Supplemental Information. An Atlas of b-glucuronidases. in the Human Intestinal Microbiome

Size: px

Start display at page:

Download "Supplemental Information. An Atlas of b-glucuronidases. in the Human Intestinal Microbiome"

Amberly Stevens
5 years ago
Views:

1 Structure, Volume 2 Supplemental Information An Atlas of b-glucuronidases in the Human Intestinal Microbiome Rebecca M. Pollet, Emma H. D'Agostino, William G. Walton, Yongmei Xu, Michael S. Little, Kristen A. Biernat, Samuel J. Pellock, Loraine M. Patterson, Benjamin C. Creekmore, Hanna N. Isenberg, Rohini R. Bahethi, Aadra P. Bhatt, Jian Liu, Raad Z. Gharaibeh, and Matthew R. Redinbo

Figure S1A. Loop Category Variability. Related to Table 1, Table 2. 33.8% Zero L1 GUS Genes 66.2% 1 or more L1 GUS Genes 33.8% 47 33.

2 Figure S1A. Loop Category Variability. Related to Table 1, Table % Zero L1 GUS Genes 66.2% 1 or more L1 GUS Genes 33.8% % of individuals have 1 L1 GUS 46 Number Individuals with this Number of L1 GUS Genes % % 1 Average 1.2 +/- 1.2 L1 GUS Genes 2.8% 2.2% Number L1 GUS Genes

Figure S1B. Loop Category Variability. Related to Table 1, Table 2. 1.4% Zero ml1 GUS Genes 98.6% 1 or more ml1 GUS Genes 2.

3 Figure S1B. Loop Category Variability. Related to Table 1, Table % Zero ml1 GUS Genes 98.6% 1 or more ml1 GUS Genes 2.1% of individuals have 3 ml1 GUS 28 Number Individuals with this Numbe rof ml1 Genes % 2 6.% 9 1.8% 1 1.8% % % % Number ml1 GUS Genes Average 4.4 +/- 2.2 ml1 GUS Genes 3.6% 2.9% 4 1.4% 2.1% 1

4 Figure S1C. Loop Category Variability. Related to Table 1, Table % Zero L2 GUS Genes 92.1% 1 or more L2 GUS Genes Number Individuals with this Number of L2 GUS Genes % % % % of individuals have 3 L2 GUS % Number L2 GUS Genes Average 2. +/- 1.6 L2 GUS Genes 7.2% 1 2.2% 3.7% 1

5 Figure S1D. Loop Category Variability. Related to Table 1, Table % Zero ml2 GUS Genes 8.6% 1 or more ml2 GUS Genes Number Individuals with this Number of ml2 GUS Genes % % of individuals have 1 ml2 GUS % 39 Average 1. +/- 1.1 ml2 GUS Genes 17.3% % Number ml2 GUS Genes

6 Figure S1E. Loop Category Variability. Related to Table 1, Table 2. 76% Zero ml1ml2 GUS Genes 76% 1 24% 1 or more ml1ml2 GUS Genes Number Individuals with this Number of ml1,2 GUS Genes Average.2 +/-. ml1,2 GUS Genes 23% of individuals have 1 ml1ml2 GUS % Number ml1,2 GUS Genes x

7 Figure S1F. Loop Category Variability. Related to Table 1, Table 2. 1% 1 or more nl GUS Genes 14 1% of individuals have 1 nl GUS 14 Number Individuals with this Number of NL GUS Genes % 2 3.6% 7.9% 11 Average 1.7 +/- 4.6 nl GUS Genes 2.2% 3.72% Number NL GUS Genes

8 Figure S1G. Loop Category Variability. Related to Table 1, Table 2. 41% Zero nc GUS Genes 7 9% 1 or more nc GUS Genes Number Individuals with this Number of NL GUS Genes % 4 1.1% of individuals have 2 nc GUS 21 6.% Number NL GUS Genes 3.6% Average 1. +/- 1.2 nc GUS Genes 1.4% 2

9 Figure S2. Summary of Loop Variability. Related to Table 2. Average Percent Composition of Abundance Reads % 21% 14% 7.1% 3.1% 4.6% 1.% L1 ml1 L2 ml2 ml1ml2 NL NC Loop Category

10 Figure S3. GUS Panel Sequence Identities. Related to Figure. Pairwise Sequence Identities for GUS Panel Proteins Ec Ee Fp Bf Bu Pm Bo Bd Ec Ee Fp Bf Bu Pm Bo 31 Bd

11 Figure S4A. GUS Panel ph Optima. Related to Figure. 3 3 E. coli GUS Optimal ph 7.4 PNP Generated (nmoles) ph 4 ph 4. ph ph. ph 6 ph 6. ph 7 ph Time (minutes)

12 Figure S4B. GUS Panel ph Optima. Related to Figure. 3 Eubacterium eligens GUS Optimal ph 6. 2 PNP Generated (nmoles) ph 4 ph 4. ph ph. ph 6 ph 6. ph 7 ph Time (minutes)

13 Figure S4C. GUS Panel ph Optima. Related to Figure. 4 Facaelibacterium prausnitzii GUS 3 Optimal ph 6 PNP Generated (nmoles) ph 4. ph 4. ph. ph. ph 6. ph 6. ph 7. ph Time (minutes)

14 Figure S4D. GUS Panel ph Optima. Related to Figure Bacteroides fragilis GUS Optimal ph PNP Generated (nmoles) ph 4 ph 4. ph ph. ph 6 ph 6. ph 7 ph Time (minutes)

15 Figure S4E. GUS Panel ph Optima. Related to Figure. 2 2 Bacteroides uniformis GUS Optimal ph 6 PNP Generated (nmoles) 1 1 ph 4 ph 4. ph ph. ph 6 ph 6. ph 7 ph Time (minutes)

Figure S4F. GUS Panel ph Optima. Related to Figure. 16 14 Parabacteroides merdae GUS Optimal ph.

16 Figure S4F. GUS Panel ph Optima. Related to Figure Parabacteroides merdae GUS Optimal ph. PNP Generated (nmoles) ph4. ph 4. ph. ph. ph 6. ph 6. ph 7. ph Time (minutes)

17 Figure S4G. GUS Panel ph Optima. Related to Figure. 6 Bacteroides ovatus GUS Optimal ph PNP Generated (nmoles) ph 4. ph 4. ph. ph. ph 6. ph 6. ph 7. ph Time (minutes)

18 Figure S4H. GUS Panel ph Optima. Related to Figure. 3 2 Bacteroides dorei GUS Optimal ph 6 PNP Generated (nmoles) ph 4. ph 4. ph. ph. ph 6. ph 6. ph 7. ph Time (min)

19 Figure SA. Heparan Carbohydrate Cleavage by GUS Panel. Related to Figure. GlcUA-GlcNAc-GlcUA-GlcNAc-GlcUA-GlcNAc-GlcUA-GlcNAc-GlcUA-PNP, 9-mer (MW = 1832.) GlcUA b-glucuronidase (GUS) GlcNAc-GlcUA-GlcNAc-GlcUA-GlcNAc-GlcUA-GlcNAc-GlcUA-PNP, 8-mer (MW = 166.4)

20 Figure SB. Heparan Carbohydrate Cleavage by GUS Panel. Related to Figure. Representative Representative HPLC chromatograms and ESI-MS spectra of nonasaccharide digestion HPLC chromatograms and ESI-MS spectra of 9-mer substrate digested by β-glucuronidases Representative HPLC chromatograms and ESI-MS spectra of of 9-mer substrate digested by by β-glucuronidases epresentative HPLC chromatograms and ESI-MS spectra of 9-mer substrate digested by β-glucuronidases 4e+ 4e+ 4e+ 4e+ 3e+ O.D. 31 nm O.D. 31 nm O.D. O.D nm nm 3e+ 3e+ 3e+ 2e+ 2e+ 2e+ 2e+ 1e+ 1e+ 1e+ 1e+ HPLC of uncleaved reaction 9-mer (e.g., Bo, Ec, Ee, Fp) 9-mer 9-mer 9-mer 9-mer Retention time (min) Retention time time (min) ESI-MS of uncleaved reactions (e.g., Bo,Ec,Ee,Fp) O.D. O.D. 31nm 31nm O.D. 31nm O.D. O.D. 31nm 31nm HPLC of partially cleaved reaction (e.g., Bd, Bf, Bu) 9-mer Relative abundance (%) Relative abundance (%) Relative Relative abundance abundance (%) (%) HPLC of fully cleaved reaction 8-mer (e.g., Pm) Retention time (min) Retention Retention time time (min) (min) Retention time (min) HPLC of uncleaved reaction (Bo,Ec,Ee,Fp) HPLC of partially cleaved reaction (Bd,Bf,Bu) HPLC of cleaved reaction (Pm) HPLC of of of uncleaved uncleavedreaction (Bo,Ec,Ee,Fp) HPLC HPLC of of partially cleaved reaction (Bd,Bf,Bu) HPLC of of cleaved reaction (Pm) 9mer 1 z= mer 9mer 1 9mer mer z=3 z=3 z=3 z= mer 86 69mer9mer z=4 z=4 z= Relative abundance (%) Relative abundance (%) Relative abundance (%) Relative Relative abundance abundance (%) (%) mer z= mer 9mer 9mer z=2 z=2 z= m/z Mass of uncleaved m/z reaction m/z (Bo,Ec,Ee,Fp) m/z Mass of uncleaved reaction (Bo,Ec,Ee,Fp) 2.e+ 2.e+ 2.e+ 2.e+ 2.e+ 2.e+ 2.e+ 2.e+ 1.e+ 1.e+ 1.e+ 1.e+ 1.e+ 1.e+ 1.e+ 1.e+.e+4.e+4.e Retention time (min) Retention time (min) 1 9mer 9mer z=3 z= mer mer 9mer 9mer z=3 z=4 z=3 z= z= z= z=3 z= z=4 1.2 z=4 z= Relative abundance (%) Relative abundance (%) Relative Relative abundance abundance (%) (%) 9-mer 8-mer 9-mer 9-mer 9-mer 8-mer 8-mer 8-mer ESI-MS of partially cleaved reactions (e.g., Bd, Bf, Bu) z=2 9mer z= z=2 9mer z=2 9mer z= z= Mass of partially m/zcleaved reaction m/z m/z (Bd,Bf,Bu) 4e+ 4e+ 4e+ 4e+ 3e+ 3e+ 3e+ 3e+ 2e+ O.D 31 nm O.D O.D nm nm O.D O.D nm nm 2e+ 2e+ 2e+ 1e+ 1e+ 1e+ 1e m/z Retention time (min) Retention time time (min) (min) 6 z= z=4 4 z= mer 8-mer 8-mer 8-mer ESI-MS of fully cleaved reaction (e.g., Pm) z=3 1.2 z=3 z= z= z=2 z= m/z m/z Mass of cleaved m/zreaction (Pm)

21 Supplemental Table 3. Crystallographic Statistics for B. uniformis GUS Resolution (highest shell; Å) ( ) Space group P Unit cell dimensions (a, b, c; Å) 74.7, 142.9, Total reflections (F>) 1,668,9 Unique reflections 12,73 Multiplicity 1.9 (11.) Completeness, % (highest shell) 99.4 (98.7) Mean I/sigma(I) (highest shell) 21.1 (.) Wilson B-factor (Å 2 ) 22.1 R merge (highest shell).68 (.448) R.144 R free.18 Number of protein, metal, ligand, and water atoms per asymmetric unit 13,6, 4, 36, 177 rms bonds (Å).11 rms angles ( ) 1.28 Ramachandran favored (%) 97. Ramachandran outliers (%) Clash score Average B-factor (Å 2 ) 3.2 RCSB ID UJ6

22 Table S4. Primer Sequences Primer Name Sequence EeGUS Fwd EeGUS Rev FpGUS Fwd FpGUS Rev BfGUS Fwd BfGUS Rev BuGUS Fwd BuGUS Rev PmGUS Fwd TACTTCCAATCCAATGCGATGCTGTACCCTGTCCTGACTCAGTCTC G TTATCCACTTCCAATGCGCTATTTGGTTTTGTAGCCAAATTCCGGA ATGGTGGACCAG TACTTCCAATCCAATGCGATGAACCGTAGCCTGCTGTACCCTCGTG TATCCACTTCCAATGCGCTTTTTTTGCGTTTTTTGAAGTCAACCG TACTTCCAATCCAATGCGCGTGAGGATATTCTACTCAACAATAACT GGAATTTCCGTTTT TTATCCACTTCCAATGCGCTATAGGGGTCTGTCTTCTTTATATTCTA CTGTCACTTCGTC TACTTCCAATCCAATGCGCAACG TCAAACTCAAACCATCAACGACTCCTGGAAG TTATCCACTTCCAATGCGCTAATAAATGTTGCGCAGTTTAATGCCAT TCAGGAAACACG TACTTCCAATCCAATGCGATGAAATACCTGTTCGTCGCTTGCCTGC TGTG PmGUS Rev TTATCCACTTCCAATGCGCTATTTCGGGCTTTTCAGTTCCAGAAAC GCGGTC BoGUS Fwd BoGUS Rev BdGUS Fwd BdGUS Rev TACTTCCAATCCAATGCGCAGGAAACTTCTCCGCGTACTATCTTCT CTCTGAAC TTATCCACTTCCAATGCGCTATTTAATGCAGTACCATTCGCAGGTG TCGGACAG TACTTCCAATCCAATGCGAGCGAGATCAGCATCACTGACTCTTGGA AGTATAAG TTATCCACTTCCAATGCGCTAGCGAATTTTTTTAACTTTCAGGCCG CTAATTACGCCCTG

23 SUPPLEMENTAL FIGURE, TABLE, AND DATA FILE LEGENDS Figure S1. Loop Category Variability. Related to Table 1, Table 2. For the HMGI313 GUS analysis, the number of individuals of each loop category is presented, with annotations to indicate averages and percent of individuals with no GUS enzymes of that category, and the averages over all individuals. Panels A-F present this information for the six formal GUS categories (Loop 1, Mini-Loop 1, Loop 2, Mini- Loop 2, Mini-Loop 1,2, No Loop, respectively), while panel G presents this information for the no content GUS proteins. Figure S2. Summary of Loop Variability. Related to Table 2. Bar graph of the average percent composition of abundance reads for the HMGI313 dataset within each loop category, with standard deviations of the averages indicated. Figure S3. GUS Panel Sequence Identities. Related to Figure. Pairwise sequence identities in percent for the GUS panel proteins from E. coli (Ec), Eubacterium eligens (Ee), Faecalibacterium prausnitzii (Fp), Bacteroides fragilis (Bf), B. uniformis (Bu), Parabacteroides merdae (Pm), B. ovatus (Bo), and B. dorei (Bd). Each enzyme s identifier is colored by loop category: red, Loop 1, green, Mini-Loop 1; blue, Loop 2; orange, Mini-Loop 2; magenta, Mini-Loop 1,2; purple, No Loop. Figure S4. GUS Panel ph Optima. Related to Figure. Results for amount of PNP produced from PNPG per minute at the eight indicated ph values are presented for each of the eight enzymes in the GUS panel, and colored by loop category as outlined in Figure S3 above. Amount of PNP Generated is shown as the average and standard deviation over three replicates. The ph optimum selected for each GUS is also indicated. Figure S. Heparan Carbohydrate Cleavage by GUS Panel. Related to Figure. A. Chemical structures and molecular weights of heparan nonasaccharaide (9-mer) assay substrate and octasaccharide (8-mer) product detected by both HPLC and ESI- MS, where GlcUA is glucuronic acid, GlcNAc is N-acetylglucosamine, and PNP is p- nitrophenol. B. Representative HPLC chromatograms and ESI-MS spectra for heparan digestion assays with the GUS panel. HPLC results (top) are shown for uncleaved (left), partially cleaved (middle), and fully cleaved (right) reactions. Electrospray ionization mass spectrometry (ESI-MS) spectra are shown for the same types of reactions (left, middle, center). GUS enzymes from the following organisms were examined: Bo, B. ovatus, Ec, E. coli, Ee, Eu. eligens, Fp, F. prausnitzii, Bd, B. dorei, Bf, B. fragilis, Bu, B. uniformis, Pm, P. merdae. Table S1. HMGI313 Characteristics. Related to Table 1, Table 2. Detailed information is provided for all 313 GUS proteins identified in the HMGI database, including the sequences of their Loop 1 and Loop 2 regions, protein length in amino acid residues, read abundances, and taxonomy along with BLAST hit characteristics.

24 Table S2. HMGC279 Characteristics. Related to Table 1, Figure 3. Detailed information is provided for the 279 GUS proteins identified in the HMGC Clustered Gene Indices database of the HMP, including the sequences of their Loop 1 and Loop 2 regions, protein length in amino acid residues, taxonomy along with BLAST hit characteristics, and signal peptide search results. Table S3. BuGUS Crystallographic Analysis. Related to Figure. X-ray data collection, structure determination, and structure refinement information are provided for the crystal structure of the Loop 2 GUS from B. uniformis (BuGUS). Table S4. Primer Sequences. Related to Figure. Forward and reverse primers employed in this study. Data File S1. HMGI313 Sequences. Related to Figure 1. FASTA sequences for the 313 total GUS proteins identified in the HMGI Gene Indices database, part of the Stool Sample Catalog of the Human Microbiome Project (HMP). Entries are labeled by their HMP identifier. Data File S2. HMGC279 Sequences. Related to Figure 1, Figure 3, Table 1. FASTA sequences for the 279 unique GUS proteins identified in the HMGC Clustered Gene Indices database, part of the Stool Sample Catalog of the Human Microbiome Project (HMP). Entries are labeled by their HMP identifier, along with the GUS category it belongs to (L1, ml1, L2, ml2, ml1,2, NL, nc), and taxonomy when identified. Data File S3. Representative GUS Loop Alignment. Related to Figure 2. Multiple sequence alignment of the amino acid sequence of twelve representative GUS enzymes, with residue numbers indicated at right, and loop regions colored as follows: red, Loop 1; green, Mini-Loop 1; blue, Loop 2; orange, Mini-Loop 2; magenta, Mini-Loop 1, 2; purpe, No Loop. The twelve GUS enzymes are from Homo sapiens (HsGUS), Faecalibacterium prausnitzii (FpGUS), E. coli (EcGUS), Streptococcus agalactiae (SaGUS), Clostridium perfringens (CpGUS), Eubacterium eligens (EeGUS), Parabacteroides merdae (PmGUS), a Firmicutes GUS described from human fecal metagenomic sequencing (H11G11-BG), Bacteroides fragilis (BfGUS), B. ovatus (BoGUS), B. uniformis (BuGUS), and B. dorei (BdGUS). Identical amino acid positions are indicated with an asterisk (*), while largely conserved and conserved amino acid positions are indicated with a colon (:) or period (.), respectively.

Table S1. X-ray data collection and refinement statistics

Table S1. X-ray data collection and refinement statistics Data collection H7.167 Fab-Sh2/H7 complex Beamline SSRL 12-2 Wavelength (Å) 0.97950 Space group I2 1 3 Unit cell parameters (Å, º) a = b = c=207.3,