Growth factors in experimental liver fibrogenesis
|
|
|
- Daniel Moody
- 6 years ago
- Views:
Transcription
1 Falk Symposium 162: Leberzirrhose: Von der Pathophysiologie zur Klinik 13. Oktober 2007 Ralf Weiskirchen Institute of linical hemistry and Pathobiochemistry, UKA Growth factors in experimental liver fibrogenesis
2 ytokines in Liver Fibrogenesis Inflammation Fibrosis General PRO- ANTI- PRO- ANTI- IL-1β IL-12 TNF-α TNF-β IFN-γ IL-18 IL1-Ra IL-4 IL-10 IL-13 IL1-Ra stnfα-r TGF-β TNF-α PDGF bfgf ET-1 IL-1 IGF-1 HGF IFN-α IL-10 MP-7
3 Overview of TGF-β1 effects during activation/transdifferentiation of HS General α-sma expression collagen expression TGF-β TGF-β MP-7 Activation Transdifferentiation quiescent HS activated HS MF Initiation phase Perpetuation phase Transcriptional events Paracrine stimulation Early EM changes Increased cytokine secretion Receptor tyrosine phosphorylation EM synthesis and remodeling adapted from Friedman (2000) J. iol. hem. 275,
4 SRF function in smooth muscle cell (SM) differentiation and α-sma expression General pluripotent fibroblast (10T1/2) RP2 (Weiskirchen et al., Oncogene 1993) RP2P (Weiskirchen & Gressner, R 2000) SRF GATA SM hang et al., Dev ell 2003
5 Serum response factor (SRF) is upregulated during transdifferentiation SRF HS MF 1d 2d 3d 4d 5d 6d 7d 2d 4d SRF (67 kda) α-sma (42 kda) Ponceau S Immunocytochemistry Western blot Herrmann et al., in revision
6 Activity of SRF during transdifferentiation of HS SRF consensus SRE X HS MF 1d 3d 5d 7d 4d mutant SRE X anti-srf control IgG X X Electrophoretic mobility shift assay Supershift consensus SRE 5 -GGA TGT A TAT TAG GA AT T-3 mutant SRE 5 -GGA TGT A TAT TAT TA AT T-3 co-factors SRF SRF (A/T) 6 GG Serum response element (SRE) SM-gene expression Herrmann et al., in revision
7 A Serum response factor (SRF) target gene expression during transdifferentiation SRF Ad5-MV-GFP Ad5-SM22α-GFP Ad5-TIMP-1-GFP MV SM22α TIMP-1 GFP GFP GFP HS MF 1d 3d 5d 7d 4d Myocardin (102 kda) Ponceau S Myocardin expression reporter gene assay Herrmann et al., in revision
8 The expression of SRF is TGF-β1-dependent SRF A 5d HS 24 h starved 6d HS 48 h starved 2d HS 7d HS TGF-β1 (ng/ml) FS (%) SRF S SRF (67 kda) Ponceau S Ponceau S S (ALK5 inhibitor) Ι ΙΙ Preparation STR SRF (67 kda) Ponceau S STR = soluble TGF-β type II receptor 4-(5-benzo(1,3)dioxol-5-yl- 4-pyridin-2-yl-1H-imidazol-2-yl) benzamide Herrmann et al., in revision
9 1 RP2 is a molecular adaptor protein RP2 NH 2 LIM1 GRR LIM2 GRR OOH NH 2 Zn H Zn OOH -X 2 --X 17 -H-X 2 --X 2 --X 2 --X 17 --X J iol hem 272, (1997) iochemistry 37, (1998) J Am hem Soc 120, (1998) J iol hem 273, (1998) J Mol iol 292, (1999) Weiskirchen et al., (2001), iochem. J. 359,
10 A RP2 expression during transdifferentiation and liver injury Transdifferentiation D Normal Liver DL Liver RP2 no DL 2d DL 7d DL 14d DL RP2 α-sma β-actin Weiskirchen et al. (2001) iochem J 359:485-96; Neyzen et al. (2006) J Hepatol 44:910-7; Herrmann et al. (2006) R 345:
11 A STR vs. Untreated (normalised to β-actin) The expression of RP2 is TGF-β1 dependent STR w/o d HS β-actin p = d HS RP2 β-actin RP2 D E Starvation TGF-β1 RP2 β-actin Starvation TGF-β1 SRP2 GAPDH Primary HS Western blot FS Northern blot RP S RP2 β-actin untreated 7d DL
12 A RP2P is a binding partner of RP2 (Y2H) NH 2 LD LIM1 LIM2 OOH hrp kd D E RP2 NH 2 LD LIM1 LIM2 OOH qrp NH 2 LD LIM1 OOH hrp2(lim1) NH 2 LD LIM2 OOH hrp2(lim2) G F Weiskirchen and Gressner (2000) R 274:655-63
13 A RP2P is a Histone-Acetyltransferase (HAT) Recognition fold Paged structures RP2P For Recognition fold methodology see: Hepatology 2001; 34:230-3
14 quiescent HS control sisrf HS SRF (67 kda) Early activation phase TGF-β1 activated HS Induction of SRF expression Induction of SRF cofactors (RP2, myocardin) SRF-Network α-sma (42 kda) SM22α (22 kda) Forming of SRF cofactor complexes Expression of specific SM genes (α-sma; SM22α) S6 (32 kda) RP2 HAT RP2 Acetylation SRF SRF SM gene expression FS hrs starvation RP2 Li et al., in revision β-actin
15 A TGF-β signal transduction in HS TGF-β/HS A D Meurer et al., J. iol. hem. 2005;280:
16 A Endoglin binds TGF-β and is associated with other TGF-β receptors sc-398 (ALK-5) sc-400 (RII) AF 242 (RIII) P4A4 (Endoglin) ross-linking and Immunoprecipitation TGF-β/HS kd HS 2d HS 7d MF 4d D 24h sirna Fluo sirna Eng hrs Endoglin (NFκ A) HSP-70 HS have higher content of p-endoglin (possibly preventing surface exposition)
17 A Analysis of the Smad1/5 signalling pathway in transdifferentiating HS type II receptor type I receptors TGF-β/HS ALK5 type III receptors Smads Northern lot
18 A Activation of artificial Smad reporters (AGA) 12 -MLP-Luc and (RE) 2 -Luc (AGA) 12 - MLP-Luc reporter ( TGF-β reporter ) MLP (minimal late promoter) Transcription PAI (Plasminogen activator Inhibitor promoter element) Luciferase rel. Luc-activity * TGF-β/HS 0 control TGF-β MP-7 (RE) 2 - Luc reporter ( MP reporter ) MLP (minimal late promoter) Transcription Id-1 (Inhibitor of differentiation-1 promoter element) Luciferase rel. Luc-activity * 0 control TGF-β MP-7 Adenoviral expression (4 d HS, 3 x 10 8 pfu/ml)
19 Endoglin: Impact on TGF-β1 and MP-7 pathways TGF-β/HS Reporter-assay in L 6 E 9 myoblasts (lacking endogenous endoglin) lockade of (AGA) 12 -Signals Stimulation of (RE) 2 -Signals Scherner et al., J iol hem 2007;282:
20 TGF-β, MP-7 and Endoglin in activated HS TGF-β/HS Endoglin TGF-β MP Smad3 psmad3 Smad5 psmad5 Smad2 psmad2 Smad1 psmad1 Fibrosis Resolution
21 Specificity and duration of Endoglin knock down TGF-β/HS A kd sion - TGF-β - sieng TGF-β Endoglin kd sion 4d 7d 10d 13d sieng 4d 7d 10d 13d Endoglin 41 β-actin 70 HSP-70 D (AGA) 12 - Luciferase assay 7 6 * rel. Luc.-activity * 0 control TGF-β sion control TGF-β sieng
22 A MP-7 Analysis of MP-7 and MP-7 receptor expression in HS RT-PR TGF-β/HS Receptors Western blot HS/MF don t express but are responsive towards MP-7
23 A Antagonisms of TGF-β1 and MP-7 in HS MP-7 [ng/ml] TGF-β/HS MP-7 [ng/ml] D MP-7 [ng/ml] ytosol Nucleus
24 TGF-β1 SUMMARY Smad phosphorylation SRF expression and activation + expression of SRF cofactors (e.g. RP2, myocardin) Endoglin Summary Activation Transdifferentiation quiescent HS activated HS generation of SRF-cofactor complexes MF activation of SM specific genes (e.g. SMA) EM synthesis expression (e.g. collagen type I) MP-7
25 Acknowledgement Institute of linical hemistry and Pathobiochemistry, UKA Steffen K. Meurer Olav Scherner Wanda N. Vreden Lidia Tihaa Erawan orkham-kamphorst Sabine Weiskirchen Senait Mengsteab Eddy van de Leur armen G. Tag Simone Mohren Olav A. Gressner Jens Herrmann Falko Drews Axel M. Gressner Martin Roderfeld, Elke Roeb Department of Internal Medicine II, University Hospital Giessen Sandip M. Kanse, Klaus T. Preissner Institute of iochemistry, University Hospital Giessen Reinhard üttner Institute of Pathology, University Hospital onn INNOVATIONSPROGRAMM F O R S H U N G Florian Winau, Stefan Kaufmann Department of Immunology, Max-Planck-Institute for Infection iology (erlin) Ankang Li, Robert J. Schwartz aylor ollege of Medicine, enter for Molecular Development and Disease, Houston, TX, USA Joachim Grötzinger hristian Albrecht University Kiel, Institute of iochemistry, Med. Faculty, Structural iology Group SF 542
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Familial PAH. Genetics and pulmonary arterial hypertension. PAH and mutations in the bone morphogenetic protein type II receptor (BMPR-II)
athology of vascular lesions in idiopathic pulmonary arterial hypertension Genetics and pulmonary arterial hypertension Concentric intimal lesion Nick Morrell British Heart Foundation rofessor of Cardiopulmonary
Liposome Mediated Delivery of sirna to Hepatic Stellate Cells Alfica Sehgal, Mohammad Zafari, Boris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz
Liposome Mediated Delivery of sirn to Hepatic Stellate ells lfica Sehgal, Mohammad Zafari, oris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz Shaikh, Martin Maier, Jonathan O Shea, Lauren Speciner,
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
Understanding Root Cause: Pathogenesis of Hepatic Fibrosis
10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis
Research article. Department of Pharmacology and Toxicology, Medical College of Georgia, Georgia Health Sciences University, Augusta, Georgia, USA.
Research article Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension, and its inhibition attenuates pathologic features of disease Wanli Ma, 1 Weihong Han, 1 Peter
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The manuscript by Wu et al describes critical role of RNA binding protein CUGBP1 in the development of TGF-beta-mediated liver fibrosis. The activation
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
D2 inhibits TLR2- initiated 12p40 transcription (-) TLR2 PGN MDP. MyD88 IRAK ECSIT TRAF6 NIK. Smallest unit of PGN muramyl dipeptide IKK.
D2 inhibits TLR2- initiated 12p40 transcription CARD CARD NOD2 LRR RICK/Rip2 NIK MDP TRAF6 PGN TLR2 MyD88 IRAK ECSIT (-) IKK Smallest unit of PGN muramyl dipeptide IκB NF-κB atanabe et al, 2004 NF-κB IL-12p40
Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
Phospholipase C γ Prof. Graham Carpenter
Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Mechanisms of hepatic fibrogenesis in chronic liver disease
Mechanisms of hepatic fibrogenesis in chronic liver disease JPEMS 2014, Physiopathology Module Corentin Bessy (Nantes) _ Gabrielle Cepella (Amsterdam) _ Charly Gaisne (Angers) _ Gwladys Guilloineau (Angers)
Connective Tissue Response in IBD
Connective Tissue Response in IBD Dr I C Lawrance MB BS, PhD FRACP School of Medicine and Pharmacology, University of Western Australia, Fremantle Hospital Intestinal response to Chronic Inflammation Control
2015 ICDM, 15-17, Jejudob Island, Korea Recent Advances in Diabetic Microvascular Complications. DPP-4 Inhibition and Diabetic Nephropathy
2015 ICDM, 15-17, Jejudob Island, Korea Recent Advances in Diabetic Microvascular Complications DPP-4 Inhibition and Diabetic Nephropathy Daisuke Koya Department of Diabetology & Endocrinology Kanazawa
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
European Society of Cardiology Congress DONOR AGE NEGATIVELY INFLUENCES THE CYTOPROTECTIVE PARACRINE EFFECTS EXERTED BY HUMAN MESENCHYMAL STEM CELLS
European Society of Cardiology Congress 28 Aug - 01 Sep 2009, Stockholm - Sweden DONOR AGE NEGATIVELY INFLUENCES THE CYTOPROTECTIVE PARACRINE EFFECTS EXERTED BY HUMAN MESENCHYMAL STEM CELLS Massimiliano
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.
Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/305/ra106/dc1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
Mesenchymal progenitor cells in intramuscular connective tissue development
Mesenchymal progenitor cells in intramuscular connective tissue development Min Du, Ph.D. Professor and Endowed Chair Department of Animal Sciences Washington State University Pullman, WA Beef Quality:
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
Cell-mediated Immunity
Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral
Host cell activation
Dept. of Internal Medicine/Infectious and Respiratory Diseases Stefan Hippenstiel Epigenetics as regulator of inflammation Host cell activation LPS TLR NOD2 MDP TRAF IKK NF-κB IL-x, TNFα,... Chromatin
Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9
Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.
CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
Chapter 13: Cytokines
Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or
Control. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
Transduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
Pedro A. Martinez, PhD December 7 th, 2015
RAP-536 (Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA-1 Function in Murine β-thalassemia Pedro A. Martinez, PhD December 7 th, 2015 Outline
About OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
Laura Smart 9/22/2011
Laura Smart 9/22/2011 Fibrosis is a wound healing response in which damaged regions are encapsulated by an extracellular matrix or scar. Fibrosis develops in almost all patients with chronic liver injury
Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma
P909 Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma Tedeschi R, Bidoli E 2, Bortolin MT, Pratesi C, Basaglia G, Zanussi
CD40L TCR IL-12 TLR-L
CD40L B cells plasmacells Neutrophils TCR inkt cells IL-12 Ab production Can inkt cells modulate the cytokine profile of neutrophils? TLR-L CD4+ and CD8+ T cell responses 1. The invariant TCR expressed
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
IL-24 AND ITS ROLE IN WOUND HEALING
IL-24 AND ITS ROLE IN WOUND HEALING Nancy J. Poindexter, Ryan Williams, Garth Powis, Sunil Chada, and Elizabeth A. Grimm & Introgen Therapeutics, Inc., Houston, TX IL-24/MDA 24/MDA-77 is a Tumor Suppressor
Relevant Disclosures
6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis
Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition.
Manuscript EMBO-2012-82682 Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition. David Balli, Vladimir Ustiyan, Yufang Zhang, I-Ching Wang, Alex J. Masino,
Healing & Repair. Tissue Regeneration
Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
Pedro A. Martinez, PhD June 10 th, 2016
(Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA1 Function in Murine β-thalassemia Pedro A. Martinez, PhD June 10 th, 2016 ACE-536 is a
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis
Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis V. Deshmukh 1, T. Seo 1, C. Swearingen 1, Y. Yazici 1 1 Samumed,
Progressive liver damage in patients with chronic
The Marburg I Variant (G534E) of the Factor VII Activating Protease Determines Liver Fibrosis in Hepatitis C Infection by Reduced Proteolysis of Platelet-Derived Growth Factor BB Hermann E. Wasmuth, 1
Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors
Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Seo-Yoon Chang, Jae Min Cho, Yang-Hyeok Jo, Myung-Jun Kim Departments of Physiology, College of Medicine, The
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
(PDGF), 9 ( -2 (FGF-2), SMO
Abstract An ethanol extract from shark muscle has been shown to have potent angiogenic activity when mixed together with olive oil in a ratio of 1part extract to 9 parts olive oil. This mixture has been
BIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Th17 Pathway Research By Bio-Plex
Th17 Pathway Research By Bio-Plex Zhiyang Shen, Senior Product Manager Bio-Rad Laboratories, Inc 2011 年 6 月 28 日星期二 T helper cell research Timeline: advances on T helper research. Figure depicts some of
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
Serum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
MCB130 Midterm. GSI s Name:
1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
PUBLICATIONS. cells. J. Physiol. (London) 517P:91P (Manchester, England, UK).
277 PUBLICATIONS Abstracts Haddad JJ, Land SC (1999). Differential activation of oxygen-responsive transcription factors over fetal-to-neonatal alveolar oxygen tensions in rat fetal distal lung epithelial
Uncovering the mechanisms of wound healing and fibrosis
Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
Epigenetic Control of ENaC
Epigenetic Control of ENaC Transcription, Na + Metabolism and Blood Pressure Wenzheng Zhang, Ph.D. Department of Internal Medicine The University of Texas Medical School at Houston International Conference
CONTRACTING ORGANIZATION: McGill University Health Center
AD Award Number: W81XWH-11-1-0009 TITLE: Studying the Roles of GRK2-Mediated Smad2/3 Phosphorylation as a Negative Feedback Mechanism of TGF-Beta Signaling and a Target of Breast Cancer Therapeutics. PRINCIPAL
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Basis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
Computational Biology I LSM5191
Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture 6 Notes: Control Systems in Gene Expression Pulling it all together: coordinated control of transcriptional regulatory molecules Simple Control:
Supplemental material for Hernandez et al. Dicoumarol downregulates human PTTG1/Securin mrna expression. through inhibition of Hsp90
Supplemental material for Hernandez et al. Dicoumarol downregulates human PTTG1/Securin mrna expression through inhibition of Hsp90 Dicoumarol-Sepharose co-precipitation. Hsp90 inhibitors can co-precipitate
Viral infections in airway remodeling
Viral infections in airway remodeling Nikos Papadopoulos As. Proffesor,Head, Allergy Dpt, 2 nd Pediatric Clinic, University of Athens Overview Acute events may have long term consequences Remodeling appears
Brd4 Coactivates Transcriptional Activation of NF- B via Specific Binding to Acetylated RelA
MOLECULAR AND CELLULAR BIOLOGY, Mar. 2009, p. 1375 1387 Vol. 29, No. 5 0270-7306/09/$08.00 0 doi:10.1128/mcb.01365-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. Brd4 Coactivates
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Materials and Methods
Short term hyperthermia prevents activation of proinflammatory genes in type B synoviocytes by blocking the activation of the transcription factor NF-κB Marica Markovic Institute of Medical Biochemistry,
INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells
Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,
Chapter 15: Signal transduction
Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,