Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF
|
|
|
- Gabriel Lindsey
- 5 years ago
- Views:
Transcription
1 Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF
2 Assay IC 50 nm Selectivity Ratio d Biochemical Activity In Vitro c-met/hgfr enzyme (Ki, nm) a 4 NA Cellular Activity In Vitro c-met phosphorylation in human tumor cell lines (mean IC 50 ) b,c 11 NA c-met phosphorylation in mouse IMCD3 epithelial cells (IC 50 ) b 5 NA Phosphorylation of c-met WT in NIH3T3 cells (IC 50 ) b 13 NA Phosphorylation of c-met mutant V1092I in NIH3T3 cells (IC 50 ) b 19 NA Phosphorylation of c-met mutant H1094R in NIH3T3 cells (IC 50 ) b 2 0.1X Phosphorylation of c-met mutant Y1230C in NIH3T3 cells (IC 50 ) b X Phosphorylation of c-met mutant Y1235D in T47D cells (IC 50 ) b 92 8X Phosphorylation of c-met mutant M1250T in NIH3T3 cells (IC 50 ) b 15 NA Phosphorylation of c-met in NCI-H69 cells expressing c-met R988C variant (IC 50 ) b 13 NA Phosphorylation of c-met in HOP92 cells expressing c-met T1010I variant (IC 50 ) b 16 NA NPM-ALK phosphorylation in human Karpas299 lymphoma cells (IC 50 ) b 24 2X Cellular Activity Against Non-Target Kinases In Vitro MSP-stimulated RON phosphorylation in NIH-3T3-RON cells (mean IC 50 ) b X RON phosphorylation in RON-GYRB cells (mean IC 50 ) b X Gas6-stimulated Axl phosphorylation in NIH-3T3-Axl cells (mean IC 50 ) b X Ligand-stimulated Tie-2 phosphorylation in NIH-3T3-Tie-2/EGFR cells (mean IC 50 ) b X NGF-stimulated TrkA phosphorylation in Trk A-PAE cells (mean IC 50 ) b X BDNF-stimulated TrkB phosphorylation in Trk B-PAE cells (mean IC 50 ) b X BCR-Abl phosphorylation in BCR-Abl-BaF3 cells (mean IC 50 ) b,e 1159 >100X Insulin-stimulated insulin receptor phosphorylation in 293-IRK cells (mean IC 50 ) b 2887 >250X CD3-stimulated Lck-dependent Zap70 phosphorylation in Jurkat cells (mean IC 50 ) b 2741 >250X Gas6-stimulated Sky phosphorylation in NIH-3T3-Sky cells (mean IC 50 ) b >10000 ~1000X Definitions a Ki for c-met/hgfr enzyme inhibition determined by monitoring NADH oxidation coupled to ATP turnover. b IC 50 values were determined after exposure of various cell lines to several concentrations of PF for 1 hour and measuring phosphorylation in cellular protein lysates by ELISA as described in Materials and Methods. IC 50 values were generated by curve fitting using a four-parameter analysis. c Mean IC 50 value derived from mean IC 50 value for c-met/hgfr phosphorylation across a panel of 7 human tumor cell lines (i.e., A549, MDA-MB-231, GTL-16, HT29, 786-O, Colo-205, A498). d Mean c cell c-met IC 50 was used to calculate the selectivity ratio for cell assays. Selectivity Index was calculated as IC 50, (c-met)/ic 50, (target). e BaF3 cells engineered to express human BCR-Abl were acquired from Dr. Brian Druker (Oregon Health and Science University, Portland). WT = Wild Type Antibody reagents and growth factors: Anti-phospho Zap70 was acquired from Zymed/Invitrogen (Carlsbad, CA). Anti-RON, FGFR1, PDGFRβ, Trk, Tie-2, and anti-phospho tyrosine (PY-20) were acquired from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-Axl and Sky antibodies and MSP, Gas6, NGF, EGF, and Insulin were acquired from R&D Systems (Minneapolis, MN). Anti-IRK was acquired from BD Pharmingen (San Diego, CA). Anti-VEGFR2 was acquired from Novus Biologicals (Littleton, CO). Anti-total and phospho ALK and anti-c- ABL were acquired from Cell Signaling Technologies (Boston, MA). BDGF was acquired from GibcoBRL/Invitrogen (Carlsbad, CA).
3
4 Supplemental Table 2. Effect of PF on c-met -Dependent Phenotypes in Cancer Cells PF Assay Concentration IC 50 (nm) a Tumor Cell Phenotypes Proliferation (MTT assay) of GTL-16 gastric carcinoma cells (mean IC 50 ) 9.7 Apoptosis (ccdna assay) of GTL-16 gastric carcinoma cells (mean IC 50 ) 8.4 HGF-stimulated NCI-H441 NSCLC cell Boyden Chamber migration (IC 50 ) 11 HGF-stimulated NCI-H441 NSCLC cell Boyden Chamber Matrigel invasion (IC 50 ) 6.1 HGF-stimulated MDCK cell colony scattering (mean IC 50 ) 16 Endothelial Cell Phenotypes HGF-stimulated HUVEC endothelial cell survival (MTT assay) (mean IC 50 ) 11 HGF-stimulated HUVEC cell Matrigel invasion (mean IC 50 ) 35 HMVEC endothelial cell tubulogenesis in fibrin gels (estimated IC 50 ) 80 a IC 50 values were generated by curve fitting using a four-parameter analysis. Definitions: NSCLC=non-small cell lung cancer; MDCK=Madin-Darby Canine Kidney; HUVEC=human umbilical vein endothelial cells; HMVEC=human microvascular endothelial cells
5 Supplemental Figure Legends Supplemental Figure 1. PF (R)-3-[1-(2,6-Dichloro-3-fluoro-phenyl)- ethoxy]-5-(1-piperidin-4-yl-1h-pyrazol-4-yl)-pyridin-2-ylamine Supplemental Figure 2. PF Inhibited HGF-stimulated NCI-H441Cell Migration and Invasion in vitro- NCI-H441 cells were treated with HGF (25 ng/ml) or designated concentrations of PF and migration of cells across a membrane (Top Panel) and/or a layer of matrigel (Invasion--Lower Panel) to the lower well of a 2- chamber plate was assessed after 22 hours. Cells that invaded or migrated to the lower well of the plate were then fixed, nuclei were stained with DAPI, and the number of migrating or invading cells was determined utilzing ImagePro Plus software. Supplemental Figure 3. Dose-Dependent Induction of Apoptosis by PF in Tumor Xenografts In Vivo. Immunohistochemical evaluation of activated caspase-3 expression was determined in GTL-16 (A) or U87MG (B) tumors at 50 mg/kg/day qd on study day 4. For each study, athymic mice bearing established GTL-16 or U87MG xenografts were orally administered vehicle or PF at the indicated dose levels qd. At designated study days at 4 hours post-administration of PF , mice were humanely euthanized, tumors were resected and fixed in 10% neutral buffered formalin for 24 hours, and then placed in 70% ethanol. Fixed tumors were embedded in paraffin, cut into 4 mm sections, and immunostained for activated caspase-3 as described in Materials and Methods. Slides were visually assessed for expression and distribution of activated caspase-3 by light microscopy.
6 Supplemental Figure 1 NH N N Cl O N Supplemental Figure 2 F Cl NH 2 Supplemental Figure 3 A. B.
SUPPLEMENTARY INFORMATION
Supplementary Information S3 TAM- family small molecule kinase inhibitors in development Compound Indication(s) Target Profile Develop Primary Target MERTK TYRO3 Other targets ment Phase Refs Cabozantinib
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm)
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm) Class I Class II HDAC1 HDAC2 HDAC3 HDAC8 HDAC4 HDAC5 HDAC6 HDAC7 HDAC9 HDAC10 4.5 12.6 9.1 79.8 13.2 11.4
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
Supplementary information
Supplementary information Pyk2 activates the NLRP3 inflammasome by directly phosphorylating ASC and contributes to inflammasome-dependent peritonitis I-Che Chung 1, Chun-Nan OuYang 1, Sheng-Ning Yuan 1,
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria,
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
ALM301: Allosteric Isoform selective Akt inhibitor
ALM301: Allosteric Isoform selective Akt inhibitor Background Akt1/2 selective inhibitors ALM301 Back-up compounds Akt2 selective inhibitors Approaches to Akt Inhibition Both ATP competitive and allosteric
(PDGF), 9 ( -2 (FGF-2), SMO
Abstract An ethanol extract from shark muscle has been shown to have potent angiogenic activity when mixed together with olive oil in a ratio of 1part extract to 9 parts olive oil. This mixture has been
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified
Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing
Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like
SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Supplemental Data. Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB. Supplemental Experimental Procedures
Supplemental Data Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB Dos D. Sarbassov, Siraj M. Ali, Shomit Sengupta, Joon-Ho Sheen, Peggy P. Hsu, Alex F. Bagley, Andrew L. Markhard, and
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
RXDX-101 & RXDX-102. Justin Gainor, MD February 20 th, 2014
RXDX-101 & RXDX-102 Justin Gainor, MD February 20 th, 2014 Background Chromosomal fusions are important oncogenic drivers in NSCLC - ALK Rearrangements (4-6%) - ROS1 Rearrangements (1-2%) - RET Rearrangements
Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
Supplementary Figure S1. Supplementary Figure S1. Chemical structure of CH
Supplementary Figure S1 Supplementary Figure S1. Chemical structure of CH7057288. Supplementary Figure S2 Kinase % competition TRKA 99 TRKC 95 TRKB 92 MEK5 87 AXL 84 CLK1 82 MERTK 82 GCN2 (Kin.Dom.2,S808G)
Supplementary Information. Targeting BRK-positive Breast Cancer with Small
Supplementary Information Targeting BRK-positive Breast Cancer with Small Molecule Kinase Inhibitors Jie Jiang 1#, Fu Gui 1#, Zhixiang He 1#, Li Li 1, Yunzhan Li 1, Shunying Li 2, Xinrui Wu 1, Zhou Deng
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Antitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models
Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on
Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Supplementary Information
Supplementary Information Lymphatic endothelial cells support tumor growth in breast cancer Esak Lee a, Niranjan B. Pandey a, and Aleksander S. Popel a,b a Department of Biomedical Engineering, Johns Hopkins
Co-Development of DELFIA Technology. - Assessment of DELFIA technology in drug biodistribution in small animals
Co-Development of DELFIA Technology PerkinElmer - Wallac Inc & - Assessment of DELFIA technology in drug biodistribution in small animals Project Report 1.9.2004-22.3.2005 Aki Koivistoinen, 1 BACKGROUND
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Mechanisms of resistance to JAK inhibitors. L. Knoops
Mechanisms of resistance to JAK inhibitors L. Knoops 1 : Resistance to tyrosine kinase inhibition in cancer are related in sequence and structure. The main diagram illustrates the similarity between the
Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Nieuwe targets en cfdna
Nieuwe targets en cfdna dr. A.J. van der Wekken Universitair Medische Centrum Groningen Leek meeting 2017 Disclosure Advisory board: Lilly Boehringer-Ingelheim Pfizer AstraZeneca MSD Lectures: Lilly Boehringer-Ingelheim
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
TITLE: Notch in Pathological Angiogenesis and Lymphangiogenesis
Award Number: W81XWH-10-1-0304 TITLE: Notch in Pathological Angiogenesis and Lymphangiogenesis PRINCIPAL INVESTIGATOR: Minji Kim CONTRACTING ORGANIZATION: Columbia University New York, NY 10032 REPORT
Osamu Tetsu, MD, PhD Associate Professor Department of Otolaryngology-Head and Neck Surgery School of Medicine, University of California, San
Osamu Tetsu, MD, PhD Associate Professor Department of Otolaryngology-Head and Neck Surgery School of Medicine, University of California, San Francisco Lung Cancer Classification Pathological Classification
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.
IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically
B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid
Supplementary Results BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid leukemia Oliver Hantschel*, Wolfgang Warsch*, Eva Eckelhart*, Ines Kaupe, Florian Grebien, Kay-Uwe Wagner, Giulio
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Inhibitors of Methionine Aminopeptidase-2 2 in the Treatment of Non-Hodgkin
Inhibitors of Methionine Aminopeptidase-2 2 in the Treatment of Non-Hodgkin Hodgkin s s Lymphoma Targeted Cancer Therapies William Westlin, Ph.D. Vice President, Preclinical Research Discovery of Fumagillin
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
c-abl PDGFRα PDGFRβ VEGFR-1 VEGFR-2 FLT-3 c-fms c-kit Ref. 2 (ND) 9.4 (ND) Supplementary Table 2. Chemical structure of the RTKIs used in this study.
SUPPLEMETARY DATA Supplementary Table 1. Upper and lower entries in each cell represent IC50 (nm) values determined by a biochemical kinase assay or cellular tyrosine kinase phosphorylation, respectively.
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
SUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
Targeting the Molecular Chaperone Hsp90 in Cancer: What Does the Biology Tell Us? Len Neckers TAT 2011
Targeting the Molecular Chaperone Hsp90 in Cancer: What Does the Biology Tell Us? Len Neckers TAT 2011 Regular Folding Pathways Molecular Chaperones Quality Control of Misfolded Proteins Activity & Stability
Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
RayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
Scavenger receptor class B type I regulates cellular cholesterol metabolism and cell signaling associated with breast cancer development.
Thomas Jefferson University Jefferson Digital Commons Department of Stem Cell Biology and Regenerative Medicine Papers & Presentations Department of Stem Cell Biology and Regenerative Medicine 9-24-2013
FGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-4-1-82 TITLE: Effect of Saw Palmetto on the Development and Progression of Prostate Carcinoma in TRAMP Mice PRINCIPAL INVESTIGATOR: Charles E. Roselli CONTRACTING ORGANIZATION:
Clinical Policy: Cetuximab (Erbitux) Reference Number: PA.CP.PHAR.317
Clinical Policy: (Erbitux) Reference Number: PA.CP.PHAR.317 Effective Date: 01/18 Last Review Date: 11/17 Coding Implications Revision Log Description The intent of the criteria is to ensure that patients
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis
SUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
PLX7486 Background Information October Candidate for CRUK Combinations Alliance
PLX7486 Background Information October 2015 Candidate for CRUK Combinations Alliance 1 Oct 2015 Plexxikon s Development Pipeline Compound Target Cancer Indication Stage of Development Pre- IND Ph1 Ph2
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
2 nd line Therapy and Beyond NSCLC. Alan Sandler, M.D. Oregon Health & Science University
2 nd line Therapy and Beyond NSCLC Alan Sandler, M.D. Oregon Health & Science University Treatment options for advanced or metastatic (stage IIIb/IV) NSCLC Suitable for chemotherapy Diagnosis Unsuitable/unwilling
(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis
Cell Reports, Volume 21 Supplemental Information Differential Effects of EGFL6 on Tumor versus Wound Angiogenesis Kyunghee Noh, Lingegowda S. Mangala, Hee-Dong Han, Ningyan Zhang, Sunila Pradeep, Sherry
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted
MECHANISMS OF 1ST GENERATION RESISTANCE. Byoung Chul Cho, M.D., Ph.D.
MECHANISMS OF 1ST GENERATION RESISTANCE Byoung Chul Cho, M.D., Ph.D. CONFLICT OF INTEREST Research funding: Novartis, Bayer, AstraZeneca, MOGAM Institute, Dong-A ST Consulting role: Novartis, AstraZeneca,
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations
Transcriptional factor Snail and MMP-9 signaling axis controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Samar Abdulkhalek 1, Olivia Geen 1, Lacey Brodhagen
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)