Supporting Online Material for

Transcription

1 Supporting Online Material for MET Amplification Leads to Gefitinib Resistance in Lung Cancer by Activating ERBB3 Signaling Jeffrey A. Engelman, Kreshnik Zejnullahu, Tetsuya Mitsudomi, Youngchul Song, Courtney Hyland, Joon Oh Park, Neal Lindeman, Christopher-Michael Gale, Xiaojun Zhao, James Christensen, Takayuki Kosaka, Alison J. Holmes, Andrew M. Rogers, Federico Cappuzzo, Tony Mok, Charles Lee, Bruce E. Johnson, Lewis C. Cantley, Pasi A. Jänne* *To whom correspondence should be addressed. Published 26 April 2007 on Science Express DOI: /science This PDF file includes: Materials and Methods Figs. S1 to S7 Tables S1 to S4 References

2 Supporting Online Material Materials and Methods Cell Culture and reagents The EGFR mutant NSCLC cell lines HCC827 (del E746_A750), H3255 (L858R), and H3255 GR (L858R/T790M) have been extensively characterized(1-4). H1993 and BT474 cells were obtained from American Type Culture Collection (ATCC; Manassas, VA). SNU-638 and MKN-45 gastric cancer cells were obtained from Dr. Won Ki Kang (Samsung Medical Center, Seoul, Korea) and have been previously characterized(5, 6). HCC827, H1993 SNU-638 and MKN-45 cell lines were maintained in RPMI 1640 (Cellgro; Mediatech Inc., Herndon, CA) supplemented with 10% FBS (20% for MKN- 45), 100 units/ml penicillin, 100 units/ml streptomycin, and 2 mm glutamine. H3255 and H3255 GR were maintained in ACL-4 media (Invitrogen; Carlsbad, CA) supplemented with 5% FBS, 100 units/ml penicillin, 100 units/ml streptomycin, and 2 mm glutamine. Gefitinib and Lapatinib were purchased from American Custom Chemical Corporation (San Diego, CA). Cl-387,785 was purchased from EMD Chemicals (San Diego, CA). PHA-665,752 was a gift of Pfizer (La Jolla, CA). Stock solutions of all drugs were prepared in DMSO and stored at 20 o C. Cell proliferation and growth assays Growth and inhibition of growth were assessed by the MTS assay. This assay, a colorimetric method for determining the number of viable cells, is based on the SOM 2

3 bioreduction of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4- sulfophenyl)-2h- tetrazolium (MTS) by cells to a formazan product that is soluble in cell culture medium, can be detected spectrophotometrically. The assay was performed according to previously established methods(1, 3, 4). The cells were seeded in 96 well plates, exposed to gefitinib (3.3 nm to 10 µm) alone, PHA-665,752 (3.3 nm to 10 µm) alone or both drugs in combination for 72 hours. The number of cells used per experiment was determined empirically(3). Each combination of cell line and drug concentration was set up in 6 replicate wells and repeated at least 3 times. The data were graphically displayed using GraphPad Prism version 3.00 for Windows, (GraphPad Software; Each point (mean (+/- standard deviation)) represents growth of treated cells compared to untreated cells. The curves were fitted using a non-linear regression model with a sigmoidal dose response. Antibodies and Western Blotting Cells were lysed in buffer containing 20 mm Tris, ph 7.4/150 mm NaCl/1% Nonidet P-40/ 10% glycerol/1 mm EDTA/1 mm EGTA/5 mm sodium pyrophosphate/50 mm NaF/10 nm β -glycerophosphate/1 mm sodium vanadate/0.5 mm DTT/4 µ g/ml leupeptin/4 µ g/ml pepstatin/4 µ g/ml apoprotein/1 mm PMSF. Lysates were centrifuged at 16,000 g for 5 min at 4 C. The supernatant was used for subsequent procedures. Western blot analyses were performed according to the antibody manufacturer s recommendations. Antibody binding was detected using an enhanced chemiluminescence system (PerkinElmer, Waltham, MA). Anti-phospho-Akt (Ser-473), anti-total Akt, anti-egfr, anti-phospho-erbb-3 (Tyr-1289) and anti-met antibodies SOM 3

4 were from Cell Signaling Technology (Beverly, MA). Anti-ERBB-3 antibody was from Lab Vision (Freemont, CA). The phospho-specific EGFR (py1068), MET (py 1234/1235), ERK1/2 (pt185/py187) antibodies were purchased from Invitrogen (Carlsbad, CA). Anti-p85 antibody was from Millipore (Billerica, MA). The total MET antibody used for immunoprecipitations was purchased from Millipore (Billerica, MA) Generation of gefitinib-resistant HCC827cells in vitro To generate a resistant cell line, we exposed HCC827 cells to increasing concentrations of gefitinib as in (4). Gefitinib concentrations were increased stepwise from 1 to 100 nm when the cells resumed growth kinetics similar to the untreated parental cells. Cells with the ability to grow in 100 nm of gefitinib were obtained 6 months after the initial drug exposure. To confirm the emergence of a resistant clone, MTS assays were performed after allowing the cells to grow in drug-free conditions for at least 4 days. The resistant HCC827 cells were passed 17 times in the absence of gefitinib and maintained their resistance as confirmed by MTS assays. Six individual clones were isolated (HCC827 GR1, GR2, GR5, GR6, GR7 and GR8) and all were confirmed independently to be resistant to gefitinib. HCC827 cells were maintained concomitantly without gefitinib and their sensitivity to gefitinib was examined every 5 passages. There was no significant change in the sensitivity to gefitinib in parental cells during the period. SURVEYOR TM analyses The entire EGFR coding region from all 6 HCC827 GR clones was examined for genetic alterations using a modification of a previously described sensitive gene scanning SOM 4

5 method(4, 7). Seven overlapping cdna segments covering the entire EGFR coding region were generated and analyzed as in (7). The PCR primers are listed in Table S4. CDNA sequencing of cell lines Total RNA was isolated from cell lines using Trizol TM (Invitrogen, Carlsbad, CA) and purified using RNeasy TM cleanup kit (Qiagen,Valencia, CA). cdna was transcribed from 2µg of total RNA with Superscript II Reverse Transcriptase (Invitrogen Life technologies, Carlsbad, CA). The cdna was used as template for subsequent PCR amplifications of EGFR and MET. The details of the PCR conditions and the primers have been previously published(1, 8). ShRNA constructs and lentiviral infection MET and ERBB3 shrna constructs cloned in plko.1 puro vector were obtained from Harvard RNAi consortiumas described in (8, 9). Each construct contains a 21 bp sequence targeting different regions of MET or ERBB3, a 6 nuecleotide hairpin sequence (CTCGAG), and a 21 bp complementary strand sequence. A vector containing green fluorescent protein (GFP), a scrambled (SC) shrna or a control (CTRL) sequence were used as controls. The CTRL is an ineffective shrna directed against EGFR as described in (4). Lentivirus production and infections were performed as in(4). Expression constructs The full length MET cdna (NM_000245) was cloned into a lentiviral expression vector (modified from phr(10)) which was a kind gift from Dr. M. Begley. A vector SOM 5

6 containing GFP was used as a control. The ERBB3 cdna (NM_001982) was cloned into the pdnr-dual (BD Biosciences, San Jose, CA) vector(9). Lentiviral and retroviral productions and infections were performed as in(4). Following infection, cells were selected in 2 µg/ml of puromycin (Invitrogen, Carlsbad, CA). SNP and expression analyses HCC827 and HCC827 GR cells were plated to 60% confluence in serumcontaining medium and total RNA was harvested 6 hours after adding fresh media. The RNA samples were then hybridized to the Affymetrix HG-U133A microarrays and scanned. The expression value for each gene was calculated using the Affymetrix GeneChip software and the data analyzed using the dchip software ( Genomic DNA was isolated from HCC827 and HCC827 GR cells using the DNeasy tissue kit (Qiagen,Valencia, CA). Samples were processed for the Human Mapping 250K Sty single nucleotide polymorphism (SNP) array according to the manufacturer's instructions (Affymetrix Mapping 500K Assay Manual), except that the MJ Research thermocycler was set to the "Block" mode, and all denaturation cycles were carried out at 92ºC. Four PCR reactions were run for each sample, and 120ug of PCR product was fragmented, labeled and hybridized to each array. Comparison of gene copy number differences between HCC827 and the GR clones was performed using the dchip software as in(11). SOM 6

7 Quantitative PCR The relative copy number for MET was determined using quantitative real time PCR using a PRISM 7500 sequence detection kit (Applied Biosystems, Foster City, CA) and a QuantiTect SYBR Green PCR Kit (Qiagen, Inc., Valencia, CA). The standard curve method was used to calculate MET gene copy number in the cell line or tumor DNA sample relative to a reference, the Line-1 repetitive element, whose copy number is similar between normal and cancerous cells(11). Quantification was based on standard curves from a serial dilution of normal human genomic DNA. All specimens were analyzed in triplicate. The PCR primers are directed at exon 2 of MET and have been previously described(11). Fluorescence in situ hybridization Fluorescence in situ hybridization (FISH) was performed using a D7S522 probe and chromosome 7 centromere probe (CEP7) purchased from Vysis (Des Plaines, IL). Five micron (5 µm) tumor sections generated from patient specimen were pretreated by deparaffinizing in xylene and dehydrating in ethanol. The sections were immersed in Tris-base and EDTA (TE), washed in phosphate-buffered saline (PBS), and then treated with Digest-All (Zymed). Sections were then fixed with formalin and dehydrated in ethanol. After co-denaturation of the tissue and the probe mixture (D7S522 and CEP7) at 70 C for 3 minutes, the sections were hybridized at 37ºC for hours, washed with sodium citrate and Tween-20 containing buffers and counterstained with DAPI. The D7S522 probe is contained within the small amplicon of the HCC827 GR cells (Fig. 1D). One hundred cells from each tumor specimen were analyzed and the number of D7S522 SOM 7

8 and CEP 7 signals determined. Cells were categorized as (1) < 1 additional copy of D7S522 compared to CEP 7, (2) > 2 additional copies of D7S522 compared to CEP 7, or (3) > 3 additional copies of D7S522 compared to CEP 7. Patients Tumor specimens from gefitinib- or erlotinib-treated patients were obtained from the Dana Farber Cancer Institute/Brigham and Women s Hospital (Boston, MA), Aichi Cancer Center Hospital (Nagoya, Japan), Chinese University (Hong Kong, China) and from the Bellaria Hospital (Bologna, Italy) under Institutional Review Board approved studies. All patients provided written informed consent. The presence of an EGFR mutation in each specimen was using confirmed by exon-specific amplification (exons 18-21), followed by subcloning and direct sequencing, or by using the Surveyor TM endonuclease coupled with denaturing HPLC (DHPLC), fractionation and sequencing (7, 12). The EGFR T790M mutation was detected by using Surveyor TM endonuclease coupled with DHPLC or by using a Cycleave real-time PCR assay(4, 7, 13). Both methods are capable of detecting the EGFR T790M mutation at an allele frequency of 1-5%(7, 13). SOM 8

9 Fig S1. HCC827 GR cells contain a focal amplification in chromosome 7. Genome wide view of copy number changes were generated using Human Mapping 250K Sty single nucleotide polymorphism (SNP) array and analyzed using the dchip program (14). The GR clones were compared with the parental HCC827 cell line (depicted by red vertical line). The blue curve on the right indicates degree of amplification of each SNP from 0 (left) to 8 (right) SOM 9

10 16 14 MET Copy Number A549 H1993 H3255 H3255 GR HCC827 HCC827 GR1 HCC827 GR2 HCC827 GR5 HCC827 GR6 HCC827 GR7 HCC827 GR8 Fig S2. MET copy number determined by quantitative PCR (QPCR). A549 and H1993 were used as negative and positive controls, respectively(11). Each column represents the average of 3 independent experiments. Error bars indicate standard deviation. SOM 10

11 Fig S3. Treatment HCC827 GR cells with the combination of both gefitinib and PHA- 665,752 results in apoptosis as measured by cleaved (89 kda) PARP. Parental and resistant cells were treated with 1 µm gefitinib alone, 1 µm PHA-665,752 alone, or both drugs in combination for 72 hours. Cell extracts were immunoblotted to detect the indicated proteins. 125 % o f c o ntro l CTRL shrna A MET shrna A MET shrna B Gefitinib Concentration (µm) F ig S4. Downregulation of MET by MET-specific shrnas restores gefitinib sensitivity in the resistant cells. Control or MET specific shrnas were introduced into HCC827 GR6 cells, treated with gefitinib at the indicated concentrations, and viable cells were measured 72 hours after gefitinib treatment. Percentage of viable cells is shown relative to untreated controls. SOM 11

12 A. B. 125 % of Control GFP MET Gefitinib Concentration (µm) Fig S5. Overexpression of MET in HCC827 cells results in gefitinib resistance and persistent ERBB3 and Akt phosphorylation. (A) Full length MET or GFP cdnas were introduced into HCC827 GR6 cells, treated with gefitinib at the indicated concentrations, and viable cells were measured after 72 hours of treatment. Percentage of viable cells is shown relative to untreated controls. (B) Cells from (A) were treated with 1 µm geftinib alone, 1 µm PHA-665,752 alone or both drugs in combination. Cell extracts were immunoblotted to detect the indicated proteins. SOM 12

13 A. B. Fig S6. ERBB3 and MET co-precipitate from CHO cells. (A) Full length cdnas of ERBB3, MET or GFP were introduced into CHO cells, and treated with 1µM PHA- 665,752 alone, 3µM gefitinib alone or 3µM lapatinib alone. Immunoprecipitation was performed from cell extracts using an anti-erbb3 antibody. The precipitated proteins were determined by immunoblotting with the indicated antibodies. ERBB3 coprecipitates with p85 only in the presence of MET and this association is inhibited only by the MET specific inhibitor. (B) CHO cells were transfected with the indicated cdnas and were treated with PHA-665,752. Immunoprecipitation was performed from cell extracts using an anti-met antibody. The precipitated proteins were determined by immunoblotting with the indicated antibodies. SOM 13

14 Fig. S7. MET amplification is detected in a tumor from a patient who developed resistance to gefitinib. Dual-color FISH (CEP7 (green)/d7s522 (red)) was performed on tumor sections from a NSCLC patient prior to gefitinib treatment (left) and after the development of gefitinib resistance (right). MET amplification is detected only in the gefitinib resistant tumor specimen. The resistant tumor has no detectable EGFR T790M. Scale bars, 10 µm. Magnification 1000X. SOM 14

15 Table S1. Summary of the most highly overexpressed 20 mrna transcripts, their chromosomal locations, and mean fold overexpression (standard deviation) in the 6 HCC827 GR cells compared to the parental HCC827 cell line. The data were analyzed using the dchip software. Gene Location Fold Change (S.D.) transcription factor EC 7q (23.90) interleukin 1 receptor accessory protein-like 1 Xp22.1-p (7.92) transcription factor EC 7q (15.51 S100 calcium binding protein A4 1q (21.77) mucin 20, cell surface associated N/A (12.84) phosphodiesterase 2A, cgmp-stimulated 11q (3.74) met proto-oncogene 7q (3.97) Capping protein (actin filament) muscle Z-line, alpha 2 7q31.2-q (8.14) collagen, type VI, alpha 1 21q (2.68) transcription factor EC 7 q (7.65) met proto-oncogene 7q (4.42) collagen, type VI, alpha 2 21q (3.38) ets variant gene 1 N/A (2.78) interleukin 1 receptor accessory protein-like 1 Xp22.1-p (3.21) family with sequence similarity 3, member C N/A (7.31) met proto-oncogene 7q (2.82) CDNA: FLJ21769 fis, clone COLF7354 N/A (5.74) mucin 20, cell surface associated N/A (6.72) high mobility group AT-hook 1 N/A (2.90) Ras-related associated with diabetes 16q (2.15) SOM 15

16 Table S2. Summary of genetic changes in tissue samples from patients with NSCLC whose tumors had developed resistance to gefitinib or erlotinib. Specimens were analyzed for EGFR activating mutations, for the presence of the resistance-conferring EGFR T790M, and for MET amplification. MET amplification is indicated as copy number (standard deviation) in tumors analyzed by QPCR, or as percent of cells with increased MET copies compared to CEP 7 in tumors analyzed by FISH. Post-treatment specimens from 4 of 18 patients (22%) had MET amplification (asterisk). One of these four patients also had a concurrent EGFR T790M mutation. Patient Specimen Type EGFR mutation T790M Method MET copy no. (S.D.) Paired Specimens 1 Pre-gefitinib Primary lung cancer L858R No QPCR 2.10 (0.27) Post-gefitinib Pleural effusion L858R No QPCR 5.83 (1.41)* 2 Pre-gefitinib Primary lung cancer Del L747_P753 ins S No QPCR 1.83 (0.45) Post-gefitinib Cervical node Del L747_P753 ins S Yes QPCR 1.97 (015) 3 Pre-gefitinib Primary lung cancer Del L747_P753 ins S No QPCR 1.87 (0.38) Post-gefitinib Primary lung cancer Del L747_P753 ins S No QPCR 1.75 (0.94) 4 Pre-gefitinib Primary lung cancer Del L747_E749, A750P No QPCR 3.07 (0.81) Post-gefitinib Pleural biopsy Del L747_E749, A750P Yes QPCR 3.17 (0.63) 5 Pre-gefitinib Lymph Node Del L747_S752del,E746V No FISH 0% Post-gefitinib Brain Del L747_S752del,E746V No FISH 0% 6 Pre-gefitinib Pleura Del L747_E749del, A750P No FISH 1% Post-gefitinib Pericardium Del L747_E749del, A750P No FISH 2% 7 Pre-gefitinib Pleura Del L747_E749del, A750P No FISH 0% Post-gefitinib Liver Del L747_E749del, A750P Yes FISH 3% 8 Pre-gefitinib Lung Del E746_A750 No FISH 0% Post-gefitinib Lymph node Del E746_A750 No FISH 26%* Post-treatment Specimens 9 Post- gefitinib Pleural effusion Del E746_A750 No QPCR 2.30 (0.25) 10 Post-gefitinib Axilary lymph node L858R No QPCR 1.98 (0.48) 11 Post-gefitinib Primary lung cancer L858R Yes QPCR 1.92 (0.46) 12 Post-gefitinib Primary lung cancer Del L747_T751,K754E Yes QPCR 3.90 (0.61) Post-gefitinib Mediastinal lymph node Del L747_T751,K754E No QPCR 6.58 (1.35)* 13 Post-gefitinib Primary lung cancer L858R Yes QPCR (7.69)* 14 Post-gefitinib Lung Metastasis L858R Yes QPCR 1.86 (0.23) 15 Post-gefitinib Primary lung cancer L858R No QPCR 1.92 (0.23) 16 Post-erlotinib Lung metastasis Del E746_A750 Yes FISH 0% 17 Post-gefitinib Lung metastasis Del L747_T751 Yes FISH 0% 18 Post-gefitinib Lung metastasis L858R Yes FISH 0% Tumors with EGFR T790M 55% (10/18) Tumors with MET amplification 4/18 (22%) SOM 16

17 Table S3. Summary of lung cancer specimens analyzed by FISH. In each sample, 100 cells were counted and the percentage of cells containing at least 2 or 3 more copies of MET compared to CEP 7 is shown. Patient Specimen Type Cells with > 2 MET > CEP 7 Cells with > 3 MET > CEP 7 5 Pre-gefitinib Lymph Node 2% 0% Post-gefitinib Brain 1% 0% 6 Pre-gefitinib Pleura 3% 0% Post-gefitinib Pericardium 2% 0% 7 Pre-gefitinib Pleura 0% 0% Post-gefitinib Liver 4% 3% 8 Pre-gefitinib Lung 3% 0% Post-gefitinib Lymph node 59% 26% 16 Post-erlotinib Lung metastasis 4% 2% 17 Post-gefitinib Lung metastasis 0% 0% 18 Post-gefitinib Lung metastasis 0% 0% SOM 17

18 Table S4. Primers used in the Surveyor TM analyses of EGFR cdna. The Sequences are based on NM_ Primer name Primer sequence 5 to 3 EGFR F1 EGFR R1 EGFR F2 EGFR R2 EGFR F3 EGFR R3 EGFR F4 EGFR R4 EGFR F5 EGFR R5 EGFR F6 EGFR R6 EGFR F7 EGFR R7 CCAGTATTGATCGGGAGAGC GGGCACAGATGATTTTGGTC CGATGGACTTCCAGAACCAC TTCTCAAAGGCATGGAGGTC CTTGCCGCAAAGTGTGTAAC TTCTCCACAAACTCCCTTGG AGGTGAAAACAGCTGCAAGG GCTTTCGGAGATGTTGCTTC GGAGCCTCTTACACCCAGTG AGGTCATCAACTCCCAAACG GCTCCCAGTACCTGCTCAAC CTGAGCTGTATCGCTGCAAG ACTTCTACCGTGCCCTGATG TTGGTCCTGGGTATCGAAAG SOM 18

19 Supporting references 1. J. G. Paez et al., Science 304, 1497 (2004). 2. J. Amann et al., Cancer Res. 65, 226 (2005). 3. T. Mukohara et al., J. Natl. Cancer Inst. 97, 1185 (2005). 4. J. A. Engelman et al., J. Clin. Invest. 116, 2695 (2006). 5. G. A. Smolen et al., Proc Natl Acad Sci U S A 103, 2316 (2006). 6. M. Park, H. Park, W. H. Kim, H. Cho, J. H. Lee, Exp Mol Med 37, 213 (2005). 7. P. A. Janne et al., Clin. Cancer Res. 12, 751 (2006). 8. T. Mukohara et al., Clin. Cancer Res. 11, 8122 (2005). 9. J. A. Engelman et al., Proc Natl Acad Sci U S A 102, 3788 (2005). 10. L. Naldini et al., Science 272, 263 (1996). 11. X. Zhao et al., Cancer Res. 65, 5561 (2005). 12. T. Kosaka et al., Clin. Cancer Res. 12, 5764 (2006). 13. Y. Yatabe et al., J Mol Diagn 8, 335 (2006). 14. X. Zhao et al., Cancer Res. 64, 3060 (2004). SOM 19