MicroRNA mir-326 regulates T H -17 differentiation and is associated with the pathogenesis of multiple sclerosis

Transcription

1 correction notice Nat. Immunol. 10, (2009) MicroRNA mir-326 regulates T H -17 differentiation and is associated with the pathogenesis of multiple sclerosis Changsheng Du, Chang Liu, Jiuhong Kang, Guixian Zhao, Zhiqiang Ye, Shichao Huang, Zhenxin Li, Zhiying Wu & Gang Pei In the version of this supplementary file originally posted online, labels above the top diagram in Supplementary Figure 4b were incorrect, and the egpf probe was included incorrectly in the Supplementary Methods. In Supplementary Figure 4b, the EF1 promoter (P EF1 ) should be IRES, and GFP should be egfp ; in the Supplementary Methods, the section on page 23 should read slides hybridized with FAM-labeled probe (Il17a, 5 TCAGGGTCCTCATTGCGGTGG 3 ) were mounted after DAPI staining. slides hybridized with biotin-labeled probes (mir-326, 5 ACTGGAGGAAGGGGGGAGAGG 3, egfp 5 CGGGGTAGCGGCTGAAGCACTGC 3 ) were blocked. The errors have been corrected in this file as of 4 December In the version of the ONLINE METHODS originally posted online, the description of the lentiviral vector was incorrect. The text in the left column, line 28, should read was cloned, downstream of the cytomegalovirus promoter, into a modified lentiviral vector generated from pcdh-cmv- MCS-EF1-copGFP (CD511B-1; System Bioscience), in which EF1-copGFP was replaced with IRES-eGFP. The error has been corrected in this file as of 4 December 2009.

2 MicroRNA mir-326 regulates T H -17 differentiation and is associated with the pathogenesis of multiple sclerosis Changsheng Du 1,5, Chang Liu 1,5, Jiuhong Kang 1,2, Guixian Zhao 3, Zhiqiang Ye 4, Shichao Huang 1, Zhenxin Li 3, Zhiying Wu 3, Gang Pei 1,2 1 Laboratory of Molecular Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences; Graduate School of the Chinese Academy of Sciences, Chinese Academy of Sciences, 320 Yueyang Road, , Shanghai, China. 2 School of Life Science and Technology, Tongji University, 1239 Siping Road, , Shanghai, China. 3 Department of Neurology and Institute of Neurology, Huashan Hospital, Shanghai Medical College, 12 Middle Wu Lu Mu Qi Road, , Shanghai, China. 4 Key Laboratory of Systems Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 320 Yueyang Road, , Shanghai, China. 5 These authors contribute equally to this work. Corresponding author: Gang Pei Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 320 Yue Yang Road, Shanghai , P. R. China Tel.: ; Fax: ; gpei@sibs.ac.cn 1

3 SUPPLEMENTARY FIGURES AND LEGENDS Supplementary Figure 1 Supplementary Figure 1. Expression of mir-326 and seven immunologically relevant micrornas in PBL of relapsing MS patients. Quantitative PCR (qpcr) analysis for expression of micrornas in peripheral blood leukocytes (PBL) of relapsing MS patients, as well as the normal controls (n = 7 per group). Data are folds (mean ± s.e.m.) relative to normal controls. **P < 0.01, versus control. The U6 small nuclear RNA (Rnu6b) was amplified as internal control. 2

4 Supplementary Figure 2 3

5 Supplementary Figure 2. Expression of Ifng, Il4, Tgfb, and Il17a in clinical samples. qpcr analysis for expression of (a) Ifng, (b) Il4, (c) Tgfb in PBL of subjects from normal controls (n = 42), NMO (n = 11), and RRMS patients (n = 43) (left panels); relapsing MS (n = 25) and remitting MS (n = 18) (middle panels); sorted cell fractions including CD4 + T cells, CD8 + T cells, and the non-t cells from PBL of relapsing MS patients and controls (right panels, n = 7 per group). (d) Similar analysis for expression of Il17a from the same samples of different groups of patients as well as different MS stages were shown. (For Il17a expression in cell fractions, see Fig. 1c, bottom panel). Data are mean ± s.e.m.; *P < 0.05, **P < 0.01, ***P < 0.005, versus control. The ribosomal gene Rpl13a was amplified as internal control. 4

6 Supplementary Figure 3 Supplementary Figure 3. Frequency of T H -17 cells in peripheral blood mononuclear cells (PBMCs) from relapsing MS patients and normal controls. PBMCs were isolated from the blood samples of relapsing MS patients and normal controls (n = 2 per group), and the frequency of IL-17 producing CD4 + T cells were measured by intracellular cytokine staining. 5

7 Supplementary Figure 4 6

8 Supplementary Figure 4. Lentivirus mediated mir-326 overexpression or inhibition. (a) MiR-326 is encoded by intron 1 of the β-arrestin 1 gene. Asterisks indicate sequence conservation. The sequences of mature mir-326, mutant mir-326, and one repeat of sponge were indicated. (b) Schematic representation of the strategy (as described in supplementary methods on line) for generating lentiviruses to express mir-326 (LV-326) or the specific inhibitor of mir-326 (LV-sponge). (c) In vitro infection of lentiviruses led to stable exogenous gene expression with over 90% efficiency in purified CD4 + T cells as indicated by the GFP reporter fluorescence. (d) Detection of mir-326 and sponge transcripts by Northern blot. Transcript of U6 was blotted as the loading control. (e) As Smoothened (Smo) has been reported as a mir-326 target 1, efficacy of LV-326 or LV-sponge on target repression or de-repression was assessed on a luciferase reporter fused with the 3 UTR sequence of Smo. Data are mean ± s.e.m.; **P < 0.01, versus control. 7

9 Supplementary Figure 5 Supplementary Figure 5. Manipulation of mir-326 in mice did not affect peripheral T/B lymphocyte population or CD4 + /CD8 + T cell ratio. Splenocytes from C57BL/6 mice infected with indicated lentiviruses were isolated on day 7 after virus administration and subjected to staining of surface markers including (a) CD3e and B220 for total T, B lymphocytes as well as (b) CD4 and CD8 for T helper cells and cytotoxic T cells. Numbers in quadrants indicated the percentages of cell subpopulations in the lymphocyte gate (n = 3 per group). 8

10 Supplementary Figure 6 9

11 Supplementary Figure 6. Fluorescence of egfp in CD4 + T cells, CD8 + T cells, and B cells of virus infected EAE mice by Fluorescence in situ hybridization (FISH). (a-d) CNS infiltrates (a), PBL (b), splenocytes (c), and draining lymph node (DLN) cells (d) were isolated from lentivirus infected mice on EAE day 14 or mock infected mice, FITC anti-cd4, CD8, or CD19 antibodies were used to label CD4 +, CD8 + T cells, and B cells respectively (green), then cell smears were prepared for FISH analysis of egfp (Cy3, red) followed by DAPI staining. Cells from mock infected mice were treated in parallel except labeling with antibodies. (e,f) The numbers of total cells (blue), cell subsets (green), and the virus infected cells (red) in each tissue were counted in 10 randomly selected visual fields. The percentages of infection in total cells (e) and specific subset of cells (f) were presented. As all the experiments have been done in parallel with LV-ctrl, LV-326, LV-sponge infected mice (n = 4-5 per group) with similar results, here we only showed the above results of the LV-326 infected mice. 10

12 Supplementary Figure 7 Supplementary Figure 7. Efficiency of lentivirus infection in naïve and effector CD4 + T cells. Naïve (CD62L + CD44 lo CD4 + ) and effector (CD62L - CD44 hi CD4 + ) T helper cells were sorted from spleen of naïve C57BL/6 mice 14 days after lentivirus infection. After FISH detection of egfp, imaging (a) or flow cytometry analysis (b) were presented. (c) Quantification of the percentages of virus infection in imaging or flow cytometry analysis in (a,b). 11

13 Supplementary Figure 8 Supplementary Figure 8. Flow cytometry analysis of CD4 + T cells, CD8 + T cells, and B cells of virus infected EAE mice after FISH analysis of egfp. PBL, splenocytes, DLN cells, and CNS infiltrates were isolated from lentivirus infected mice on EAE day 14 or mock infected mice, FITC anti-cd4, CD8, or CD19 antibodies were used to label CD4 + T cells, CD8 + T cells, and B cells respectively (FITC, green), then cells were subjected to FISH analysis of egfp (Cy3, red), which stands for the virus infection. Cells from mock infected mice were treated in parallel but without antibodies incubation. Flow cytometry analysis was performed to detect the percentages of infection in specific subset of cells. All the experiments were in parallel done with LV-ctrl, LV-326, LV-sponge infected mice (n = 4-5 per group), and the similar results were obtained, here we only showed the 12

14 above results of the LV-326 infected mice. 13

15 Supplementary Figure 9 14

16 Supplementary Figure 9. Fluorescent images of egfp and Il17a in CNS infiltrates of different viruses infected EAE mice by FISH. (a) CNS infiltrates were isolated from LV-ctrl, LV-326, or LV-sponge infected mice on EAE day 14, then cell smear were prepared for FISH analysis of Il17a (FAM, green) and egfp (Cy3, red). (b) The numbers of total cells (blue), Il17a producing cells (green), and the virus infected cells (red) in each group were counted in 10 randomly selected visual fields. The percentages of Il17a + egfp + and Il17a + egfp - cells to total cells were calculated. 15

17 Supplementary Figure 10 Supplementary Figure 10. Effect of mir-326 on IL-17 expression in CD8 + T cells or T cells. Mononuclear cells from DLN were harvested from the LV-ctrl, LV-326, and LV-sponge infected mice on EAE day 14. IL-17 production was measured within the T cells and CD8 + T cells by intracellular cytokine staining. The percentages of IL-17 + T cells or IL-17 + CD8 + T cells in total DLN cells (a) and mean fluorescence intensity (MFI) values for IL-17 in both subpopulations (b) were presented. 16

18 Supplementary Figure 11 Supplementary Figure 11. Induction of signature gene expression in in vitro differentiation system for T H 0, T H 1, T H 2, T H -17 and it reg cells. Naive CD4 + CD62L + T cells were cultured under T H 0, T H 1, T H 2, T H -17, or it reg conditions for 4 days. Transcript levels of (a) lineage specific transcription factors and (b) cytokines were analyzed by qpcr. (c) CCR6 + and CCR6 - populations were sorted from the in vitro T H -17 culture and expression of Il17a was assessed. Data for each transcript are folds (mean ± s.e.m.) relative to that in naive T cells, pooled from four independent experiments. Rpl13a was amplified as the internal control. 17

19 Supplementary Figure 12 Supplementary Figure 12. Manipulation of mir-326 by retrovirus affected the in vitro T H -17 cell differentiation. Naive CD4 + CD62L + T cells purified from spleens of C57BL/6 mice were activated and cultured under T H -17 polarizing condition. Cells were transduced with retroviruses encoding mir-326 (RV-326), its sponge (RV-sponge) or a mutant mir-326 (RV-ctrl) on day 1 and 2, and harvested on day 4 for intracellular staining of IL-17. IL-17 production by GFP + or GFP - cells were shown respectively. 18

20 Supplementary Figure 13 Supplementary Figure 13. Clinical scores of passively induced EAE mice. Passive EAE was induced by intravenous transferring myelin-reactive CD4 + T cells. We harvested splenocytes from LV-ctrl, LV-326, and LV-sponge infected mice (donor) on day14 after MOG(35-55) immunization and restimulated them in vitro with MOG(35-55) peptide for 96 hours, then the MOG-specific CD4 + T cells were transferred by intravenous injection into sublethally irradiated C57BL/6 mice (recipient, n = 3 per group). Clinical scores of EAE developed in different groups of recipient mice (mean ± s.e.m.) were shown. 19

21 Supplementary Figure 14 Supplementary Figure 14. MiR-326 did not regulate mouse Foxp3 expression. (a) Schematic representation of the mutations in mouse mir-326 seed sequence (top) and its predicted binding site within Foxp3 3 UTR (bottom). (b) Luciferase activity in HEK293T cells cotransfected with reporter plasmids containing wild type or mutant 3 UTR of mouse Foxp3 and plasmids expressing mir-326 or its mutant. Data (mean ± s.e.m.) shown were normalized to values from cells transfected with the mutant mir-326, from three independent experiments. (c) Naive CD4 + CD62L + T cells were sorted from spleens of C57BL/6 mice infected with indicated lentiviruses and cultured under it reg condition for five days. Cells were then harvested and subjected to intracellular staining for Foxp3 expression and numbers in quadrants indicated average percentage of Foxp3 producing cells within the CD4 + gate (n = 2 per group). 20

22 SUPPLEMENTARY METHODS Northern blot. For northern blot analysis, total RNA was loaded onto 15% acrylamide, 8M urea TBE (Tris & borate & EDTA) gels. After electrophoresis, RNA was transferred to a nylon membrane (Qiagen) and pre-hybridized for 1 hour at 42 C in hybridization buffer (ExpressHyb TM Hybridization Solution, Clontech). The synthesized reverse and complementary oligonucleotides of mir-326 or U6 labeled by biotin at both 5 and 3 ends were used as probes, and hybridized to the membranes for 12 hours at 42 C. After twice wash in PBS for 30 minutes, and followed by 30 minutes blocking in 10% (W/V) skim milk. Membranes were incubated with Avidin-conjugated horseradish peroxidase and exposed on X-film after ECL reaction. Reverse transcription and real-time quantitative PCR. Total RNA was extracted with TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Random Hexamer primer and M-MLV Reverse Transcriptase (Progema) were used for reverse transcription. All gene transcripts were quantified by real-time quantitative PCR performed with the JumpStart TM Taq ReadyMix TM (sigma) supplemented with EvaGreen Dye (Biotium) and on a Light Cycler apparatus (Stratagene). Primer pairs are listed below: Human Sense (5 3 ) Anti-sense (5 3 ) Ifng TCGGTAACTGACTTGAATGTCCA TCCTTTTTCGCTTCCCTGTTTT Il4 CCAACTGCTTCCCCCTCTG TCTGTTACGGTCAACTCGGTG Il17a CAATCCCACGAAATCCAGGATG GGTGGAGATTCCAAGGTGAGG 21

23 Tgfb CAACAATTCCTGGCGATACCT GCTAAGGCGAAAGCCCTCAAT Rpl13a CGAGGTTGGCTGGAAGTACC CTTCTCGGCCTGTTTCCGTAG Mouse Sense (5 3 ) Anti-sense (5 3 ) Rorc AGTGTAATGTGGCCTACTCCT GCTGCTGTTGCAGTTGTTTCT Il17a TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC Il17f TGCTACTGTTGATGTTGGGAC AATGCCCTGGTTTTGGTTGAA Il22 GTGAGAAGCTAACGTCCATC GTCTACCTCTGGTCTCATGG Il21 GATCCTGAACTTCTATCAGCTCCAC GGCATTTAGCTATGTGCTTCTGTT Il23r ACACTGGGAAGCCTACCTACA AGCTTGGACCCATACCAAATACT Tgfb CACTGATACGCCTGAGTG GTGAGCGCTGAATCGAAA Ifng ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC Il4 ACTTGAGAGAGATCATCGGCA AGCTCCATGAGAACACTAGAGTT Il10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG Ets-1 CGGGTCCCCTCCTATGACAG GAATGACAGGCTTGTCCTTGTT Rpl13a GGGCAGGTTCTGGTATTGGAT GGCTCGGAAATGGTAGGGG Fluorescence in situ hybridization. Cell smear slides were firstly incubated with or without FITC conjugated anti-cd4, CD8, B220, CD11c (BD Biosciences), washed twice with PBS, and fixed in 4% paraformaldehyde for 10 min at room temperature. Fluorescence in situ hybridization was then performed as reported 2. Briefly, after washing with PBS twice for 3 min, slides were pre-hybridized in hybridization solution (50% formamide, 5 SSC,

24 μg/ml yeast trna, 2% blocking reagent (Roche)) at 48 C for 30 min, followed by hybridization at 48 C for at least 4 hours in hybridization solution with the probes (40 nm). Slides were then subjected to three times of wash steps, each with 0.1 SSC at 55 C for 10min per wash and followed by a last wash step for 5 min in 2 SSC at room temperature. The slides hybridized with FAM-labeled probe (Il17a, 5 TCAGGGTCCTCATTGCGGTGG 3 ) were mounted after DAPI staining and analyzed on a fluorescence microscope (Leica Microsystems). The slides hybridized with biotin-labeled probes (mir-326, 5 ACTGGAGGAAGGGGGGAGAGG 3, egfp 5 CGGGGTAGCGGCTGAAGCACTGC 3 ) were blocked with blocking solution (0.5% Blocking Reagent (Roche), 0.1% Tween 20 in TBS) for 1 h at 25ºC, incubated in Avidin-Cy3 (Boster) diluted 1:2000 in blocking solution for 1 h at 25ºC, washed twice with TBS, then mounted after DAPI staining and analyzed on a fluorescence microscope. Retroviral transduction. A genomic sequence spanning mouse mir-326 coding region flanked by approximately 100bp from 5 or 3 prime in either end, or mir-326-specific inhibitory oligonucleotide ( sponge as defined in the text) was cloned into retroviral vector pgfp-rv 3 containing IRES-regulated GFP. Naïve CD4 + CD62L + T cells from C57BL/6 mice were magnetic sorted and activated with 2 μg/ml anti-cd3 and 2 μg/ml anti-cd28 and induced under standard T H -17 polarizing condition. Twenty-four hours after activation, the cells were infected with mir-326-gfp or sponge-gfp or control virus (expressing mir-326 mutant and GFP) by spinning at 2,500 rpm for 90 min, 30 C. Six hours after spin infection, virus containing supernatant was replaced by the T H -17 conditioned medium supplemented with 10ng/ml recombinant mouse IL-23 (ebioscience). Three days after infection, the cells 23

25 were restimulated with PMA and ionomycin in the presence of BFA for 5 h, after which IL-17 producing cells were analyzed by intracellular staining. CD4 + T cell adoptive transfer. For passive EAE induction, splenocytes were harvested on day 14 from MOG(35-55) immunized mice and restimulated in vitro with MOG(35-55) peptide (30μg/ml) for 96 h. CD4 + cells were then positively selected by using CD4 microbeads (Miltenyi Biotech) with over 97% purity, and CD4 + cells (in 200 μl PBS) were injected intravenously into sublethally irradiated (350 cgy) naïve recipient mice (n = 3 mice per group). Pertussis toxin (200ng per mouse) was given intraperitoneally on days 0 and 2. EAE scoring was assessed as described in online methods. SUPPLEMENTARY REFERENCE 1. Ferretti, E. et al. Concerted microrna control of Hedgehog signalling in cerebellar neuronal progenitor and tumour cells. Embo J 27, (2008). 2. Silahtaroglu, A.N. et al. Detection of micrornas in frozen tissue sections by fluorescence in situ hybridization using locked nucleic acid probes and tyramide signal amplification. Nat Protoc 2, (2007). 3. Ouyang, W. et al. Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity 9, (1998). 24