Supplementary Figure 1

Size: px
Start display at page:

Download "Supplementary Figure 1"

Transcription

1 Supplementary Figure 1 60 HRAS G12V 40 * Percent BRDU Positive NS Percent BRDU Positive NS dox dox doxkt5720 -doxkt5720 Treatment TSHKT dox dox doxkt5720 -doxkt5720 Treatment TSHKT5720 Supplementary Figure 1: The PKA antagonist KT5720 inhibits TSH but not oncoprotein-induced DNA synthesis in rat PCCL3 cells. PCCL3 cells conditionally expressing the indicated oncoprotein in a dox-inducible manner were grown in Coon s/h4 serum and then switched to Coon s/h3 serum (without TSH) for 3 days. Cells were then treated with 10 µg/ml BrdU for 24 h in the absence or presence of 1 µg/ml of doxycycline or 10 miu/ml TSH with or without 5 µm KT5720 for 24 h. BrdU incorporation was analyzed by FACS. Data represent mean SD of 3 wells. *p<0.05; p<0.009; NS: Not significant, p > 0.05.

2 Supplementary Figure 2 A Braf terk Dox KT5720 B PCCL3 PCCL3 RET/PTC3 Braf RET/PTC3 rs6 ERK Dox - - camp rs6 ERK Dox - - camp Supplementary Figure 2 Effects of camp on ribosomal S6 phosphorylation in PCCL3 cells expressing oncogenic BRAF or RET/PTC3. A,B) PCCL3 cells conditionally expressing Braf V600E (left) or RET/PTC3 (right) were incubated in Coon s/h3 serum for 2 days. A) Cells were then incubated in Coon s - serum with or without dox for 2 days. KT5720 (10 µm) was added 6 hours prior to preparing protein lysates. B) Cells were then incubated in Coon s - serum with or without dox for 4 days. camp was added 60 min prior to preparing protein lysates. Western blotting was performed for the indicated proteins.

3 BHT101 ps6k T389 prs6 S240/244 p4ebp1 T37/46 prsk 380 trsk terk Rapa 20nM 2h AZD nM 2h FMK 5 µm 2h Supplementary Figure 3 Role for RSK in ribosomal S6 phosphorylation in a human thyroid cancer cell line harboring oncogenic BRAF. Cells were incubated in medium with 10% FBS, and then with DMSO, rapamycin (20 nm), AZD6244 (500 nm) or RSK inhibitor (FMK, 5 μm) alone or in combination for 2 h. Cells lysates were Western blotted with the indicated antibodies.

4 8Br-cAMP KT5720 (µm) ps6k T389 prs6 S240/242 p4ebp1 T37/46 pakt S473 KT5720 (µm) ps6k T389 prs6 S240/242 p4ebp1 T37/46 pakt S473 8Br-cAMP - - rapa - AKTi ps6k T389 prs6 S240/242 p4ebp1 T37/46 pakt S473 8Br-cAMP - - rapa - U ps6k T389 prs6 S240/242 p4ebp1 T37/ Supplementary Figure 4 Densitometry of Western blots shown in Figure 1. Bars represent the ratio of the indicated phosphoprotein relative to the loading control.

5 Dox rapa U0126 AKTi ps6k T389 prs6 S240/242 p4ebp1 T37/46 pakt S473 Dox rapa U AKTi ps6k T389 prs6 S240/242 p4ebp1 T37/46 pakt S473 Dox rapa U0126 AKTi ps6k T389 prs6 S240/242 p4ebp1 T37/46 pakt S473 Supplementary Figure 5 Densitometry of Western blots shown in Figure 2B. Bars represent the ratio of the indicated phosphoprotein relative to the loading control α-tubulin.

6 8 Br camp - - ps6k T389 prs6 S240/242 p4ebp1 T37/46 pakt S473 8 Br camp - - ps6k T389 prs6 S240/242 p4ebp1 T37/46 pakt S473 Supplementary Figure 6 Densitometry of Western blots shown in Figure 3B. Bars represent the ratio of the indicated phosphoprotein relative to the loading control α-tubulin.

7 rapa U AKTi ps6k T389 prs6 S240/242 p4ebp1 T37/46 pmek pakt S473 rapa U AKTi ps6k T389 prs6 S240/242 p4ebp1 T37/46 pmek pakt S473 rapa U AKTi ps6k T389 prs6 S240/242 p4ebp1 T37/46 pmek pakt S473 rapa U AKTi ps6k T389 prs6 S240/242 p4ebp1 T37/46 pmek pakt S473 Supplementary Figure 7 Densitometry of Western blots shown in Figure 5B. Bars represent the ratio of the indicated phosphoprotein relative to the loading control α-tubulin.

8 Fig. 6A ERK norm alized expression AZD6244 AZD8055 BHT101 KTC1 pakt S473 Hth104 ps6k T389 ERK norm alized expression AZD6244 AZD8055 BHT101 KTC1 pakt S473 Hth104 ps6k T389 Fig. 6D β -actin Norm alized Expression AZD AZD pakt S473 * β -a c tin N o rm a liz e d Expression AZD AZD pakt S Supplementary Figure 8 Densitometry of Western blots shown in Figure 6A and C. (upper) Bars represent the ratio of the indicated phosphoprotein relative to total ERK1 for Figures 6A. (lower) Bars represent ratio of the indicated phosphoprotein relative to β-actin for Figure 6C. *p<0.05, p<0.006.

9 Supplementary Table 1: Cell lines used in study. Cell Source Mutation Line 1 identified 2 WRO G. Juilliard, University of California Los none BHT101 OCUT2 KTC1 FRO Angeles German Collection of Microorganisms and Cell Cultures ( Naoyoshi Onoda, Osaka City University German Collection of Microorganisms and Cell Cultures ( Junichi Kurebayashi, Kawasaki Medical School G. Juilliard, University of California Los Angeles PI3KCA H104 7R KRAS G12R none TPC1 Sissy M. Jhiang, Ohio State RET/PTC1 Hth104 C c FTC133 Nils-Erik Heldin, Uppsala University Hospital, Sweden Nils-Erik Heldin, Uppsala University Hospital, Sweden Nils-Erik Heldin, Uppsala University Hospital, Sweden Nils-Erik Heldin, Uppsala University Hospital, Sweden German Collection of Microorganisms and Cell Cultures ( German Collection of Microorganisms and Cell Cultures ( HRAS Q61R HRAS G13R PTEN 1 All cell line were subjected to STR analysis and found to have a unique STR profile (i.e. no match to cell lines in ATCC, DSMZ, or EACAC databases) (1). 2 Cell lines were screened for point mutations in BRAF, RAS, AKT, and PI3KCA as well as for RET, ntrk, PPARγ rearrangements as described in Ricarta-Fihlo et al., (2). References 1. Schweppe RE, Klopper JP, Korch C, Pugazhenthi U, Benezra M, Knauf JA, et al. DNA Profiling Analysis Of 40 Human Thyroid Cancer Cell Lines Reveals Cross-Contamination Resulting In Cell Line Redundancy And Misidentification J Clin Endocrinol Metab 2008; 15, Ricarte-Filho JC, Ryder M, Chitale DA, Rivera M, Heguy A, Ladanyi M, et al. Mutational profile of advanced primary and metastatic radioactive iodine-refractory thyroid cancers reveals distinct pathogenetic roles for BRAF, PIK3CA, and AKT1 Cancer Res 2009; 69,

10 Supplementary Table 2: Different PCCL3 media used in study. Medium Contents Coon s modified F12 supplemented with TSH (10 miu/ml), insulin (10 Coon s/h4serum mg/ml), apotransferrin (5 mg/ml), hydrocortisone (10 nmol/l) and fetal calf serum (5%) Coon s/h3serum Coon s modified F12 supplemented as above except TSH omitted. Coon s modified F12 supplemented with TSH (10 miu/ml), insulin (10 Coon s/h4-serum mg/ml), apotransferrin (5 mg/ml), hydrocortisone (10 nmol/l) and bovine serum album (0.5%) Coon s/h3-serum Coon s modified F12 supplemented as above except TSH omitted. Coon s modified F12 supplemented apotransferrin (5 mg/ml), Coon s/h2-serum hydrocortisone (10 nmol/l) and bovine serum album (0.5%)

Molecular Diagnostics in Thyroid Tumors

Molecular Diagnostics in Thyroid Tumors USCAP 2011 Endocrine Pathology Society Companion Meeting Molecular Diagnostics in Thyroid Tumors Yuri E. Nikiforov, M.D., Ph.D. Department of Pathology University of Pittsburgh Medical Center Outline Overview

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

Research Article. Abstract. Introduction

Research Article. Abstract. Introduction Mutational Profile of Advanced Primary and Metastatic Radioactive Iodine-Refractory Thyroid Cancers Reveals Distinct Pathogenetic Roles for BRAF, PIK3CA, and AKT1 Julio C. Ricarte-Filho, 1 Mabel Ryder,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

New Developments in Thyroid Cancer

New Developments in Thyroid Cancer New Developments in Thyroid Cancer Eric J. Sherman, MD Professor Vice-Chair for Clinical Operations Chief, Division of Head and Neck Surgery Departments of Otolaryngology, Radiation Oncology, and Immunology

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Martina Broecker-Preuss 1,4*, Stefan Müller 2, Martin Britten 1,5, Karl Worm 3, Kurt Werner Schmid 3, Klaus Mann 1,6 and Dagmar Fuhrer 1

Martina Broecker-Preuss 1,4*, Stefan Müller 2, Martin Britten 1,5, Karl Worm 3, Kurt Werner Schmid 3, Klaus Mann 1,6 and Dagmar Fuhrer 1 Broecker-Preuss et al. BMC Cancer (2015) 15:184 DOI 10.1186/s12885-015-1186-0 RESEARCH ARTICLE Open Access Sorafenib inhibits intracellular signaling pathways and induces cell cycle arrest and cell death

More information

Supplemental Figure legends. Supplemental Figure 1: HIF-reporter assay in FTC133, 8505c, WRO and BcPAP cells under

Supplemental Figure legends. Supplemental Figure 1: HIF-reporter assay in FTC133, 8505c, WRO and BcPAP cells under Supplemental Figure legends Supplemental Figure 1: HIF-reporter assay in FTC133, 855c, WRO and BcPAP cells under normoxia, 1% O 2 and anoxia. HIF-activity was decreased following exposure to 1µM GDC- 941

More information

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,

More information

Honglai Zhang 1 and Dong Chen 2*

Honglai Zhang 1 and Dong Chen 2* Zhang and Chen Thyroid Research (2018) 11:13 https://doi.org/10.1186/s13044-018-0057-6 RESEARCH Synergistic inhibition of MEK/ERK and BRAF V600E with PD98059 and PLX4032 induces sodium/iodide symporter

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Kris MG, Johnson BE, Berry LD, et al. Using Multiplexed Assays of Oncogenic Drivers in Lung Cancers to Select Targeted Drugs. JAMA. doi:10.1001/jama.2014.3741 etable 1. Trials

More information

Protocol. This trial protocol has been provided by the authors to give readers additional information about their work.

Protocol. This trial protocol has been provided by the authors to give readers additional information about their work. Protocol This trial protocol has been provided by the authors to give readers additional information about their work. Protocol for: Ho AL, Grewal RK, Leboeuf R, et al. Selumetinib-enhanced radioiodine

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

Normal Skin. Tissue Samples and Melanoma Cell Lines. BRAF Mut. RAS Mut RAS WT /BRAF WT

Normal Skin. Tissue Samples and Melanoma Cell Lines. BRAF Mut. RAS Mut RAS WT /BRAF WT Supplemental Figure 1. MERTK gene expression in melanoma cell line panel from Cancer Cell Line Encyclopedia. A. Microarray analysis of melanoma cell lines from UNC collection grouped by oncogenic mutation.

More information

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB

More information

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,

More information

Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014

Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014 Policy Number 2.04.82 Molecular Markers in Fine Needle Aspirates of the Thyroid Medical Policy Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014 Disclaimer Our medical policies

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

NIH Public Access Author Manuscript Cancer Res. Author manuscript; available in PMC 2010 September 15.

NIH Public Access Author Manuscript Cancer Res. Author manuscript; available in PMC 2010 September 15. NIH Public Access Author Manuscript Published in final edited form as: Cancer Res. 2009 September 15; 69(18): 7311 7319. doi:10.1158/0008-5472.can-09-1077. Genetic Alterations in the PI3K/Akt Signaling

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel p53 RB Myc Cell Line Mutation A Mutation A Amplification B COR-L103 C p.y234c p.d584e L-Myc NCI-H526 p.s33_splice None N-Myc NCI-H1048

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK

More information

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel

More information

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized

More information

Sustained ERK inhibition maximizes responses of Braf V600E thyroid cancers to radioiodine

Sustained ERK inhibition maximizes responses of Braf V600E thyroid cancers to radioiodine Sustained ERK inhibition maximizes responses of Braf V600E thyroid cancers to radioiodine James Nagarajah, 1,2 Mina Le, 1,3 Jeffrey A. Knauf, 1 Giuseppe Ferrandino, 4 Cristina Montero-Conde, 1 Nagavarakishore

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk

Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk EGF induced VATPase assembly and mtorc1 activation Supplemental Information Supplemental Figure Legends Figure S1. Effect of bafilomycin on EGFinduced Akt and Erk signaling. A. Hepatocytes were treated

More information

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee

More information

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855

AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855 Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Prolonged mitotic arrest induces a caspase-dependent DNA damage SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey

More information

Sel u me ti nib-enhanced Radioiodine Uptake in Advanced Thyroid Cancer

Sel u me ti nib-enhanced Radioiodine Uptake in Advanced Thyroid Cancer T h e n e w e ngl a nd j o u r na l o f m e dic i n e original article Sel u me ti nib-enhanced Radioiodine Uptake in Advanced Thyroid Cancer Alan L. Ho, M.D., Ph.D., Ravinder K. Grewal, M.D., Rebecca

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

Citation for published version (APA): Verbeek, H. (2015). Medullary Thyroid Carcinoma: from diagnosis to treatment [S.l.]: [S.n.]

Citation for published version (APA): Verbeek, H. (2015). Medullary Thyroid Carcinoma: from diagnosis to treatment [S.l.]: [S.n.] University of Groningen Medullary Thyroid Carcinoma Verbeek, Hans IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document

More information

Antitumor activity of the ERK inhibitor SCH against BRAF mutant, NRAS mutant and wild-type melanoma

Antitumor activity of the ERK inhibitor SCH against BRAF mutant, NRAS mutant and wild-type melanoma Wong et al. Molecular Cancer 2014, 13:194 RESEARCH Open Access Antitumor activity of the ERK inhibitor SCH722984 against BRAF mutant, NRAS mutant and wild-type melanoma Deborah JL Wong 1, Lidia Robert

More information

A novel Monoclonal Antibody against Notch1 Targets Leukemiaassociated Mutant Notch1 and Depletes Therapy Resistant Cancer Stem Cells in Solid Tumors

A novel Monoclonal Antibody against Notch1 Targets Leukemiaassociated Mutant Notch1 and Depletes Therapy Resistant Cancer Stem Cells in Solid Tumors Supplementary Information:- A novel Monoclonal Antibody against Notch1 Targets Leukemiaassociated Mutant Notch1 and Depletes Therapy Resistant Cancer Stem Cells in Solid Tumors Ankur Sharma 1, Rupali A

More information

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

NIH Public Access Author Manuscript Mol Cancer Ther. Author manuscript; available in PMC 2015 January 01.

NIH Public Access Author Manuscript Mol Cancer Ther. Author manuscript; available in PMC 2015 January 01. NIH Public Access Author Manuscript Published in final edited form as: Mol Cancer Ther. 2014 January ; 13(1): 134 143. doi:10.1158/1535-7163.mct-13-0187. Off Target Effects of c-met Inhibitors on Thyroid

More information

Targeting BRAF V600E with PLX4720 Displays Potent Antimigratory and Anti-invasive Activity in Preclinical Models of Human Thyroid Cancer

Targeting BRAF V600E with PLX4720 Displays Potent Antimigratory and Anti-invasive Activity in Preclinical Models of Human Thyroid Cancer The Oncologist Endocrinology Targeting BRAF V600E with PLX4720 Displays Potent Antimigratory and Anti-invasive Activity in Preclinical Models of Human Thyroid Cancer CARMELO NUCERA, a,e MATTHEW A. NEHS,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

β-catenin signaling is required for RAS-driven thyroid cancer through PI3K activation

β-catenin signaling is required for RAS-driven thyroid cancer through PI3K activation /, Vol. 7, No. 31 β-catenin signaling is required for RAS-driven thyroid cancer through PI3K activation Ana Sastre-Perona 1, Garcilaso Riesco-Eizaguirre 1,2, Miguel A. Zaballos 1, Pilar Santisteban 1 1

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

ASC Companion Meeting at the 2017 USCAP: Ancillary Molecular Testing in "Indeterminate. Thyroid Nodules: How Far Have We Come?

ASC Companion Meeting at the 2017 USCAP: Ancillary Molecular Testing in Indeterminate. Thyroid Nodules: How Far Have We Come? ASC Companion Meeting at the 2017 USCAP: Ancillary Molecular Testing in "Indeterminate Thyroid Nodules: How Far Have We Come? William C. Faquin, MD, PhD, Massachusetts General Hospital, Boston, MA The

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

Clinical and Molecular Approach to Using Thyroid Needle Biopsy for Nodular Disease

Clinical and Molecular Approach to Using Thyroid Needle Biopsy for Nodular Disease Clinical and Molecular Approach to Using Thyroid Needle Biopsy for Nodular Disease Robert L. Ferris, MD, PhD Department of Otolaryngology/Head and Neck Surgery and Yuri E. Nikiforov, MD, PhD Division of

More information

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig. 1. 3 or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

ras Multikinase Inhibitor Multikinase Inhibitor 0.1

ras Multikinase Inhibitor Multikinase Inhibitor 0.1 a ras ** * ** * ** ** ** ** un in et m lu Se ib SL G 32 W 7 So 50 ra 74 fe ni b LY W 294 or 0 tm 02 R an ap n a in Ev my er cin ol im BE us Z2 3 En P 5 za I13 st 0 au rin D as SP ati 60 nib C 012 is 5

More information

Supporting Information

Supporting Information Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,

More information

Promising New Treatments for Metastatic Differentiated and Medullary Thyroid Cancer. Marcia Brose MD PhD

Promising New Treatments for Metastatic Differentiated and Medullary Thyroid Cancer. Marcia Brose MD PhD Promising New Treatments for Metastatic Differentiated and Medullary Thyroid Cancer Marcia Brose MD PhD Department of Otorhinolaryngology: Head and Neck Surgery Department of Medicine, Division of Hematology/Oncology

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

More information

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass

More information

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary

More information

K-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF

K-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF shcttl shkras EGF + + 15 17 17 KRas EGFR pegfr 13 pplcγ 1 Level of pegfr (A.U.) 1 8 6 4 2 shkras Mock EGF Supplementary Figure S1. KRasdeficient pancreatic cancer cells retain normal RTK signalling. (a)

More information

A chemical screen in diverse breast cancer cell lines reveals genetic enhancers and suppressors of sensitivity to PI3K isoform-selective inhibition

A chemical screen in diverse breast cancer cell lines reveals genetic enhancers and suppressors of sensitivity to PI3K isoform-selective inhibition Biochem. J. (2008) 415, 97 110 (Printed in Great Britain) doi:10.1042/bj20080639 97 A chemical screen in diverse breast cancer cell lines reveals genetic enhancers and suppressors of sensitivity to PI3K

More information

Effects of sorafenib and an adenylyl cyclase activator on in vitro growth of well-differentiated thyroid cancer cells

Effects of sorafenib and an adenylyl cyclase activator on in vitro growth of well-differentiated thyroid cancer cells 2017, 64 (1), 1-10 Original Advance Publication doi: 10.1507/endocrj.EJ16-0525 Effects of sorafenib and an adenylyl cyclase activator on in vitro growth of well-differentiated thyroid cancer cells Aya

More information

Sezione di Endocrinologia e Medicina Interna Direttore: Prof. Ettore degli Uberti Dipartimento di Scienze Mediche Università degli Studi di Ferrara

Sezione di Endocrinologia e Medicina Interna Direttore: Prof. Ettore degli Uberti Dipartimento di Scienze Mediche Università degli Studi di Ferrara Sezione di Endocrinologia e Medicina Interna Direttore: Prof. Ettore degli Uberti Dipartimento di Scienze Mediche Università degli Studi di Ferrara Endocrinology Overview of genetic markers Molecular markers

More information

Activity of osimertinib and the selective RET inhibitor BLU-667 in an EGFR-mutant patient with acquired RET rearrangement.

Activity of osimertinib and the selective RET inhibitor BLU-667 in an EGFR-mutant patient with acquired RET rearrangement. Activity of osimertinib and the selective RET inhibitor in an EGFR-mutant patient with acquired RET rearrangement. Z Piotrowska 1, H Isozaki 1, JK Lennerz 1, S Digumarthy 1, JF Gainor 1, N Marcoux 1, M

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin

More information

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

THE RELATIONSHIP OF BRAF V600E MUTATION STATUS TO FDG PET/CT AVIDITY IN THYROID CANCER: A REVIEW AND META-ANALYSIS

THE RELATIONSHIP OF BRAF V600E MUTATION STATUS TO FDG PET/CT AVIDITY IN THYROID CANCER: A REVIEW AND META-ANALYSIS ENDOCRINE PRACTICE Rapid Electronic Article in Press Rapid Electronic Articles in Press are preprinted manuscripts that have been reviewed and accepted for publication, but have yet to be edited, typeset

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature23291 Supplementary discussion part 1 Our model suggests that, in tumours that express Class 3 BRAF mutants and activated RAS, both BRAF MUT /RAF WT heterodimers and WT RAF dimers are

More information

SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000

SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000 Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.

More information

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b. Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure

More information

Thyroid cancer is a genetically heterogeneous disease that

Thyroid cancer is a genetically heterogeneous disease that Correlation of BRAF V600E Mutation and Glucose Metabolism in Thyroid Cancer Patients: An F-FDG PET Study James Nagarajah 1,2, Alan L. Ho 3, R. Michael Tuttle 2, Wolfgang A. Weber 1, and Ravinder K. Grewal

More information

Brdu 24 hrs. % of BrdU positive * * Palbo 96h. Palbo 96h. Palbociclib 96 hrs. BrdU - EdU + Palbo 72 hrs. 0 hrs 0.5 hrs 24 hr

Brdu 24 hrs. % of BrdU positive * * Palbo 96h. Palbo 96h. Palbociclib 96 hrs. BrdU - EdU + Palbo 72 hrs. 0 hrs 0.5 hrs 24 hr Supplementary FIGURE - Herrera-Abreu et al. BrdU negative BrdU positive cell line: 96 hrs % of BrdU positive 8 6 Brdu 4 hrs mean cell area (µm²) 5 5 number of nuclei 3 P- S87/8 P- S87/8 4 48 7h 4 8 6 4

More information

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary

More information

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Montagut C, Argilés G, Ciardiello F, et al. Efficacy of Sym4 in patients with metastatic colorectal cancer with acquired resistance to anti-egfr therapy and molecularly selected

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28 A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Significant cytostatic effect of everolimus on a gefitinib-resistant anaplastic thyroid cancer cell line harboring PI3KCA gene mutation

Significant cytostatic effect of everolimus on a gefitinib-resistant anaplastic thyroid cancer cell line harboring PI3KCA gene mutation 522 Significant cytostatic effect of everolimus on a gefitinib-resistant anaplastic thyroid cancer cell line harboring PI3KCA gene mutation NAOYOSHI ONODA 1*, MASANORI NAKAMURA 1*, NAOKI AOMATSU 1, SATORU

More information

CAN Resubmission SUPPLEMENTAL INFORMATION

CAN Resubmission SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION CAN-5-686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)

More information

Supplementary Material

Supplementary Material Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2018 Supplementary Material 1 Supplemental Figures Supplemental Figure S1. Mechanical properties

More information