to inhiit inflmmtory ytokines in PiClhllenged NC/Ng mie, simulting topi dermtitis. 27,28) In these studies, rley nd fermented grin produts suppressed inflmmtion vi pthwys different from NF-B inhiition, suh s interferon- nd IL-4 signling. We did not mesure the onentrtions of IL-4, IgE or the tivtion of nive T ells. Thus some of the nti-inflmmtory effet of FBE shown in this study my e medited y its involvement in pthwys other thn NF-B tivtion. In this study, we showed tht FBE ws le to suppress LPS-indued inflmmtion nd liver dmge in rts signifintly. FBE mintined signifintly lower NO onentrtion fter the onentrtion inresed exessively due to LPS hllenge, demonstrting one importnt key in preventing further inflmmtory propgtion. This effet ws hieved y n inrese in liver nd plsm ntioxidtive enzyme tivities s result of FBE supplementtion. Further investigtion is required to determine speifilly whih omponent of FBE hs highest tivity, nd whether this prtiulr omponent tivtes the trnsription of ntioxidtive genes. Aknowledgment This study ws supported in prt y the Iijim Memoril Foundtion for the Promotion of Food Siene nd Tehnology.

6 1976 P. E. GIRIWONO et l. Referenes 1) Ruidvets JB, Bongrd V, Dllongeville J, Arveiler D, Duimetière P, Perret B, Simon C, Amouyel P, nd Ferrières J, J. Epidemiol. Commun. Helth, 61, (27). 2) Hole AS, Grimmer S, Nterstd K, Jensen MR, Pur I, Johnsen SG, Blstd TR, Blomhoff R, nd Shlstrøm S, J. Agri. Food Chem., 57, (29). 3) Behll KM, Sholfield DJ, nd Hllfrish JG, Nutr. Res., 26, (26). 4) Perez-Jimenez J nd Sur-Clixto F, J. Agri. Food Chem., 53, (25). 5) Brennn CS nd Clery LJ, J. Cerel Si., 42, 1 13 (25). 6) Mttil P, Pihlv JM, nd Hellström J, J. Agri. Food Chem., 53, (25). 7) Ye XJ, Morimur S, Hn SL, Shigemtsu T, nd Kid K, Biosi. Biotehnol. Biohem., 68, (24). 8) Yoshimoto M, Kurt-Azum R, Fujii M, Hou DX, Iked K, Yoshidome T, nd Osko M, Biosi. Biotehnol. Biohem., 68, (24). 9) Heinen MM, Hughes MC, Iieele TI, Mrks JC, Green AC, nd vn der Pols JC, Eur. J. Cner, 43, (27). 1) Serfini M, Belloo R, Wolk A, nd Ekström AM, Gstroenterology, 123, (22). 11) Krin M, Co Y, Greten FR, nd Li ZW, Nt. Rev. Cner, 2, (22). 12) Vlen G, Yn ZQ, nd Hnsson GK, J. Am. Coll. Crdiol., 38, (21). 13) Mttson MP nd Cmndol S, J. Clin. Invest., 17, (21). 14) Feldmnn M, Andrekos E, Smith C, Bondeson J, Yoshimur S, Kirikidis S, Mono C, Gsprini C, Sre S, Lunderg A, Pleolog E, Horwood NJ, Brennn FM, nd Foxwell BMJ, Ann. Rheum. Dis., 61, ii13 ii18 (22). 15) Christmn JW, Sdikot RT, nd Blkwell TS, Chest, 117, (2). 16) Neurth MF, Beker C, nd Brulesu K, Gut, 43, (1998). 17) Hlvorsen BL, Holte K, Myhrstd MCW, Brikmo I, Hvttum E, Remerg SF, Wold A, Hffner K, Bugerød H, Andersen LF, Moskug JØ, Jos DR, nd Blomhoff R, J. Nutr., 132, (22). 18) Giriwono PE, Hshimoto T, Ohski Y, Shirkw H, Hokzono H, nd Komi M, Food Res. Int., 43, (21). 19) Phutthphdoong S, Ymd Y, Hirt A, Tomit H, Hr A, Limtrkul P, Iwski T, Koyshi H, nd Mori H, Onol. Rep., 23, (21). 2) Ohski Y, Shirkw H, Hiwtshi K, Furukw Y, Mizutni T, nd Komi M, Biosi. Biotehnol. Biohem., 7, (26). 21) Shirkw H, Ohski Y, Minegishi Y, Tkumi N, Ohint K, Furukw Y, Mizutni T, nd Komi M, Biohim. Biophys. At, 176, (26). 22) Knuhi O, Oshim T, Andoh A, Shioy M, nd Mitsuym K, Snd. J. Gstroenterol., 43, (28). 23) Msters RC, Liese AD, Hffner SM, Wgenkneht LE, nd Hnley AJ, J. Nutr., 14, (21). 24) Miyke Y, Ito C, Itoigw M, nd Osw T, Biosi. Biotehnol. Biohem., 71, (27). 25) Psprkis M, Nt. Rev. Immunol., 9, (29). 26) N HK nd Surh YJ, Food Chem. Toxiol., 46, (28). 27) Hokzono H, Omori T, nd Ono K, Biosi. Biotehnol. Biohem., 74, (21). 28) Iguhi T, Kwt A, Wtne T, Mzumder TK, nd Tne S, Biosi. Biotehnol. Biohem., 73, (29).