Supplementary Data. Reference

Transcription

1 Supplementary Data Supplementary Methods Cloning of the mir-155 and mir-221/222 genes Genomic DNA was isolated from hmsc-tert20 cells using the High Pure PCR Template Preparation Kit (Roche Applied Science, Indianapolis, IN), according to the manufacturer s recommendations. The mir-155 and mir-221/222 genes with flanking sequences were amplified using standard PCR and cloning procedures. mir-155 was isolated using primers mir-155_2_f and mir-155_2_r, which generated a 371-bp fragment. The resulting expression vector was designated pmahygro/to/mir-155. mir-221 and mir-222 have the same seed sequence and are separated by less than bp in the genome, suggesting that they are processed from a single transcript. As the expression patterns of mir-221 and mir-222 during differentiation were similar, we cloned both mirna genes and expressed them simultaneously from the same vector. A genomic fragment of 1,299 bp harboring the mir-221 and mir-222 genes were cloned using primers mir-221/222_f_1 and R_1 (Supplementary Table S1). The primers were designed with overhangs for either BamH I or Hind III, but T/A cloning was used. The expression vector with these mirnas was designated pmahygro/to/mir- 221/222. The CMV-driven expression vector pmahygro/to is a modified version of the pcdna5/frt/to vector (Life Technologies, Carlsbad, CA), in which the FRT site and ATG-lacking Hygromycin gene have been removed and replaced with a Hygromycin expression cassette obtained from the psilencer 3.1-H1 Hygro vector (Life Technologies). Briefly, adenosine-tailed PCR products (using standard procedures) were T/A cloned into pmahygro/to. To allow T/A cloning, the vector was first digested with EcoR V (New England Biolabs, Ipswich, MA) and subsequently thymidinetailed using standard procedures. Expression of mature mirna sequences was confirmed by transient transfection of HEK-293 cells with Lipofectamine 2000 (Life Technologies) followed by qpcr using TaqMan MiRNA Assays (Life Technologies) (Supplementary Fig. S1). pmaegfp was used to optimize the transfection conditions. This construct was generated by cloning an enhanced green fluorescent protein expression cassette from padtrack-cmv [1] (Addgene plasmid 16405) into the pgem-t Easy vector (Promega, Madison, WI). Reference 1. He T-C, S Zhou, LT da Costa, J Yu, KW Kinzler and B Vogelstein. (1998). A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95: SUPPLEMENTARY FIG. S1. Ectopic expression of mir-155 and mir-222 in HEK-293 cells. The mirna expression contructs pmahygro/to/mir-155 and pmahygro/to/mir were transiently transfected into HEK-293 cells using Lipofectamine 2000 as described by the manufacturer. Expression of mature mirnas at the indicated time points was confirmed by qpcr. pmahygro/to/mir generates both mir-221 and mir-222, illustrated by expression of mir The average of RNU6B and RNU24 was used for normalization. h: hours after transfection.

2 SUPPLEMENTARY FIG. S2. Changes in gene expression patterns of adipocyte markers during differentiation of hmsc- Tert20 cells. hmsc-tert20 cells were differentiated for 21 days, and total RNA was isolated at the indicated time points. The expression of CCAAT/enhancer-binding protein beta, (CEBPB), CCAAT/enhancer-binding protein delta (CEBPD) 1, peroxisome proliferator-activated receptor gamma (PPARG), CCAAT/enhancer-binding protein alpha (CEBPA), complement factor D (CFD) 1, and ADIPOQ 1 was analyzed using qpcr. The average of TATA-binding protein (TBP) 1 and human acidic ribosomal phosphoprotein (RPLPO) 1,orofTBP and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was used to normalize the data for the SYBR Green or TaqMan Gene Expression Assays, respectively. Representative data from 2 independent experiments are shown. 1 SYBR Green assays. d and h, days and hours after induction of adipogenesis, respectively.

3 SUPPLEMENTARY FIG. S3. Adipocyte differentiation of primary hmscs. Primary hmscs were differentiated for 21 days. (A) Representative images of differentiated and undifferentiated cells at day 21 after induction of adipogenesis are shown at 10 magnification. In addition, the cells were fixed and stained with Oil Red O to demonstrate adipocyte differentiation. (B) The expression levels of CEBPB, PPARG, CEBPA, and ADIPOQ 1 at the indicated time points after induction of adipogenesis were determined using qpcr. The average of TBP 1 and RPLPO 1,orofTBP and GAPDH, was used to normalize the data for the SYBR Green or TaqMan Gene Expression Assays, respectively. 1 SYBR Green assays. d and h, days and hours after induction of adipogenesis, respectively.

4 SUPPLEMENTARY FIG. S4. mirna expression analysis during adipocyte differentiation of hmsc-tert20. An initial microarray-based global profiling revealed that 66 mirnas were expressed in hmsc-tert20 during adipogenesis. Twenty mirnas that were differentially expressed were further investigated (bold). Two more biological replicates of differentiation were performed and the expression levels of the 20 mirnas in all 3 biological experiments were quantified using qpcr. Twelve mirnas showed consistent expression patterns in all 3 biological experiments (italic). Let-7a, mir-21, mir-26a, mir- 30d, mir-34a, and mir-92 were upregulated and mir-18a, mir-146a, mir-155, mir-214, mir-221, and mir-222 showed decreased expression levels during adipocyte differentiation. d and h: days and hours after induction of adipogenesis, respectively.

5 SUPPLEMENTARY FIG. S5. GeneGO network based on the 32 common targets. A network was generated based on the 32 common targets of mir-155 and mir-221/mir-222. Additional proteins were included to establish interactions between the predicted targets, creating a network of up to 50 proteins using GeneGO and the algorithm auto expand. Supplementary Table S1. Overview of Primers Used to Clone mir-155 and mir-221/222 from hmsc-tert20 Genomic DNA Primer Sequence (5 3 ) mir-155_2_f mir-155_2_r mir-221/222_f_1 mir-221/222_r_1 CTGTCACTCCAGCTTTATAACCG GTTTAAGGTTGAACATCCCAGTG TACGATGGATCCTCACAAGGAATCATGTATGCTG TACGATAAGCTTCTCCACTGGTTTATACCTCCTG The primers used to clone mir-221/222 (mir_221/222_f-1 and mir_221/222_r-1) have restriction sites for BamH I and Hind III (bold letters), although T/A cloning was used in the present study.

6 Supplementary Table S2. Overview of Primers Used for SYBR Green Quantitative Real-Time Polymerase Chain Reaction Gene symbol Primer names Sequence (5 3 ) References ADIPOQ ADIPOQ_F ATGGTCCTGTGATGCTTTGA [1] ADIPOQ_R GTTGAGTGCGTATGTTATTTTT CFD CFD_F ATCACCGAGCGCTTGATGTG CFD_R CTTCTTGCGGTTGCCGCAAA CEBPD CEBPD_F ACAGCCTCGCTTGGACGCAGAG [2] CEBPD_R AGTCGATGTAGGCGCTGAAGTC RPLPO RPLPO_F CGCTGCTGAACATGCTCAAC RPLPO_R TCGAACACCTGCTGGATGAC TBP TBP_F GCCCGAAACGCCGAATAT TBP_R CGTGGCTCTCTTATCCTCATGA ADIPOQ, adiponectin; CFD, complement factor D; CEBPD, CCAAT/enhancer-binding protein delta; RPLPO, human acidic ribosomal phosphoprotein PO; TBP, TATA-binding protein. [1]. Heidi SB, PL Staale, S Axel, M Marta, T Liv, AD Christian, S Unni and ER Janne. (2004). Adiponectin and its receptors are expressed in bone-forming cells. Bone 35: [2]. Tang D, GS Sivko and JW DeWille. (2006). Promoter methylation reduces C/EBPo (CEBPD) gene expression in the SUM-52PE human breast cancer cell line and in primary breast tumors. Breast Cancer Res Treat 95: Supplementary Table S3. Overview of TaqMan Gene and mirna Expression Assays Gene symbol Assay ID/part number Target genes CEBPB Hs _s1 PPARG Hs _m1 CEBPA Hs _s1 CDKN1B Hs _m1 SCD Hs _m1 Endogenous controls Human TBP E Human GAPD (GAPDH) E Target genes hsa-mir hsa-mir hsa-mir-30d hsa-mir hsa-mir-146a hsa-mir hsa-mir-20a hsa-mir hsa-mir hsa-mir hsa-mir hsa-let-7a hsa-let-7c hsa-mir-26a hsa-mir-18a hsa-mir-199a hsa-mir hsa-mir-19b hsa-mir-125a hsa-mir Endogenous controls RNU RNU6B CEBPB, CCAAT/enhancer-binding protein beta; PPARG, peroxisome proliferator-activated receptor gamma; CEBPA, CCAAT/ enhancer-binding protein alpha; CDKN1B, cyclin-dependent kinase inhibitor 1B; SCD, stearoyl coenzyme A desaturase 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

7 Supplementary Table S4. Common Predicted Targets for mir-155 and mir-221/222 Gene symbol Gene name Ref. Seq. ID ACVR2B Activin A receptor, type IIB NM_ BRWD1 Bromodomain and WD repeat domain containing 1 NM_ C14orf147 Chromosome 14 open reading frame 147 NM_ CBL Cas-Br-M (murine) ecotropic retroviral transforming sequence NM_ CD47 Homo sapiens CD47 molecule NM_ E2F2 E2F transcription factor 2 NM_ ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) NM_ FOS FBJ murine osteosarcoma viral oncogene homolog NM_ GABRA1 Gamma-aminobutyric acid (GABA) A receptor, alpha 1 NM_ H3F3A H3 histone, family 3A NM_ HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 NM_ KCNA1 Potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic NM_ ataxia with myokymia) KIAA1267 KIAA1267 NM_ KPNA1 Karyopherin alpha 1 (importin alpha 5) NM_ KSR1 Kinase suppressor of ras 1 NM_ MIDN Midnolin NM_ MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 NM_ MYO10 Myosin X NM_ NFAT5 Nuclear factor of activated T-cells 5, tonicity-responsive NM_ NOVA1 Neuro-oncological ventral antigen 1 NM_ NUFIP2 Nuclear fragile X mental retardation protein interacting protein 2 NM_ PIK3R1 Phosphoinositide 3-kinase regulatory subunit 1 (alpha) NM_ SHANK2 SH3 and multiple ankyrin repeat domains 2 NM_ SOCS1 Suppressor of cytokine signaling 1 NM_ SOX10 SRY (sex determining region Y)-box 10 NM_ SOX11 SRY (sex determining region Y)-box 11 NM_ TCF4 Transcription factor 4 NM_ TRPS1 Trichorhinophalangeal syndrome I NM_ WEE1 WEE1 homolog (S. pombe) NM_ ZMYM2 Zinc finger, MYM-type 2 NM_ ZNF618 Zinc finger protein 618 NM_ AAK1 AP2 associated kinase 1 NM_ The database TargetScan5.1 was used to identify candidate targets for either mir-155 or mir-221/222. This resulted in 281 and 306 conserved putative targets for mir-155 and mir-221/222, respectively (data not shown), and 32 common targets for all 3 mirnas.

8 Supplementary Table S5. GeneGO Analysis of Common Candidate Targets for mir-155 and mir-221/222 Name Network objects P value Top GeneGO Maps Cell differentiation 11/ E-06 Cell cycle and its regulation 7/ E-05 Apoptosis 9/ E-05 Hematopoiesis 5/ E-04 Vascular development (angiogenesis) 6/ E-03 Mitogenic signaling 6/ E-03 Inflammatory response 6/ E-03 Hypoxia response regulation 2/ E-03 Immune system response 7/ E-03 Protein synthesis 4/ E-03 Top GeneGo Pathway Maps Development_EGFR signaling via small GTPases 3/ E-05 Apoptosis and survival_ceramides signaling pathway 3/ E-05 Development_ERBB-family signaling 3/ E-05 Development_Thrombopoietin-regulated cell processes 3/ E-04 Development_GM-CSF signaling 3/ E-04 G-protein signaling_proinsulin C-peptide signaling 3/ E-04 Immune response_ifn gamma signaling pathway 3/ E-04 Immune response_trem1 signaling pathway 3/ E-04 Development_Prolactin receptor signaling 3/ E-04 Development_Gastrin in cell growth and proliferation 3/ E-04 Top GeneGo Process Network Development_Hemopoiesis, Erythropoietin pathway 6/ E-06 Cell cycle_g1-s Growth factor regulation 6/ E-05 Inflammation_IL-6 signaling 5/ E-05 Reproduction_Feeding and Neurohormones signaling 6/ E-05 Reproduction_FSH-beta signaling pathway 5/ E-04 Apoptosis_Anti-Apoptosis mediated by external signals via MAPK and JAK/STAT 5/ E-04 Immune response_phagocytosis 5/ E-04 Translation_Regulation of initiation 4/ E-04 Cell cycle_g1-s Interleukin regulation 4/ E-04 Development_EMT_Regulation of epithelial-to-mesenchymal transition 5/ E-04 Functional analysis of the common targets was performed in GeneGO. An enrichment analysis was performed and the 10 most significant findings for each of the functional categories are presented.