Inhibition of Gastric Cancer Invasion and Metastasis by PLA2G2A, a Novel β-catenin/tcf Target Gene

Size: px

Start display at page:

Download "Inhibition of Gastric Cancer Invasion and Metastasis by PLA2G2A, a Novel β-catenin/tcf Target Gene"

Ira Gibson
5 years ago
Views:

1 Supplementary Information Inhibition of Gastric Cancer Invasion and Metastasis by PLA2G2A, a Novel β-catenin/tcf Target Gene Kumaresan Ganesan, 1 Tatiana Ivanova, 1 Yonghui Wu, 1 Vikneswari Rajasegaran, 2 Jeanie Wu, 1 Ming Hui Lee, 1 Kun Yu, 1 Sun Young Rha, 3 Hyun Cheol Chung, 3 Bauke Ylstra, 4 Gerrit Meijer, 4 Kon Oi Lian, 5 Heike Grabsch, 6 and Patrick Tan 1,2,7,* 1 Cellular and Molecular Research and 5 Division of Medical Sciences, National Cancer Centre, 11 Hospital Drive, Singapore, Duke-NUS Graduate Medical School, 2 Jalan Bukit Merah, Singapore, Department of Internal Medicine, Yonsei Cancer Center, Yonsei University College of Medicine, 134 Shinchon-Dong, Seodaemun-Ku, Seoul, Korea Department of Pathology, VU University Medical Center, PO Box 757, 17 MB Amsterdam, Netherlands. 6 Dept of Pathology and Tumour Biology, Leeds Institute for Molecular Medicine, St James's University Hospital, Beckett Street, Leeds, LS9 7TF. United Kingdom. 7 Genome Institute of Singapore, 6 Biopolis Street Genome #2-1, Singapore, * Corresponding author gmstanp@nus.edu.sg Tel : , Fax :

2 A E xpression Units (Arbitrary) PLA2G2A expression (mrna) AGS YCC3 KatoIII SNU16 SNU1 SNU5 NCI-N87 YCC1 YCC2 YCC6 YCC9 YCC1 YCC16 MKN7 IM95 Hs746T Fu97 B AGS YCC3 KATO III NCI-N87 SNU1 SNU5 SNU16 PLA2G2A β-actin Figure S1. PLA2G2A expression in gastric cancer cell lines. (A) Relative PLA2G2A mrna expression in 17 GC cell lines determined by Affymetrix U133A plus arrays. (B) Semi-quantitative RT-PCR confirming the expression of PLA2G2A mrna in a panel of GC cell lines. RT-PCR for β-actin gene shows the usage of equal amounts of RNA in all samples. 2

3 A Chr3: CTNNB1 locus (41.25 Mb mb) Copy number (absolute) CON1 CON2 CON3 CON4 CON5 CON6 CON7 CON8 AGS Fu97 Hs 746T IM95 KATO III MKN7 NCI-N87 SNU-1 SNU-16 SNU-5 YCC1 YCC11 YCC16 YCC2 YCC3 YCC6 YCC9 B CTNNB1 mrna Expression Units (absolute) AGS YCC3 Kato III N87 SNU1 SNU5 SNU16 C Gene β- catenin APC AGS G34E mutation a WT YCC3 WT & Genomic Amplification WT (MCR) Kato III WT & Genomic Amplification b Promoter Methylation c Figure S2. Amplification of CTNNB1 locus in the gastric cancer cell lines Kato III and YCC3. (A) Representation of genomic copy number gains of CTNNB1 locus in gastric cancer cell lines Kato-III and YCC3, as estimated by 5K SNP arrays (Affymetrix). CON represents the genomic DNA from normal healthy control lymphocytes. Location of CTNNB1 in human genome is Chr 3, 41,216,4-41,256,938. The estimated copy numbers of the four probes in this region from 8 controls and 17 cell lines are shown. (B) CTNNB1 mrna expression in the GC cell lines as determined by Affymetrix U133A plus arrays. Relatively higher level of CTNNB1 mrna is expressed in the GC cell lines with CTNNB1 locus amplification (Kato-III followed by YCC3). (C) PLA2G2A is expressed in Wnt-hyperactive GC cells. Table showing the gain of functions in β-catenin and loss of APC expression in the Wnt hyperactive cell lines (Refs: a: (1), b: (2), c: (3)). In YCC3, CTNNB1 coding region and the mutation cluster region (MCR) of APC are wild type. 3

4 A Kato III Control sirna CTNNB1 sirna PLA2G2A: RT-PCR CTNNB1: RT-PCR β-actin: RT-PCR B PLA2G2A (mrna) expression (%) Control sirna CTNNB1 sirna AGS YCC3 Figure S3. Transcription of PLA2G2A is regulated by β-catenin in gastric cancer cell lines. (A) β-catenin knockdown by sirna mediated silencing in KatoIII cells results in inhibition of PLA2G2A transcription, which is revealed by semi-quantitative RT-PCR. The two lanes for both control and CTNNB1 sirna represent two independent experiments. (B) Quantitative representation of the reduction in PLA2G2A transcripts in β-catenin silenced AGS and YCC3 cells. Quantitations were performed from the intensity of ethidium bromide stained RT-PCR fragments shown in Figure 1B and the quantities of PLA2G2A mrna were calculated by considering the mrna in control sirna treated samples as 1%. 4

-133-925 TCF-binding site PLA2G2A promoter TSS (+1) Figure S4. Nucleotide sequence of PLA2G2A promoter.

5 TCF-binding site PLA2G2A promoter TSS (+1) Figure S4. Nucleotide sequence of PLA2G2A promoter. PLA2G2A promoter has three consensus TCF binding sites in the region between transcription start site (TSS) and bp. Consensus TCF binding sites are highlighted yellow. Figure S5. PLA2G2A inhibits the cellular invasion in AGS cells. AGS cells, control sirna transfected AGS cells and PLA2G2A sirna transfected cells were subjected to matrigel invasion assay and the cells invaded through the invasion chamber are counted. Representative photographs of the cells invaded through the membrane. 5

6 A ploka-vector ploka-non specific ploka-361 ploka-361 ploka-665 ploka-33 ps2mag-75 ps2mag-841 B ploka-vector ploka-non specific ploka-361 ploka-665 ploka-33 ps2mag-75 ps2mag-841 Anti-PLA2G2A Anti-Vinculin PLA2G2A GAPDH C AGS S AGS S Weeks Anti- PLA2G2A AGS-Non Specific Control AGS-sh PLA2G2A (ploka361) Anti- β Actin Figure S6. Selection of stable PLA2G2A silenced AGS cells. (A) Screening of multiple targets/constructs for efficient stable silencing of PLA2G2A. AGS cells were transduced or transfected with different lentiviral/retroviral shrna constructs and the stable pools of clones were selected. Maximum silencing was obtained in AGS cells transduced with ploka-361shrna construct. (B) RT-PCR screening of multiple AGS-PLA2G2A shrna clones for PLA2G2A knock-down. (C) Monitoring of stable silencing: the frozen stable pools of cells (S) were subsequently passaged for ten weeks and the silencing was analyzed by immunoblotting. It was identified that clone AGS-pLOKA361 is also good in terms of long term silencing. AGS is the parental cell line and AGS-sh Non specific control cells are non-targeting shrna producing cells. AGS-pLOKA361 cells were designated as AGS-shPLA2G2A cells and used in further experiments. 6

7 Figure S7. PLA2G2A inhibits the cellular migration in N87 cells. Wound healing/cell migration assay performed on monolayer cells reveal the PLA2G2A mediated inhibition of cellular migration in N87 cells. Photographs are the representative wounded & healed areas in N87, N87-pCDNA and N87-PLA2G2A cell lines in the cell migration assay. 7

8 Figure S8. The nucleotide sequence of PLA2G2A promoter with CpG sites. The consensus TCF binding sites in the PLA2G2A promoter are highlighted yellow and the CpG sites are highlighted in blue. Relative TCF activity (Folds) Control GSK3β Inhibitor N87 YCC1 Figure S9. Enhancement of TCF transcriptional activity in GC cells by GSK3βinhibition. TCF assay showing the enhanced TCF transcriptional activity in N87 and YCC1 cells treated with GSK3β-inhibitor (LY211931). 8

9 PLA2G2A copy number in Gastric cancer cell lines Absolute Copy Number Con1 Con2 Con3 Con4 Con5 Con6 Con7 Con8 SNU-16 Hs 746T YCC11 SNU-1 KATO III IM95 YCC3 NCI-N87 YCC16 AGS YCC1 MKN7 Fu97 YCC2 YCC6 SNU-5 YCC9 Figure S1. Genomic deletion of PLA2G2A locus in gastric cancer cells. Genomic copy number determined by 5K SNP arrays showing the possible genomic deletion of PLA2G2A locus in GC cells. While the copy number of PLA2G2A remains 2 in controls (CON1-CON8), the GC cell lines SNU5 and YCC9 show a definite allelic loss. YCC1, MKN7, Fu97, YCC2 and YCC6 cell lines also might have lost one of their PLA2G2A allele. The 2 SNP probes shown in the graph (SNP_A & SNP_A ) are located at Mb & Mb respectively in chromosome 1 and the location of PLA2G2A in human genome is Chr 1: 2.174, ,496 Mb. THE SEQUENCES OF THE OLIGOS USED IN THE STUDY: Oligos used for RT-PCR: PLA2G2A-RTF: CCTCTGAGAGAGCCACCAAG, PLA2G2A-RT R: TAACTGAGTGCGGCTTCCTT ACTIN-RTF: CGGGAAATCGTGCGTGACATTAAG ACTIN-RTR: TGATCTCCTTCTGCATCCTGTCGG GAPDH-RTF: TGAACGGGAAGCTCACTGG GAPDH-RTR: TCCACCACCCTGTTGCTGTA 9

10 S1A4-RTF: TCTCTCCTCAGCGCTTCTTC S1A4-RTR: CCCAACCACATCAGAGGAGT NEDD9-RTF: GAGAGGAGCTGGATGGATGA NEDD9-RTR: ACTGTTTGTGGTGGGTAGGC Oligos used for RT-PCR ChIP-PCR: cyclind1-chipf: GTTCCTGGAAGGGCGACTAA cyclind1-chipr: GGGGTGGGATCTGAGATTTG PLA2G2A-ChiP F: CTGTTTCCGAAAGTGCAATG PLA2G2A- ChiP R: CAGCCCTCAGAAGGAATCAA REFERENCE: 1. Caca, K., Kolligs, F. T., Ji, X., Hayes, M., Qian, J., Yahanda, A., Rimm, D. L., Costa, J., and Fearon, E. R. Beta- and gamma-catenin mutations, but not E- cadherin inactivation, underlie T-cell factor/lymphoid enhancer factor transcriptional deregulation in gastric and pancreatic cancer. Cell Growth Differ, 1: , Suriano, G., Vrcelj, N., Senz, J., Ferreira, P., Masoudi, H., Cox, K., Nabais, S., Lopes, C., Machado, J. C., Seruca, R., Carneiro, F., and Huntsman, D. G. betacatenin (CTNNB1) gene amplification: a new mechanism of protein overexpression in cancer. Genes Chromosomes Cancer, 42: , Tsuchiya, T., Tamura, G., Sato, K., Endoh, Y., Sakata, K., Jin, Z., Motoyama, T., Usuba, O., Kimura, W., Nishizuka, S., Wilson, K. T., James, S. P., Yin, J., Fleisher, A. S., Zou, T., Silverberg, S. G., Kong, D., and Meltzer, S. J. Distinct methylation patterns of two APC gene promoters in normal and cancerous gastric epithelia. Oncogene, 19: , 2. 1

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student