FAK Copy Number. tumor 79. tumor 78. tumor 73. tumor 75. n=79 R 2 =0.09 P= FAK mrna (Log 2 ) MYC mrna (A.U.) n=79 R 2 =0.04 P=0.

Transcription

1 A 25 Copy Number B tumor 72 tumor 73 tumor 74 tumor 75 tumor 76 tumor 77 tumor 78 tumor 79 mrna (Log 2 ) n=79 R 2 =.9 P=.5 C / CEP8 Ratio MYC mrna (A.U.) 1 5 n=79 R 2 =.4 P= / CEP8 Ratio Supplementary Figure 1. The Level of Amplification of is Variable and does not Correlate with Expression of MYC (A) Box-and-whisker plot illustrates copy number variation in tumor cells from breast cancers exhibiting igh-level amplification (>5 copies of on average). B) Scatter plot illustrates correlation between amplification of ( / CEP8 ratio) and level of expression of ( mrna). (C) Scatter plot illustrates lack of correlation between amplification of ( / CEP8 ratio) and level of xpression of MYC (MYC mrna).

2 A C mrna (Z Score) Proportion (%) High mrna Low mrna n= Tumor Samples Distribution Histotype High Low mrna Poorly Diff. Intermediate Well Diff. D Proportion (%) ER+ ER- B ER Status High Low mrna Proportion E Tumor Diameter (mm) mrna (Z Score) Size Distribution Subtype Status High Low n=295 Lum. B Lum. A HER2+ Basal Supplementary Figure 2. High Levels of do not Correlate with the Size, Level of Histological Progression, Hormone Receptor Status, or Transcriptomic Subtype of Primary Breast Tumors (A) Samples from the Netherland Cancer Institute DNA microarray dataset were divided in three equally numerous groups depending on the level of expression of mrna (high, medium or low Z score). Z score = (expression - [avg expression all samples]) / STDEV all samples. Tumors with high and medium Z score (top 2/3) were grouped together and are indicated as possessing high mrna. The remainder are indicated as possessing low mrna. Primary data are from Chang et al. (25). (B) The graph illustrates the distribution of size of primary tumors with high or low mrna. Primary data are from Chang et al. (25). (C) The graph shows the proportion of tumors with high or low mrna displaying a poorly differentiated, intermediate, or well differentiated histology. Primary data are from Chang et al. (25). (D) The graph shows the proportion of tumors with high or low mrna expressing ER or not. Primary data are from Chang et al. (25). (E) Box-and-whisker plot of mrna expression levels in the four major transcriptomic subtypes of breast cancer. Primary data are from Chang et al. (25).

3 A C MYC mrna (Z Score) MYC mrna (Z Score) Tumor Samples Tumor Samples B 15 MYC high 1 MYC medium 95 MYC low 9 n=295 P=.51 (ns) MYC high MYC low n=295 D Met-free Survival (%) Met-free Survival (%) Years MYC high MYC medium MYC low MYC high MYC low P=.56 (ns) Years Supplementary Figure 3. High MYC Levels do not Predict a Poor Prognosis in Breast Cancer (A) Samples from the Netherland Cancer Institute DNA microarray dataset were divided in three equally numerous groups depending on the level of expression of MYC mrna (high, medium, or low Z score). Z score = (expression - [avg expression all samples]) / STDEV all samples. Primary data are from Chang et al. (25). (B) Kaplan-Meier analysis of metastasis-free survival in patients with high, mid, and low MYC Z score. P value indicates log rank t test for trend. (C) Samples were divided in two groups depending on the level of expression of MYC mrna (top 2/3 with high + medium Z score and bottom 1/3 with low Z score). (D) Kaplan-Meier analysis of metastasis-free survival in patients with high + mid MYC Z score (top 2/3) or low MYC Z score (bottom 1/3). P value indicates log rank t test for trend.

4 A X-Gal / Eosin B 1 2 D X-Gal / DAPI MMTV-Cre; R26R C PYK2 PYK2 (PY42) tubulin MMTV-Cre; +/+ ; R26R E Hematoxylin F MMTV-Cre; Flox/Flox MMTV-Cre; Flox/Flox ; R26R MMTV-Cre; +/+ MMTV-Cre; +/+ ; R26R R26R FRNK MMTV-Cre; Flox/Flox ; R26R H&E X-Gal X-Gal / Eosin Supplementary Figure 4. Deletion of does not Disrupt Pubertal Mammary Gland Development (A) Mammary gland sections from 6 weeks old MMTV-Cre; +/+ ; R26R mice and control R26R mice were stained with X-Gal and Eosin. Arrows point to cells that have not undergone Cre-mediated recombination. (B) Primary mammary epithelial cells from MMTV-Cre; +/+ (1) and MMTV-Cre; Flox/Flox mice (2) were cultured on collagen I in complete medium and subjected to immunoblotting with the indicated antibodies. (C) -/- ; P53 -/- mouse embryo fibroblasts, untransduced (1) or transduced with a vector encoding FRNK (2), and +/+ mammary epithelial cells (3) were subjected to immunoblotting with an antibody reacting with both and FRNK. (D) Mammary gland sections from 6 weeks old mice of the indicated genotypes were stained with X-Gal, anti-, and DAPI. Pictures were taken under Phase Contrast (left) or epifluorescence (right). Arrows point to cells that have not undergone Cre-mediated excision of. (E) Whole-mounts of mammary glands from mice of the indicated genotypes were stained with Hematoxylin (left) or sectioned and stained with Hematoxylin and Eosin (right). (F) Whole-mounts from mice of the indicated genotypes were stained with X-Gal (left) or sectioned and counterstained with Eosin (right).

5 A Normal Gland Dysplasia / MIN Early Carcinoma B Progression Series C mrna / Eosin Normal Gland / MIN MIN / DAPI 1 * * / H * * P- (PY397) / H * * D E Adherent Suspended Neu Ras NMuMG SFM PyMT NMuMG FCS PyMT SFM NMuMG PyMT FCS NMuMG PyMT SFM NMuMG PyMT FCS NMuMG PyMT Adherent Suspended Adherent Suspended P- (PY397) P- (PY576) P- (PY861) P- (PY397) Tubulin P-ERK P-Akt Norm. Levels (A.U.) P- Supplementary Figure 5. is Upregulated and Activated after PyMT-mediated Transformation of Mammary Epithelium (A) Sections of a mammary gland from a MMTV-PyMT mouse were stained with DIG- mrna probe (purple) and counterstained with Eosin (pink). (B) Sections of a mammary gland from a MMTV-PyMT mouse were stained with anti- and counterstained with DAPI. expression is low in normal ducts and lobules (asterisks), is enhanced in hyperplastic lesions (1), and increases dramatically during MIN expansion (2 to 5). (C) Sections of a mammary gland from a MMTV-PyMT mouse were stained with anti- (left) or anti- P- (py397) (right). Both expression and activation are enhanced in MIN lesions as compared to pre-neoplastic ducts and lobules. (D) Normal NMuMG cells and PyMT-transformed mammary tumor cells were cultured in either SFM or complete medium with FCS. Equal amounts of proteins were subjected to immunoblotting. (E) The indicated cells were cultured in suspension or under adherent conditions in SFM or complete medium and subjected to immunoblotting with the indicated antibodies. Densitometry was used to quantify the anti-p- and anti- bands. Values were normalized using tubulin levels as a reference.

6 A tubulin -/- Cells +/+ Tumor Flox/Flox Tumors -neg. Escaper Escaper B mrna / Eosin Escaper -neg. +/+ Supplementary Figure 6. Mammary Tumors Arising in MMTV-PyMT; MMTV-Cre; Flox/Flox Mice Express (A) Equal amounts of total proteins from 45 tumors arising in MMTV-PyMT; MMTV-Cre; Flox/Flox mice were subjected to immunoblotting with the indicated antibodies. Three samples corresponding to 2 escapers and 1 tumor lacking detectable expression of are shown. Primary tumor cells from MMTV-PyMT; Flox/Flox mice transduced with Adeno-Cre virus were used as negative control and a tumor arising in MMTV-PyMT; +/+ mouse as positive control. Expression of was not detectable only in 2 out of 45 tumors. (B) In situ hybridization for on 2 tumors from MMTV-PyMT; MMTV-Cre; Flox/Flox mice (left and middle) A tumor from a MMTV-PyMT; MMTV-Cre; +/+ mouse was used as positive control (right). Samples were counterstained with Eosin. Expression of mrna was not detectable in the 2 tumors lacking protein.

7 MMTV-PyMT; MMTV-Cre; +/+ MMTV-PyMT; MMTV-Cre; Flox/Flox Ki-67 / Ki-67 / DAPI Supplementary Figure 7. -negative MIN Lesions Exhibit a Proliferative Deficiency Sections of mammary glands from mice of the indicated genotypes were subjected to double immunostaining with antibodies to and Ki-67. -negative MIN lesions from MMTV-PyMT; MMTV-Cre; Flox/Flox mice were selected and photographed (bottom 2 rows).

8 GFP / PECAM1 / DAPI Cleaved Caspase 3 Day 1 apoptotic TGL / Ad-Cre TGL / Ad Day 2 non apoptotic Day 2 apoptotic Day 2 non apoptotic Supplementary Figure 8. Identification of Apoptotic Tumor Cells in the Microvascular Compartment of the Lung Tumor cells transduced with the indicated viruses were prestained with Oregon Green 488 to enhance the green emission generated by GFP (green) and injected in the tail vein of NOD/SCID mice. Mice were sacrificed at day 1 and 2 and sections from their lungs were stained with anti-cleaved caspase-3 (red) and anti-pecam-1 (magenta). Panels show representative images of apoptotic and non apoptotic tumor cells.

9 xz 3D PECAM-1 / GFP (Day 1) TGL/Ad ( +/+ ) TGL/Ad-Cre ( -/-) yz yz xz xy xy 3D xz xz xz PECAM-1 / GFP (Day 2) TGL/Ad-Cre ( -/-) TGL/Ad ( +/+ ) yz yz xy xz xy yz xy Supplementary Figure 9. Confocal Analysis of Tumor Cell Extravasation in the Lung Tumor cells transduced with the indicated viruses were prestained in vitro with Oregon Green 488 to enhance the emission generated by GFP (green) and injected in the tail vein of NOD/SCID mice. Mice were sacrificed at day 1 and 2 and sections from their lungs were stained with anti-pecam-1 (red) and subjected to confocal analysis followed by 3D reconstruction. Panels show representative images at days 1 and 2. yz xy

10 A PyMT Ras c 1 2 c 1 2 Neu Neu-β4-T c 1 2 c 1 2 ERK2 B tubulin MDA-MB231 BT474 T47D SK-Br3 c 1 6 c 1 6 c 1 6 c 1 6 HCC1954 c 1 6 tubulin HS578T BT549 CAMA-1 MDA-MB468 c 1 6 c 1 6 c 1 6 c 1 6 MDA-MB361 c 1 6 Supplementary Figure 1. Short-hairpin RNA-mediated Knock Down of in Mouse and Human Mammary Tumor Cells (A) PyMT-, Ras-, and Neu-tranformed mouse mammary tumor cells expressing wild type (Neu) or signaling-defective integrin β4 (Neu-β4-T) were transduced with either empty lentiviral vector (c) or vectors encoding short-hairpin (sh) RNAs targeting murine (1, 2). Equal amounts of proteins were subjected to immunoblotting with antibodies to the indicated proteins. (B) The indicated human breast cancer cells were transduced with lentiviral vectors encoding a control scrambled shrna or shrnas targeting human (1, 6). Equal amounts of proteins were subjected to immunoblotting with antibodies to the indicated proteins.

11 Supplementary Figure 11. Knock Down of Inhibits the Capacity of ErbB2-transformed Mammary Tumor Cells Carrying a Deletion of the Integrin β4 Signaling Domain to Give Rise to Orthotopic Tumors Neu (left) and Neu-β4-1355T (right) cells were transduced with empty lentiviral vector (control) or vectors encoding short-hairpin RNAs targeting murine (sh-1 and sh-2). 25, cells were injected into the mammary fat pad of NOD/SCID mice. The graph indicates tumor volumes (+/- SEM) at the indicated times. P values are indicated as follows: *, p<.5; **, p<.1. Tumor Size (mm 3) Neu sh-2 sh-1 shcon days Tumor Size (mm 3) Neu-β4-T * ** shcon. sh-1 sh days

12 shcontrol sh-1 sh-6 SK-Br3 BT474 T47D HS578T MDA-MB231 Supplementary Figure 12. Knock-down of Suppresses Proliferation in Human Breast Cancer Cells carrying Distinct Oncogenic Mutations The indicated cells were transduced with either control virus (shcontrol) or vectors encoding shorthairpin RNAs targeting (sh-1 and sh-6). The MDA-MB-231 and HS578T cells were also stained with X-gal (blue). Representative bright field pictures are shown.

13 1 Growth Inhibition After Silencing of (%) MDA-MB361 HCC1954 BT474 SK-Br3 ErbB2 (short exp.) ErbB2 (long exp.) Vinculin MDA-MB361 HCC1954 BT474 SK-Br3 upplementary Figure 13. Elevated Levels of ErbB2 Correlate with Decreased Sensitivity to Knock Down of Equal amounts of total proteins from the indicated human breast cancer cells were subjected to immunoblotting with the indicated antibodies (top). The graph illustrates the sensitivity of the cell lines to knock down of (bottom). Data are from the experiment of Figure 7A.

14 SUPPLEMENTAL METHODS Cell Culture PyMT cells were cultured in DME HG:F12 supplemented with 2% FBS, NEAA, PSFG, 1 µg/ml hydrocortisone, 1 µg/ml insulin, 1 nm cholera toxin and 1 ng/ml EGF. Neu cells were cultured in DME HG:F12 supplemented with 1% FBS, NEAA, PSFG, 1 µg/ml hydrocortisone, 1 µg/ml insulin, and 1 nm cholera toxin. Ras cells (kind gift of Dr. P. Leder, Department of Genetics, Harvard Medical School, Boston, MA 2115) were cultured in DME HG supplemented with 1% FBS and PSFG. HS578T, MDA-MB-231, MDA-MB-361, BT474, BT549, CAMA-1 and T47D cells were cultured in DME HG supplemented with 1% FBS and PSFG. SKBr3 (kind gift of Dr. N. Rosen, Department of Molecular Pharmacology and Chemistry, Memorial Sloan-Kettering Cancer Center, New York, NY 165) and MDA-MB-468 cells were cultured in DME HG:F12 supplemented with 1% FBS, NEAA, and PSFG. HCC1954 cells were maintained in RPMI 164 supplemented with 1% FBS and PSFG. Antibodies Immunoblotting experiments were performed with affinity purified mouse Mabs to (H1) and Chk1 from Santa Cruz, to α-tubulin and vinculin from Sigma, to STAT3 from Cell Signaling, to Chk2 from Upstate Biotechnologies, and to PYK2 and p13 Cas from BD Biosciences; with rabbit antibodies to P- (PY397), P- (PY576), P- (PY861), P-paxillin (PY118), and P-Akt (PS473) from Biosource, to P-CAS (Y41), P-PYK2 (PY42), P-c-Jun (PS73), P-Histone H2A.X (Ser 139), P-ErbB2 (Y877), P-ErbB2 (Y1221/2) and P-ERK (T22/Y24) from Cell Signaling, and to ERK2 and ErbB2 from Santa Cruz; and with goat antibodies to Akt from Santa Cruz and rabbit anti-mouse antibodies to P-STAT3 (PY75) and to c-jun from Cell Signaling. Immunostaining experiments were conducted with rabbit antibodies to (C2) from Santa Cruz, to from Upstate Biotechnologies, to Cre from Covance, to Ki-67 from Novocastra, to histone H3 (tri-methyl K9) from Abcam, to cleaved caspase-3 from Cell Signaling

15 and to P- (PY397) from Biosource, and with rat-anti-mouse antibodies to PECAM-1 from BD Biosciences. Other Materials Matrigel was obtained from BD Biosciences, poly-l-lysine from Sigma, collagen I from Upstate Biotechnologies, and the vital dye Oregon Green 488 from Molecular Probes. Constructs The retroviral vector pbabe-puro- was generated by inserting the cdna encoding chicken (kind gift from E. Marcantonio, Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY 132) into the MCS of pbabe-puro. The Y397F, K454R, P712A/P713A, Y863F and Y926F mutants of were generated by using the QuikChange Site Directed Mutagenesis Kit (Stratagene). The expression vector encoding CasΔSD, a dominant negative form of p13 Cas (1), was a kind gift from K. Vuori, The Burnham Institute, La Jolla, CA CasΔSD construct was transfected using Lipofectamine 2. The PyMT cdna (kind gift of Y.C. Du, Program in Cancer Biology and Genetics, Memorial Sloan-Kettering Cancer Center, New York, NY 165) was subcloned into pbabe-hygromycin. To generate a probe for in situ hybridization, a PCR fragment encompassing base pairs of the cdna encoding mouse (from ATCC) was subcloned into pcr2.1-topo using the TOPO TA cloning kit from Invitrogen and finally into the EcoRI site of pbsks II (-). plko1 vectors encoding short hairpin RNAs against murine were kindly provided by L. Chin (Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 2115) (2). plko1 vectors encoding short hairpin RNAs against human (5 - CCGGCCGATTGGAAACCAACATATACTCGAGTATATGTTGGTT TCCAATCGTTTTG-3 ; 5 -CCGGGCCCAGAAGAAGGAATCAGTTCTCGAG AACTGATTCTTCTTCTGGGCTTTTTG-3 ) as well as control vectors were obtained from Open Biosystems. sirna oligos against human p13 Cas were

16 described previously (3). Targeting oligonucleotides and a non-targeting sirna control were obtained from Dharmacon and transfected into cells using Lipofectamine Dolfi, F., Garcia-Guzman, M., Ojaniemi, M., Nakamura, H., Matsuda, M., and Vuori, K The adaptor protein Crk connects multiple cellular stimuli to the JNK signaling pathway. Proc Natl Acad Sci U S A 95: Kim, M., Gans, J.D., Nogueira, C., Wang, A., Paik, J.H., Feng, B., Brennan, C., Hahn, W.C., Cordon-Cardo, C., Wagner, S.N., et al. 26. Comparative oncogenomics identifies NEDD9 as a melanoma metastasis gene. Cell 125: Hamamura, K., Furukawa, K., Hayashi, T., Hattori, T., Nakano, J., Nakashima, H., Okuda, T., Mizutani, H., Hattori, H., Ueda, M., et al. 25. Ganglioside GD3 promotes cell growth and invasion through p13cas and paxillin in malignant melanoma cells. Proc Natl Acad Sci U S A 12: