Patient derived xenograft models and potential therapeutic applications
|
|
|
- Nelson Greer
- 5 years ago
- Views:
Transcription
1 Patient derived xenograft models and potential therapeutic applications Daniel Lindner, Marcella Diaz, Frances Mao, John Barnard, Yvonne Parker, Maryam Zamanian-Daryoush, John Pink, James Finke, Brian Rini 1. Whole genome expression modeling of sunitinib resistance 2. Ingenuity pathway analysis 3. TKI/ combination in PDX 4. Myeloid derived suppressor cells
2 Ren-02 human RCC tumors grown s.c. in NOD-scid-IL2Rg (NSG) mice each mouse bearing 3 tumors harvested on day:
3 Tumor volume cu. mm mean ± SE 600 Ren-02 human RCC tumors sunitinib 40 mg/kg/d p.o. continuous, start d Pre-sunit Response Escape Day
4 qrt-pcr human mrna expression MAPKBP1 TNFRSF12 IL8 MAPK7 MAPK3 ANGPT2 HIF1A VEGFA EPO MEK1 ERK1 response escape Log fold change
5 Human mrna expression low high * * *
6 Murine Human Heme function Response Imm cell traffic Heme function Escape Imm cell traffic Inflam response Cell movement Inflam response Cell survival Cell movement Cell survival Heme function Imm cell traffic Heme function Imm cell traffic Cell movement Inflam response Cell movement Inflam response Cell survival Cell survival
7 Tumor volume cu mm mean ± SE Effect of sunitinib + MEK inhibitor PD on Ren-02 tumor growth sunit continuous sunit, add sunit 40 mg/kg/d, PD mg/kg/d 50 sunit + continuous sunit, switch to Day
8 Tumor volume fraction of initial Tumor volume normalized to equal initial volume All TKI (sut, paz, axit) p<0.01 between All TKI&MEKI and other groups All TKI& Day All agents given continuously x 42d
9 Tumor volume mm 3 mean Long-term TKI & combinations Survival % Cont Sun Ax PD Ax+PD Sun+PD PD Cont Sun Ax Day Sun+PD Ax+PD Day NSG mice bearing established Ren-02 tumors received vehicle, sunitinib (40 mg/kg/d), axitinib (30 mg/kg bid), MEK inhibitor PD (4 mg/kg/d), or TKI/ combinations from d15 to d69.
10 Quantitation of phospho-mek1/2, phospho-erk1/2, and phospho-stat3 in Ren-02 tumor lysates after long term treatment in vivo perk1/2 pmek1/2 pstat3 Mesoscale multiplex ELISA
11 Number of Cells G-CSF pg/ml Intratumoral myeloid derived suppressor cells 2500 Flow cytometry Intratumoral G-CSF levels ELISA Ly6G+CD11b+ Ly6C+CD11b Human G-CSF pg/ml Mouse G-CSF pg/ml Control Sutent Axitinib Sut + Ax + 0 Control Sutent Axitinib Sut + Ax +
12 murine (host) compartment G-CSF human (tumor) compartment MDSC G-CSF
13 Thank you From the Cleveland Clinic Taussig Cancer Institute
14 Sample relation map. Numbers 1 4 refer to individual mice in study. Multi-Dimensional Scaling (MDS) measured the gene expression signal strength coefficient of variance between replicates in a group. Data collected at each of the three time points (pre-sunit, response, escape) clustered tightly, indicating low variation differences in tumor gene expression between replicates.
PT2385: HIF 2α Antagonist for the Treatment of. Peloton Therapeutics, Inc. 5/4/ th International VHL Medical Symposium April 8, 2016
5/4/216 : Antagonist for the Treatment of VHL Mutant ccrcc 12th International VHL Medical Symposium Eli Wallace, Ph.D. Vice President of Chemistry Disclosure Information Eli Wallace I have the following
State of the Art 3: Immunotherapy and Modulators of Apoptosis
State of the Art 3: Immunotherapy and Modulators of Apoptosis James Finke, PhD - Cleveland Clinic, Immunology Crystal Mackall, MD - NCI, Pediatric Oncology James Mier, MD - BIDMC, Medical Oncology Craig
CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of
Supplementary Materials: CRISPR/Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of human chimeric antigen receptor T cells Authors: Levi J. Rupp 1,2,3,4,, Kathrin Schumann 3,5,6, Kole T. Roybal
ONCO-HU TM MICE FOR IMMUNOTHERAPEUTIC DRUG DISCOVERY. Brian W. Soper, Ph.D. Senior Technical Information Scientist
ONCO-HU TM MICE FOR IMMUNOTHERAPEUTIC DRUG DISCOVERY Brian W. Soper, Ph.D. Senior Technical Information Scientist Presentation Outline Capabilities Humanization Hu-NSG TM versus Hu-NSG TM -SGM3 Immuno-oncology
Overview for today. NSG and NSG -SGM3 are a proven platform. A growing list of drugs have shown translationally relevant response
1 Overview for today NSG and NSG -SGM3 are a proven platform A growing list of drugs have shown translationally relevant response Targeted therapeutics and anti-angiogenesis drugs show their expected response
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
Targeted Therapy in Advanced Renal Cell Carcinoma
Targeted Therapy in Advanced Renal Cell Carcinoma Brian I. Rini, M.D. Department of Solid Tumor Oncology Glickman Urologic and Kidney Institute Cleveland Clinic Taussig Cancer Institute Cleveland, Ohio
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
Have Results of Recent Randomized Trials Changed the Role of mtor Inhibitors?
Have Results of Recent Randomized Trials Changed the Role of mtor Inhibitors? Bernard Escudier Institut Gustave Roussy Villejuif, France EIKCS Lyon April 2015 What is the current role of mtor inhibitors?
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Comprehensive evaluation of human immune system reconstitution in NSG. and NSG -SGM3 mouse models toward the development of a novel ONCO-HU
Comprehensive evaluation of human immune system reconstitution in NSG and NSG -SGM3 mouse models toward the development of a novel ONCO-HU xenograft model Aaron Middlebrook, 1 Eileen Snowden, 2 Warren
Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer
Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer Kevin Staveley-O Carroll, PhD, MD, FACS Professor and Chair, Department of Surgery Director of the Ellis Fischel Cancer
4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
Utilizing Humanized NSG Mice to Evaluate Drug Efficacy in Immuno-Oncology
Utilizing Humanized NSG Mice to Evaluate Drug Efficacy in Immuno-Oncology Rick Huntress Director Business Development March 15, 2017 Onco-Hu : Humanized Mice for Evaluation of Immuno-Oncology Therapeutics
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Biology of Renal Cell Cancer. Disclosures
Biology of Renal Cell Cancer Dr Joseph Ischia Uro-oncology Fellow 14-3-2012 No patents No honorariums Not on any boards Disclosures Essendon supporter 1 Renal Cell Cancer 2% of new cancers 30% have metastatic
Localized Regulated Expression of IL- 12 as a Gene Therapy Approach to Cancer Immunotherapy. John A. Barrett Ph.D. Ziopharm Oncology, Boston MA 02129
Localized Regulated Expression of IL- 12 as a Gene Therapy Approach to Cancer Immunotherapy John A. Barrett Ph.D. Ziopharm Oncology, Boston MA 02129 Background & Rationale IL-12 in Oncology Tumors grow
A Versatile Tool to Study Immune Checkpoint Therapeutics: Syngeneic Tumor Mouse Models in vivo
The Solution Provider for Drug Discovery in Oncology A Versatile Tool to Study Immune Checkpoint Therapeutics: Syngeneic Tumor Mouse Models in vivo Holger Weber - 1 - Drug discovery platform for oncology
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Appendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
Converting Novel Therapeutic Models into Early Phase Clinical Trials
Converting Novel Therapeutic Models into Early Phase Clinical Trials James H. Doroshow, M.D. Deputy Director for Clinical and Translational Research National Cancer Institute, NIH IOM National Cancer Policy
Eosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Pre-clinical PK/PD modelling of combination therapies in oncology: abemaciclib and vemurafenib
Pre-clinical PK/PD modelling of combination therapies in oncology: abemaciclib and vemurafenib Combination Therapies in Oncology Combination therapies in oncology have been explored and used for many decades
Can we classify cancer using cell signaling?
Can we classify cancer using cell signaling? Central hypotheses (big ideas) Alterations to signaling genes would cause leukemic cells to react in an inappropriate or sensitized manner to environmental
Sequestration of T cells in bone marrow in the setting of glioblastoma and other intracranial tumors
SUPPLEMENTARY INFORMATION Articles https://doi.org/1.138/s41591-18-135-2 In the format provided by the authors and unedited. Sequestration of T cells in bone marrow in the setting of glioblastoma and other
SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
Antitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models
Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics
The Promise of Adjuvant Epigenetic Therapy in Early Stage Esophageal Cancer. Zhihao Lu M.D. Peking University Cancer Hospital
The Promise of Adjuvant Epigenetic Therapy in Early Stage Esophageal Cancer Zhihao Lu M.D. Peking University Cancer Hospital Current Treatment Strategies for Early Stage Esophageal Cancer Rate Prognosis
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
IL-22 mediates mucosal host defense against gram negative bacterial pneumonia
IL-22 mediates mucosal host defense against gram negative bacterial pneumonia Shean J. Aujla, Yvonne R. Chan, Mingquan Zheng, Mingjian Fei, David J. Askew, Derek A. Pociask,Todd A. Reinhart, Florencia
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
Developping the next generation of studies in RCC
Developping the next generation of studies in RCC Bernard Escudier Institut Gustave Roussy Villejuif, France Disclosure Information Advisory/Consultancy Role Pfizer, Exelixis, Novartis, BMS, Bayer, Roche,
Supplementary Information Titles
Supplementary Information Titles Please list each supplementary item and its title or caption, in the order shown below. Note that we do NOT copy edit or otherwise change supplementary information, and
REPROGRAMING IMMUNITY IN RENAL CELL CARCINOMA
REPROGRAMING IMMUNITY IN RENAL CELL CARCINOMA RETHINKING TYROSINE KINASE INHIBITORS Dr. L.M. Antón Aparicio. Complejo Universitario de La Coruña INTRODUCTION Angiogenesis, which is regulated by a fine
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea
Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like
SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated
Pediatric Preclinical Testing Program (PPTP) evaluation of the Bcl-2 inhibitor ABT-263
Pediatric Preclinical Testing Program (PPTP) evaluation of the Bcl-2 inhibitor ABT-263 Malcolm A. Smith, John M. Maris, Stephen T. Keir, Henry S. Friedman, Richard B. Lock, Hernan Carol, Mayamin Tajbakhsh,
Therapeutic Immunization with Autologous DC Pulsed with Autologous Inactivated HIV-1 Infected Apoptotic Cells
Therapeutic Immunization with Autologous DC Pulsed with Autologous Inactivated HIV-1 Infected Apoptotic Cells Sharon A. Riddler, MD, MPH University of Pittsburgh May 2008 Slide 1 HIV and DC Vaccines During
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
Human Immune System (HIS) mouse models for translational research. Barbara Joyce-Shaikh
Human Immune System (HIS) mouse models for translational research Barbara Joyce-Shaikh Humanized Immune System (HIS) Mouse Models Goals Enable clinically relevant in vivo studies of human cells, tissues,
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging
Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies Saul Kivimäe Senior Scientist, Research Biology Nektar Therapeutics NK Cell-Based Cancer Immunotherapy, September 26-27,
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Development of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection
Development of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection Christine Wooddell, Rui Zhu, Holly Hamilton, Qili Chu, Heather Sternard, Joshua Schumacher, Thomas
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
NKTR-214 plus NKTR-262, a Scientifically-Guided Rational Combination Approach for Immune Oncology
plus NKTR-262, a Scientifically-Guided Rational Combination Approach for Immune Oncology Jonathan Zalevsky SVP, Biology and Preclinical Development Nektar Therapeutics World Preclinical Congress, 2017
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Anti-tumor Effects of Activated Human Natural Killer Cells in Orthotopic Human Brain Tumor Models
Anti-tumor Effects of Activated Human Natural Killer Cells in Orthotopic Human Brain Tumor Models William Murphy, PhD Depts. of Dermatology and Internal Medicine Neal Goodwin, PhD Jackson Laboratories
Supplemental Information. Augmentation of Antitumor Immunity by Human. and Mouse CAR T Cells Secreting IL-18
Cell Reports, Volume 20 Supplemental Information Augmentation of Antitumor Immunity by Human and Mouse CAR T Cells Secreting IL-18 Biliang Hu, Jiangtao Ren, Yanping Luo, Brian Keith, Regina M. Young, John
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
IOM Workshop on Comparative Oncology Pharmacokinetics in Companion Animal Cancer Studies
IOM Workshop on Comparative Oncology Pharmacokinetics in Companion Animal Cancer Studies Daniel L. Gustafson, Ph.D. Professor Shipley University Chair in Comparative Oncology Director of Basic Research,
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28
A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Carcinoma renale metastatico: cambia la pratica clinica? Camillo Porta Fondazione I.R.C.C.S. Policlinico San Matteo, Pavia
Carcinoma renale metastatico: cambia la pratica clinica? Camillo Porta Fondazione I.R.C.C.S. Policlinico San Matteo, Pavia New target, new agent (James Brugarolas) Atezolizumab + Bevacizumab and PD-L1
Serum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt
Supplementary Information CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt Jae Hyang Lim, Hirofumi Jono, Kensei Komatsu, Chang-Hoon Woo, Jiyun Lee, Masanori Miyata,
RNA Interference: A New Tool in the Toolbox for Treatment of HBV. Discovery On Target Senior Director, Research 25 September 2017
RNA Interference: A New Tool in the Toolbox for Treatment of HBV Amy Lee Discovery On Target Senior Director, Research 25 September 2017 Arbutus Biopharma Boston, MA NASDAQ: ABUS www.arbutusbio.com Chronic
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells
Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,
Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc.
Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc. Cellecta, Inc. Founded: April 2006 Headquarters: Mountain View, CA 12 SBIR Grants Custom Service Provider for Functional
Sequencing of therapies in mrcc. Ari Hakimi MD Assistant Professor Urology Service, Department of Surgery MSKCC
Sequencing of therapies in mrcc Ari Hakimi MD Assistant Professor Urology Service, Department of Surgery MSKCC Old Paradigm Sequencing approved agents VEGF TKI Sunitinib Pazopanib Axitinib TKI TKI MTORi
Posters and Presentations
Posters and Presentations June 2017: American Society of Clinical Oncology (ASCO) Annual - Preliminary Correlative Analysis of PD-L1 expression from the SUNRISE Study. View April 2017: American Association
Immunotherapy versus targeted treatments in metastatic renal cell carcinoma: The return game?
Immunotherapy versus targeted treatments in metastatic renal cell carcinoma: The return game? Sylvie NEGRIER MD, PhD Centre Léon Bérard, Lyon Université Lyon I IMMUNOTHERAPY: A LONG AND WIDING ROAD! WHERE
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
Evaluation of immunomodulatory agents in syngeneic models and immune cell phenotyping of humanized mouse models carrying patient-derived tumors
Evaluation of immunomodulatory agents in syngeneic models and immune cell phenotyping of humanized mouse models carrying patient-derived tumors Philippe Slos 2 nd Annual ICI March 15-17, 2016 Boston Introduction