Mangosteen peel can reduce methane production and rumen biohydrogenation in vitro
|
|
- Derrick Simmons
- 5 years ago
- Views:
Transcription
1 South Africn Journl of Animl Science 2016, 46 (No. 4) Mngosteen peel cn reduce methne production nd rumen iohydrogention in vitro P. Shokryzdn 1, M.A. Rjion 2, Y.M. Goh 1,2#, I. Ishk 2, M.F. Rmlee 2, M. Fseleh Jhromi 1,3 & M. Erhimi 2# 1 Institute of Tropicl Agriculture, Universiti Putr Mlysi, UPM Serdng, Selngor, Mlysi. 2 Fculty of Veterinry Medicine, Universiti Putr Mlysi, UPM Serdng, Selngor, Mlysi. 3 Agriculture Biotechnology Reserch Institute of Irn (ABRII), Est nd North-Est Brnch, P.O.B , 844 Mshhd, Irn. (Received 10 Septemer 2015; Accepted 11 Septemer 2016; First pulished online 24 Novemer 2016) Copyright resides with the uthors in terms of the Cretive Commons Attriution 2.5 South Africn Licence. See: Condition of use: The user my copy, distriute, trnsmit nd dpt the work, ut must recognise tht uthors nd the South Africn Journl of Animl Science Astrct Mngosteen peel (MP), n griculturl y-product of tropicl countries, hs een reported to contin condensed tnnins nd sponins, which cn ffect rumen microes to reduce enteric methne emission. In the present study, the effects of mngosteen peel on in vitro ruminl fermenttion, gs production, methne production, ftty cid iohydrogention, nd microil popultion were investigted. Results showed tht MP t medium nd high levels (25 % nd 50 % replcing lflf) were le to reduce (P <0.05) in vitro methne production without ffecting voltile ftty cid (VFA) production nd the ph of the sustrte. The lowering effect of MP on methne production ws ecuse of suppression of the rumen microil popultions, especilly totl protozo nd totl methnogens. MP t the higher level (50%) reduced (P <0.05) the mounts of iohydrogention for linoleic cid (C18:2n-6), α-linolenic cid (C18:3n-3) nd the totl C18 unsturted ftty cids (UFA) owing to the reduction of the Butyrivirio firisolvens popultion, tht is, the most importnt rumen microorgnism involved in the iohydrogention process. In conclusion, mngosteen peel hs potentil to e used in ruminnt livestock feeds, with the dvntge of reducing ruminl methne production nd iohydrogention, without dverse effects on ruminl ph nd VFA production. Keywords: griculturl y-product, sponins, condensed tnnins, gs production, voltile ftty cid, microil quntifiction # Corresponding uthors: merhimii@gmil.com; ymgoh@upm.edu.my Introduction The rumen houses illions of microes, predominntly cteri, protozo nd fungi. It is suitle plce for microes to multiply ecuse of its neroic environment, good mixing of inner mterils, nd constnt ph nd temperture. Microes in the rumen help cellulose nd crohydrte digestion to simple sugrs nd VFAs to e used y the host (Frndson et l., 2009). Other undnt products of microil digestion in the rumen re cron dioxide, methne nd mmoni (Hoson, 1997). Importnt cellulolytic cteri of the rumen include Ruminococcus lus, Ruminococcus flvefciens nd Firocter succinogens (Fseleh Jhromi et l., 2013). Rumen protozo consist minly of Entodinium, Holotrichs, Spirotrichs, Methnocterium ruminntium nd Methnosrcin rkeri, of which the ltter two re importnt rumen methnogens (Fseleh Jhromi et l., 2013). Ruminnt enteric fermenttion is responsile for 15 % to 20 % of glol methne emissions (Crutzen et l., 1986; Bhtt et l., 2015; Buccioni et l., 2015), which is pproximtely 4 % of totl greenhouse gs production (FAO, 2010). In ddition, methne produced during ruminl fermenttion cuses loss of 11 % to 13 % of digestile energy (McDonld et l., 2002). Hence, mny techniques hve een ttempted over the yers to reduce methne production y ruminnts, usully employing dietry mnipultion, for exmple dietry supplementtion of ntiiotics, hlogented compounds, oils, orgnic cids, propionte precursors, direct-fed microils, cteriocins, vccines nd secondry metolites of plnts. In ddition, owing to high levels of ftty cid iohydrogention in the rumen, ruminnt products usully contin high levels of sturted ftty cids (SFA) nd low levels of polyunsturted ftty cids (PUFA) (Morimoto et l., 2005). Becuse of incresed consumer wreness of the effects of diet on their helth, RL: ISSN (print), ISSN (online) Pulisher: South Africn Society for Animl Science
2 420 Shokryzdn et l., S. Afr. J. Anim. Sci. vol. 46 reserchers hve ttempted to lter the ftty cid profile of ruminnt met products to reduce SFA nd increse PUFA y lowering iohydrogention in the rumen, with some success in lm (Rjion et l., 2001) nd chevon (Erhimi et l., 2011). Mny tropicl plnts nd their extrcts, which normlly contin high or medium levels of secondry metolites, hve een used in ruminnt feeds, nd hve een shown to ffect the rumen fermenttion process nd end-products y ltering the rumen microil popultions. For exmple, sponins nd condensed tnnins hve een shown to exert specific effect ginst rumen protozo (Lu & Jorgensen, 1987; Getchew et l., 2000; Wng et l., 2000). Altertion of the rumen microil popultion cn lso ffect production of methne nd iohydrogention of ftty cids in the rumen. Mngosteen (Grcini mngostn L.), ntive tropicl fruit tht is found in South Est Asin countries such s Indonesi, Mlysi, Thilnd nd Vietnm, consists of the peel (exocrp), pulp nd seed. Mngosteen peel contin condensed tnnins (16.8% w/w dry mtter (DM)) nd sponins (10.0% w/w DM), which hve een reported to hve some effect ginst rumen protozo, while the rest of the rumen iomss remins unltered (Ngmseng & Wnpt, 2005). Hence, ecuse of the vilility nd undnce of mngosteen in Mlysi, it could e used s feed supplement for ruminnts to reduce methne production nd ftty cid iohydrogention in the rumen. In the present study, the effects of mngosteen peel on in vitro gs production, methne production, rumen fermenttion, ftty cid iohydrogention nd chnges in microil popultion were investigted. Mterils nd Methods Fresh mngosteen fruits were purchsed from locl mrket in Serdng, Selngor, Mlysi. The fruit pulps were removed, nd the peels were kept to prepre MP powder. The peels were dried in the oven t 60 o C for 72 h. After tht, the dried peel were ground nd filtered through 1-mm sieve to otin the MP powder. Totl sponin content ws determined ccording to Mkkr et l. (2007), sed on the vnillin-sulfuric cid colorimetric rection. The results were expressed s mg diosgenin equivlent/g DM of MP. Condensed tnnins were determined y the utnol-hcl-iron method ccording to Porter et l. (1985), s descried y Jynegr et l. (2010). In rief, 0.5 ml of the extrct ws mixed with 0.1 ml ferric regent (2.0 g ferric mmonium sulfte in 100 ml of 2 N HCl), followed y 3 ml utnol-hcl (95:5 v/v), nd the tue ws vortexed. Susequently, the tue ws heted in oiling wter th t 100 o C for 60 min. The sornce ws red t 550 nm. In the present study, three tretments were used, nmely the control (C, 50% concentrte + 50% lflf without MP); medium MP (MMP, 50% concentrte + 25% lflf + 25% MP); nd high MP (HMP, 50% concentrte + 50% MP). Gs production ws determined y the procedure descried y Fievez et l. (2005) with minor modifictions (mount of sustrte nd time of cron dioxide infusion were chnged). Rumen fluid ws collected efore the morning feeding from two rumen-fistulted (Br Dimond Inc, PO Box 60, Prm, Idho, USA) gots fed n equl weight mixture of 40% concentrte nd 60% lflf twice dily t 08:00 nd 18:00. Rumen fluid ws collected in thermos flsk nd trnsported directly to the lortory. After tht, the rumen fluid ws filtered with four lyers of cheesecloth, nd stirred with mgnetic stirrer while eing continuously flushed with cron dioxide. Phosphte uffer (contining 28.8 g N 2 HPO 4.12H 2 O, 6.1 g NH 2 PO 4.H 2 O nd 1.4 g NH 4 Cl per litre distilled wter, ph 6.8) nd icronte uffer (contining 39.2 g of NHCO 3 per litre distilled wter, ph 6.8) were mixed (4:1 v/v) with the filtered rumen fluid. A totl of 0.25 g dried feed mteril of ech tretment ws dded to 100-mL clirted syringe, nd 30 ml of the rumen fluid mixture were lso dded to ech syringe. All the syringes were incuted t 39 ºC for 24 h. At the sme time, volumes of produced gs were mesured fter 0 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h nd 24 h incution. At ech reding time, the syringes were shken crefully to ensure complete mixing of the incuted contents. Stndrd hy (University of Hohenheim, Stuttgrt, Germny) with n estimted gs production of ml/g DM ws used to clirte the in vitro gs production system. After 24 h in vitro incution, smples of sustrte were otined from the syringes to determine methne nd VFA production, using gs-liquid chromtogrphy (Agilent Technologies, Agilent 7890A, Plo Alto, Clif, USA). After 24 h in vitro incution, smples of gs were otined nd the concentrtion of methne for ech smple ws determined y injection of 500 µl gs from ech syringe to the gs-liquid chromtogrphy (Agilent 5890 Series Gs Chromtogrph, Wilmington, Del, USA), equipped with HP-Plot Q column (30 m 0.53 mm 40 µm) (Agilent Technologies, Wilmington, Del, USA). The crrier gs ws nitrogen with flow rte of 3.5 ml/min, nd the temperture of the oven ws set t 50 C. Methne ws detected using therml conductivity detector in 1 min of run time. Clirtion ws completed using stndrd gs prepred y Scott Specilty Gses (Supelco, Bellefonte, P, USA), which contins 1% of methne, cron dioxide, cron monoxide, oxygen nd hydrogen (Fseleh Jhromi et l., 2013).
3 Shokryzdn et l., S. Afr. J. Anim. Sci. vol The mounts of VFA produced were determined ccording to the method of Erhimi et l. (2014) with minor modifictions in the gs-liquid chromtogrphy conditions. The detils re descried elow. After smple preprtion, 0.5 ml superntnt nd 0.5 ml internl stndrd (20 mmol, 4-methylvleric cid) were trnsferred to 2-mL glss tues nd 1 µl of ech smple ws injected to gs-liquid chromtogrphy (Agilent Technologies, Agilent 7890A, Plo Alto, Clif, USA) with flme ioniztion detector with Qudrex 007 Series (Qudrex Corportion, New Hven, Conn, USA) onded phse fused silic cpillry column (15 m, 0.32 mm ID, 0.25 µm film thickness). The temperture of column ws set t 70 to 150 ºC with temperture progrmming t the rte of 7 ºC/min increments for optiml seprtion. Temperture of oven, FID nd injector were 160 ºC, 250 ºC, nd 230 ºC, respectively. Nitrogen with the flow rte of 1.0 ml/min ws used s crrier gs. Acette (20 mmol), propionte (10 mmol) nd utyrte (10 mmol) were used s stndrd solutions to identify the peks, sed on their retention times (Erhimi et l., 2015). Totl ftty cids were extrcted from the whole syringe content fter 24 h of incution, sed on the method of Folch et l. (1957), modified y Rjion et l. (1985), s descried y Erhimi et l. (2012) using chloroform/methnol 2:1 (v/v) contining utylted hydroxy toluene to prevent oxidtion during smple preprtion. After complete seprtion, the lower phse ws collected in round ottom flsk nd rotry evported (Lorot 4000-efficient; Heidolph, Germny) t 70 ºC. An internl stndrd, heneicosnoic cid (C21:0) (Sigm Chemicl, St. Louis, Mo, USA), ws dded to ech smple efore trnsmethyltion to determine the individul ftty cid concentrtion in the smple. Trnsmethyltion of the extrcted ftty cids to their ftty cid methyl esters (FAME) ws crried out using potssium hydroxide (KOH) in methnol nd 14% methnolic oron trifluoride (BF 3 ). The FAME were seprted y gs chromtogrphy (Agilent 7890N), using Supelco SP 2560 cpillry column of 100 m 0.25 mm ID 0.2 μm film thickness (Supelco, Bellefonte, P, USA). The mount of 1 μl ws injected y n uto smpler (Agilent Auto Anlyzer 7683 B series, Agilent Technologies, Snt Clr, Clif, USA) into the chromtogrph equipped with split/splitless injector nd n FID. The crrier gs ws nitrogen t flow rte of 1.2 ml/min. The split rtio ws 1 : 20 fter injection of 1 μl of the FAME. The injector temperture ws progrmmed t 250 ºC, nd the detector temperture ws 270 ºC. The column temperture progrmme strted to run t 150 ºC, for 2 min, wrmed to 158 ºC t 1 ºC/min, held for 28 min, wrmed to 220 ºC t 1 ºC/min, nd then held for 20 min to chieve stisfctory seprtion. The peks of smples were identified, nd concentrtions clculted sed on the retention time nd pek re of known stndrds (Sigm Chemicl). The ftty cid concentrtions re expressed s g/100 g of the sum of identified peks mesured in ech smple. The ftty cid concentrtions re expressed s percentge (%) of totl identified ftty cids. A reference stndrd (mix C4-C24 methyl esters; Sigm-Aldrich, Inc., St. Louis, Mo, USA) nd CLA stndrd mix (cis-9 trns-11 nd trns-10, cis-12 CLA, Sigm-Aldrich, Inc., St. Louis, Mo, USA) ws used to determine recoveries nd correction fctors to determine individul FA composition. The iohydrogention (BH) of PUFA ws clculted y the decrese in the mounts of PUFA fter 24 h incution from the initil PUFA t strt point (0 h) of incution s descried y Jynegr et l. (2011): Biohydrogention (%) = [PUFA(0h) PUFA (24h) PUFA(0h)] 100 PUFA (0 h): concentrtion (g/100g of ftty cid) of PUFA t 0 h incution; PUFA (24 h): concentrtion (g/100g of FA) of PUFA t 24 h of incution. Concentrtions of mmoni were determined with the colorimetric method descried y Solorzno, (1969), sed on the stndrd curve of mmonium sulfte stndrd solution, nd its reltion to the intensity of colour produced in the smples. The intensity of developed colour ws determined y mesuring opticl density of smples t 420 nm using spectrophotometer (Spectro UV Vis Auto, Lomed Inc., Culver City, Clif, USA). One nd hlf millilitres of ech rumen fluid smple were used for solute microil quntifiction using rel-time polymerse chin rection. Totl DNA ws extrcted from ech smple with the QIA mp DNA Stool Mini Kit (Qigen Inc., Vlenci, Clif, USA) ccording to the mnufcturer s instructions. The extrcted DNAs were stored t -20 C until used. The quntifiction ssy ws sed on the stndrd curve method. To prepre the stndrd curves, numers of copies of the trget genes were plotted ginst quntifiction cycle (Cq). The Cq vlues were otined from tenfold seril dilutions of PCR products from plsmid DNA of ech trget microil group (totl cteri, totl methnogens, totl protozo or Butyrivirio firisolvens). Specific primers for ech group of trget microorgnisms, indicted in Tle 1, were used to mplify trget genes using conventionl PCR. The PCR rection properties hve een descried y Fseleh Jhromi et l. (2013). The PCR products of the trget microorgnisms were run in 1% (w/v) grose gel, nd specific nds were purified using the MEGAquick-spin TM purifiction kit (intron Biotechnology, Kore). The purified PCR products were then cloned into the PCR 2.1 TOPO vector using PCR 2.1 TOPO TA Cloning Kit (Invitrogen Ltd., USA) ccording
4 422 Shokryzdn et l., S. Afr. J. Anim. Sci. vol. 46 to the mnufcturer s instructions. The purity nd concentrtion of plsmid DNA in ech smple were mesured with Nnodrop ND-1000 spectrophotometer (Implen NnoPhotometer TM, Germny). The numer of copies of the plsmid DNA per ml of elution uffer ws clculted with this formul, which is ville online ( Numer of copies = Amount of DNA (μg/ml) / Length (p) Primers used to quntify the popultion of vrious groups of microorgnisms re the sme s those used to mplify trget genes for stndrd curve preprtion (Tle 1). Rel-time PCR ws performed with the BioRd CFX96 Touch (BioRd, USA) using opticl grde pltes. The PCR rection ws performed on totl volume of 25 μl using the iqtmsybr Green Supermix (BioRd, USA). Ech rection consisted of 12.5 μl SYBR Green Supermix, 1 μl forwrd primer, 1 μl reverse primer, 2 μl DNA smples, nd 8.5 μl nuclesefree wter. No-templte control ws included in the rel-time PCR mplifiction to rule out crosscontmintion. These rection conditions were pplied: n initil 5-min denturtion t 94 ºC, followed y 40 cycles of denturtion t 94 ºC for 20 s, primer nneling (nneling tempertures for primers re descried in Tle 1) for 30 s, nd extension t 72 C for 20 s (Nvidshd et l., 2012). To confirm the specificity of mplifiction; melting curve nlysis ws crried out fter the lst cycle of ech mplifiction; nd PCR products were verified on 1% (w/v) grose gel tht runs for 40 min t 80 V. The expected sizes of mplified frgments were presented in Tle 1. The mplifiction efficiency ws clculted using the following eqution: E (%) = (10 1/slope 1) 100 In this eqution, E is 100% if tenfold dilution of DNA templte results in Cq difference of Only the dt generted from rections with efficiency etween 90 nd 110% were used for further nlysis. Tle 1 Sequences, product size nd nneling temperture for specific primers of the trget groups of microes Trget group R/F Sequence (5 to 3 ) Product size (p) Anneling temperture (ºC) Totl cteri Totl protozo Totl methnogens Butyrivirio firisolvens R F R F R F R F CCATTGTAGCACGTGTGTAGCC CGGCAACGAGCGCAACCC GCTTTCGWTGGTAGTGTATT CTTGCCCTCYAATCGTWCT CGGTCTTGCCCAGCTCTTATTC CCGGAGATGGAACCTGAGAC CCA ACA CCT AGT ATT CAT C GYG AAG AAG TAT TTC GGT AT All the experiments were crried out twice, ech tretment in triplicte. Sttisticl nlysis of experimentl dt ws performed y the one-wy nlysis of vrince (one-wy ANOVA) procedure of Sttisticl Anlysis System (SAS, 2008) version 9.2. Significntly different mens were then further differentited with Duncn s multiple rnge test procedure. The results re presented s men ± stndrd error of the mens. Differences etween mens with P <0.05 were regrded s eing sttisticlly different. Results of microil quntifiction re presented s log 10 of copy numer/ml. Results In the present study, the totl mounts of condensed tnnin nd sponin of MP were determined s nd % of DM, respectively. Figure 1 shows the effect of MP on the totl volume (ml) of gs production. There ws no significnt difference etween the tretment groups in terms of the mount of gs produced t ny reding time-point, lthough the control group produced numericlly higher mounts of gs thn the MMP nd HMP groups. Similrly, there ws no significnt difference etween the tretment groups in terms of the rte (ml/h) of in
5 Rte of gs production (ml/h) (ml) Shokryzdn et l., S. Afr. J. Anim. Sci. vol vitro gs production fter 24 h incution (Figure 2). The control nd HMP group showed numericlly the highest (1.2 ml/h) nd lowest (0.8 ml/h) rtes of gs production, respectively. Figure 3 shows the effect of MP on in vitro methne production fter 24 h of incution. Results show higher (P <0.05) methne production for the control group (19.9 ml methne/g DM) thn the two groups contining MP, nmely MMP (18.3 ml methne/g DM) nd HPM (18.2 ml methne/g DM). In ddition, the results showed tht MP reduced (P <0.05) the mounts of produced methne per unit of totl gs production (0.08 ± 0.01 nd 0.08 ± 0.00 for the MMP nd HMP groups, respectively, in comprison with 0.09 ± 0.01 for control group; dt not shown) Incution time (h) CON MMP HMP Figure 1 Effect of MP on the volume (ml) of in vitro gs production CON: 50% concentrte + 50% lflf without MP; MMP: 50% concentrte + 25% lflf + 25% MP; HMP: 50% concentrte + 50% MP CON MMP HMP Figure 2 Effect of MP on the rte (ml/h) of in vitro gs production CON: 50% concentrte + 50% lflf without MP; MMP: 50% concentrte + 25% lflf + 25% MP; HMP: 50% concentrte + 50% MP. Different letters denote significnt differences t P <0.05. Error r =1 SE
6 ml methne/g dry mtter 424 Shokryzdn et l., S. Afr. J. Anim. Sci. vol CON MMP HMP Figure 3 Effect of MP on in vitro methne production fter 24 h incution CON: 50% concentrte + 50% lflf without MP; MMP: 50% concentrte + 25% lflf + 25% MP; HMP: 50% concentrte + 50% MP. Different letters denote significnt differences t P <0.05. Error r =1 SE The mounts of VFA rnged from 83.1 to 91.1 mm/ml. There ws no significnt difference in terms of production of the three mesured VFAs (cetic, propionic nd utyric cids), cette/propionte rtio, nd mounts of methne per unit of VFA production mong the three tretment groups. However, the production of cetic cid ws numericlly higher for oth groups contining MP compred with the control group. However, for propionic nd utyric cid production, the control group showed numericlly higher mounts thn the two groups with MP. Tle 2 shows the results of in vitro mmoni production fter 24 h of incution. The mmoni production in the rumen fluid smples did not show ny significnt difference mong the three tretment groups, nd rnged from 3.68 to 3.83 ppm/ml. Hence, MP hd no effect on mmoni production. Results of chnges in the ph of rumen fluid from the use of MP re presented in Tle 3. The ph of rumen fluid, which rnged from 7.20 to 7.22, did not show ny significnt difference mong the three tretment groups. Tle 2 Effect of MP (men ± SE; n=6) on in vitro ruminl fermenttion fter 24 h of incution Prmeter Tretment Control MMP HMP Rumen ph 7.21 ± ± ± 0.01 Ammoni 3.79 ± ± ± 0.05 Totl VFA (mm/ml) ± ± ± 3.76 Acetic (%) ± ± ± 0.26 Propionic (%) ± ± ± 0.41 Butyric (%) ± ± ± 0.56 Acetic/propionic 2.20 ± ± ± 0.04 Methne/VFA (ml/mm) 0.24 ± ± ± 0.01 VFA: voltile ftty cid; CON: 50% concentrte + 50% lflf without MP; MMP: 50% concentrte + 25% lflf + 25% MP; HMP: 50% concentrte + 50% MP Tle 3 shows the percentge of iohydrogention of oleic cid (C18:1n-9), linoleic cid (C18:2n-6), α-linolenic cid (C18:3n-3) nd totl UFA, percentge of production of vccenic cid (C18:1 t11), c9,t11 conjugted linoleic cid nd t10,c12 conjugted linoleic cid (CLA) t 24 h of incution. Bsed on the results, the rnge of iohydrogention ws from 47.2 % to 64.6 %. Although the iohydrogention of oleic cid (C18:1n-9) did not show ny difference (P >0.05) mong the three tretment groups, MP in oth levels (25% in MMP group nd 50% in HMP group) reduced (P <0.05) the iohydrogention of linoleic cid
7 Shokryzdn et l., S. Afr. J. Anim. Sci. vol (C18:2n-6), α-linolenic cid (C18:3n-3) nd the totl UFA (C18). The mounts of vccenic cid (C18:1 t11) production were different (P <0.05) mong the three tretment groups. Production of the two isomers of CLA, c9,t11 nd t10,c12, which re derivtives of linoleic cid, did not show ny difference (P >0.05). Tle 3 Percentge (%) of iohydrogention nd production of ftty cids fter 24 h incution (men ± SE; n = 6) Ftty cid Tretment Control MMP HMP Biohydrogention Oleic cid (C18:1n-9) ± ± ± 1.24 Linoleic cid (C18:2n-6) 64.6 ± ± ± 2.24 α-linolenic cid (C18:3n-3) 56.3 ± ± ± 2.68 Totl unsturted ftty cids (C18) 63.1 ± ± ± 1.29 Production Vccenic cid (C18:1 t11) 17.7 c ± ± ± 2.14 c9,t11 conjugted linoleic cid 4.1 ± ± ± 0.26 t10,c12 conjugted linoleic cid 4.3 ± ± ± c Row mens with different superscripts differ significntly t P <0.05 CON: 50% concentrte + 50% lflf without MP; MMP: 50% concentrte + 25% lflf + 25% MP; HMP: 50% concentrte + 50% MP Figure 4 shows the results of the microil quntifiction ssy. The high level (50%) of MP reduced (P <0.05) the popultion of totl protozo nd totl cteri in comprison with the MMP nd control groups. The MMP nd control groups did not show ny significnt difference in terms of popultion of totl protozo nd totl cteri. The popultion of totl methnogens ws reduced (P <0.05) in the two tretment groups contining MP compred with the control group. However, there ws no significnt difference etween the popultions of totl methnogens in the MMP nd HMP groups. The popultion of Butyrivirio firisolvens ws in the order of CON > MMP > HMP, with significnt difference (P <0.05) etween HMP nd CON. Discussion The rumen contins millions of microes, nmely cteri, protozo nd fungi. Interction of these microes in the rumen environment provides the ruminnt with the ility to digest cellulose nd crohydrte to simple sugrs nd VFA, which cn e used y the host (Frndson et l., 2009), nd produces certin components, such s cron dioxide, methne nd mmoni (Hoson, 1997). Any chnge in the rumen environment, which could e ecuse of chnges in the diet, might cuse n ltertion in the popultion of the rumen resident microes, which would led to chnge in the mounts of fermenttion endproducts. Among these end-products, methne is one of the most importnt, nd hs een studied extensively. According to the US Environmentl Protection Agency (2007), ruminnts produce huge volumes (out 80) of methne every yer. Methne is considered hrmful product, not only ecuse it is greenhouse gs, ut ecuse it is responsile for losing some prt (11 % to 13 %) of digestile energy (McDonld et l., 2002). Hence, there is continued reserch to find wys of mitigting methne production in ruminnts without ffecting VFA production. After the n on the usge of ntiiotics in livestock feeds y the Europen Union (OJEU, 2003) ecuse of incresing risk of pssing on ntiiotic resistnce to humn pthogens, plnt extrcts nd plnt secondry metolites, such s essentil oils, tnnins, sponins nd flvonoids, to improve livestock productivity, hs een regrded s nturl lterntives to ntiiotics (Cieslk et l., 2012). This strtegy ws lso intended to reduce environment pollutnts, including lowering methne production y ruminnts, nd decrese phosphorus nd nitrogen in mnure (Mkkr et l., 2009).
8 Log10 cell/ml Log10 cell/ml Log10 cell/ml Log10 cell/ml 426 Shokryzdn et l., S. Afr. J. Anim. Sci. vol Totl cteri CON MMP HMP Totl protozo CON MMP HMP A B 5.8 Totl methnogens C CON MMP HMP Butyrivirio firisolvens D CON MMP HMP Figure 4 Effects of MP on the popultions of totl cteri (A), totl protozo (B), totl methnogens (C) nd Butyrivirio firisolvens (D) fter 24 h incution CON: 50% concentrte + 50% lflf without MP; MMP: 50% concentrte + 25% lflf + 25% MP; HMP: 50% concentrte + 50% MP. Different letters denote significnt difference t P <0.05. Error r = 1 SE
9 Shokryzdn et l., S. Afr. J. Anim. Sci. vol As stted, the mngosteen (Grcini mngostn), which contins secondry metolites such s tnnins nd sponins, cn ffect rumen fermenttion nd methne production. Since mngosteen production is extensive, leding to high vilility of the fruit in Mlysi, mngosteen peel cn e regrded s potentil feed source or feed supplement for ruminnts. In the present study, MP ws compred with lflf to evlute its effects on in vitro ruminl prmeters, such s totl gs, methne, VFA nd mmoni production, nd iohydrogention of ftty cids, ph nd microil popultion of rumen fluid in vitro. Bsed on the results, lthough MP hd no significnt effect on totl gs production, it reduced the totl produced gs numericlly. Besides, MP hd no dverse effect on the ph of rumen fluid nd VFA production. VFA production in the rumen depends on the ville sustrtes nd the microil popultion of the rumen (Szumcher-Strel & Cieslk, 2012). In norml ruminl fermenttion process, the gs produced is directly correlted to the level of VFA produced. However, in the present study, the reduction of totl gs nd the rte of gs production in the tretments contining MP, without decresing the level of VFA produced, indicted tht the fermenttion kinetics hd een shifted towrds more VFA production thn the tht of gses such s methne, hydrogen nd cron dioxide. The reduced methne production (Figure 3) cn e ttriuted to the lowered effect of the secondry metolites of MP, such s sponins nd condensed tnnins on methne production. These results confirmed those of Animut et l. (2008), Tn et l. (2011) nd Cieslk et l. (2012), who showed reduced methne emissions with tnnin inclusion in cows with rumen cnnul, rumen fistulted cttle, nd gots fed incresing levels of Koe lespedez. In ddition, the current results gree with those of Theodoridou et l. (2011), who incuted Sinfoin (contining condensed tnnins) with uffered rumen fluid for 3.5 h nd 24 h nd oserved no effect on VFA production y tnnins. Cieslk et l. (2012), who supplemented Vccinium vitiside (contining 2 g of tnnins/kg dietry DM) in the diet of cows, reported tht tnnins did not hve ny significnt effect on the VFA production. This could e ecuse of the dpttion of rumen microorgnisms to the tnnins (Ptr & Sxen, 2011). However, nother study y Hssnt & Benchr (2013), using vrious sources nd concentrtions of tnnins on rumen microil fermenttion in vitro, showed tht gs nd totl VFA production decresed s tnnin concentrtion incresed. This discrepncy could e owing to the usge of vrious types of tnnins, ecuse in the results otined y Hssnt nd Benchr (2013), tnnins from Vlone were the only tnnin source tht reduced methne production without ffecting VFA concentrtion. It hs een reported tht sponins nd condensed tnnins my reduce methne production y decresing the methnogen popultions through reduction in the numers of protozo, nd lowering methnogenesis ctivity of protozo ssocited methnogens (Hess et l., 2003; Guo et l., 2008; Tn et l., 2011). In ddition, Tvendle et l. (2005) proposed tht condensed tnnins reduce methne emissions from ruminnts directly y inhiiting the growth of methnogens, nd indirectly y reducing fire digestion which decreses hydrogen production. Since the suppressing effect of secondry metolites on the ruminl protozo nd methnogens hve een lredy reported, the effects of MP on methne production in the current study could e similr to those oserved in these reports. To confirm this, the present study oserved decresed in the popultion of totl methnogens (Figure 4). Besides, MP reduced the popultion of totl protozo in the tretment group contining high level (50%) of MP compred with the control group. These results confirm the effect of secondry metolites of MP on the popultion of rumen protozo nd methnogens. This is consistent with the results of Animut et l. (2008), who showed tht incresed levels of tnnins (50, 101, 151 g/kg DM) in got diets lowered the popultion of rumen protozo. In nother study, Cieslk et l. (2012) reported nti-protozol effects of tnnins (2 g tnnins/kg dietry DM) in cows. However, in their experiment (Cieslk et l 2012), tnnin hd no significnt effect on the popultions of totl cteri nd methnogens, wheres in the present study, the popultions of totl cteri nd totl methnogens were reduced y using 50 % MP. This discrepncy could e ttriuted to the types of tnnins, their origin nd supplementtion levels (Ptr & Sxen, 2011). Sponin, secondry metolite, hs een reported to ffect ruminl conditions. Hess et l. (2003), who compred three sponin-rich tropicl fruits (Spindus sponri, Enteroloium cyclocrpum nd Pithecelloium smn) reported tht only S. sponri significntly lowered protozol popultion nd methne production, without ffecting the popultion of methnogens, in comprison with the control group. In nother study (Guo et l., 2008), the ddition of sponins extrcted from te seeds significntly decresed methne production during ruminl fermenttion. It lso reduced the popultion of protozo, ut not methnogens. In the present study, the popultion of Butyrivirio firisolvens, which re responsile for ruminl iohydrogention, decresed numericlly nd significntly in the MMP nd HMP groups, respectively, in comprison with the control group, which my e result of reduced hydrogen production. However, the mounts of hydrogen produced were not determined in the present study. The reduction in the popultion of Butyrivirio firisolvens proly cused decrese in iohydrogention of linoleic cid (C18:2n-6), α-linolenic cid (C18:3n-3) nd totl UFA (C18). This result
10 428 Shokryzdn et l., S. Afr. J. Anim. Sci. vol. 46 suggests tht MP hs the potentil to prevent the sturtion of UFA nd thus increse the presence of UFA in the ruminnt met. To the est of the uthors knowledge, this is the first report on the effect of mngosteen peel on rumen iohydrogention. Biohydrogention in the rumen cuses production of CLA isomers nd vccenic cid (C18:1 t11). The c9,t11 isomer of CLA, known s rumenic cid (RA), is the min isomer of CLA in products derived from ruminnts. It is considered to hve mny potentil humn helth-promoting effects (Priz et l., 2001). RA cn e produced y desturting vccenic cid in the mmmry glnd nd other tissues. However, it is produced minly in the rumen through iohydrogention of dietry linoleic cid (C18:2n-6) y rumen microorgnisms, especilly Butyrivirio firisolvens The RA is then reduced to vccenic cid nd fter tht to steric cid (C18:0) (Plmquist et l., 2005). Accumultion of vccenic cid in the rumen hs een considered mens to increse the content of CLA in ruminnt products(priz et l., 2001; Plmquist et l., 2005). Inhiition of the rumen iohydrogention of vccenic cid to steric cid leds to ccumultion of vccenic cid in the rumen. Recent studies hve reported tht this step of rumen iohydrogention could e inhiited with tnnins (Khios-Ard et l., 2009; Vst et l., 2009; Vst et l., 2009). However, reports on the effects of tnnins on rumen iohydrogention re few nd controversil. For instnce, in vitro experiments (Khios-Ard et l., 2009; Vst et l., 2009) indicte positive effects of tnnins on rumen vccenic cid ccumultion, ut in vivo studies suggest tht tnnins hve negtive effects or none (Benchr & Chouinrd, 2009; Ciddu et l., 2009; Vst et l., 2009). In the present study, lthough the mounts of vccenic cid significntly incresed y rising the levels of MP, which indicted inhiition of iohydrogention of vccenic cid to steric cid (C18:0), there were no significnt differences mong the three tretment groups in terms of the mounts of CLA isomers produced. The ph of rumen fluid is good indictor of overll rumen function (Ky, 1983). The ph of rumen cn rnge from out 8 to less thn 5, sed on the diet fed to ruminnts. Lower ph vlues re normlly oserved in nimls receiving concentrte diets (Slyter et l., 1964; Cerrto-Sánchez et l., 2008). Rumen microflor is sensitive to the rumen ph (Istsse et l., 1986). Therefore, ny chnge in rumen ph my led to huge impct on ruminl microil composition nd the digestive functions (Orskov, 2012). At lower ph, VFA production is often reduced nd cetic cid ccumultion is incresed (Dunlop & Hmmond, 1965). In the present study, the MP hd no dverse effect on ph of rumen fluid nd VFA production. Ammoni results from mino cid demintion in the rumen, nd tnnins cn ind to the proteins in the rumen nd form insolule complexes, nd therefore reduce protein degrdtion, nd decrese mmoni production in rumen fluid (Ptr & Sxen, 2011). This would decrese nitrogen excretion in urine (Crull et l., 2005), which is responsile for emissions of nitrous oxide, potent greenhouse gs. Reduction of mmoni production y tnnins hve een reported for exmple y Hssnt nd Benchr (2013), who showed tht tnnin tretments reduced mmoni concentrtions, indicting reduction in ruminl protein degrdtion. However, in the present study, MP hd no significnt effect on mmoni production. This my e ecuse different plnt sources provide different types, structure nd concentrtion of secondry metolites. Conclusion In terms of totl gs nd VFA production, MP ws comprle with lflf, with the dvntge tht MP cn reduce gs production numericlly per unit of VFA produced. In ddition, MP reduced methne production, possily y lowering the popultions of totl protozo nd totl methnogens in comprison with lflf. Furthermore, MP reduced the percentge of iohydrogention of UFA, proly y decresing the popultion of Butyrivirio firisolvens in comprison with lflf. Hence, the results suggest tht the MP hs gret potentil to e used in niml feed to reduce ruminl methne production nd iohydrogention, without dverse effects on ruminl ph nd VFA production. The effects of MP on ruminl prmeters of vrious ruminnt hosts in vivo needs to e investigted in future. Acknowledgements The uthors re grteful to the Fculty of Veterinry Medicine nd Institute of Tropicl Agriculture, Universiti Putr Mlysi. This reserch ws supported y Mlysin Government E-Science Grnt No SF0200. Authors Contriutions PS, MAR, YMG, II, MFR, ME nd MFJ designed nd crried out the studies, performed the sttisticl nlysis, interpreted the results nd drfted the mnuscript. MAR, ME nd PS supervised the study, designed the experiments nd drfted the mnuscript. MFJ, II, MFR, PS nd
11 Shokryzdn et l., S. Afr. J. Anim. Sci. vol ME prticipted in the iochemicl nd microil dt nlysis. ME, II nd MFR crried out the in vitro experiment. ME nd YMG performed the investigtion of ftty cid chnges nd sttisticl nlysis. All uthors red nd pproved the finl mnuscript. Conflict of Interest Declrtion Authors declre tht there is no conflict of interest for this study. References Animut, G., Puchl, R., Goetsch, A., Ptr, A., Shlu, T., Vrel, V. & Wells, J., Methne emission y gots consuming diets with different levels of condensed tnnins from lespedez. Anim. Feed Sci. Tech. 144, Benchr, C. & Chouinrd, P., Assessment of the potentil of cinnmldehyde, condensed tnnins, nd sponins to modify milk ftty cid composition of diry cows. J. Diry Sci. 92, Bhtt, R., Mlik, P.K. & Prsd, C.S., Enteric Methne Emission: sttus, mitigtion nd future chllenges n Indin perspective. In: Livestock Production nd Climte Chnge. Eds Mlik, P.K., Bhtt, R., Tkhshi, J., Kohn, R. & Prsd, C.S., CABI Interntionl, pp Buccioni, A., Cppucci, A. & Mele, M., Methne emission from enteric fermenttion: methnogenesis nd fermenttion. In: Climte Chnge Impct on Livestock: Adpttion nd Mitigtion. Eds Sejin, V., Gughn, J., Bumgrd, L. & Prsd, C., Springer Indi, pp Ciddu, A., Molle, G., Decndi, M., Spd, S., Fiori, M., Piredd, G. & Addis, M., Responses to condensed tnnins of flowering sull (Hedysrum coronrium L.) grzed y diry sheep: Prt 2: Effects on milk ftty cid profile. Livest. Sci. 123, Crull, J., Kreuzer, M., Mchmüller, A. & Hess, H., Supplementtion of Acci mernsii tnnins decreses methnogenesis nd urinry nitrogen in forge-fed sheep. Crop Psture Sci. 56, Cerrto-Sánchez, M., Clsmigli, S. & Ferret, A., Effect of the mgnitude of the decrese of rumen ph on rumen fermenttion in dul-flow continuous culture system. J. Anim. Sci. 86, Cieslk, A., Zmor, P., Pers-Kmczyc, E. & Szumcher-Strel, M., Effects of tnnins source (Vccinium vitis ide L.) on rumen microil fermenttion in vivo. Anim. Feed Sci. Tech. 176, Crutzen, P.J., Aselmnn, I. & Seiler, W., Methne production y domestic nimls, wild ruminnts, other herivorous fun, nd humns. Tellus B. 38, Dunlop, R.H. & Hmmond, P.B., D-Lctic cidosis of ruminnts. Ann. N. Y. Acd. Sci. 119, Erhimi, M., Rjion, M., Goh, Y. & Szili, A., Impct of different inclusion levels of oil plm (Eleis guineensis Jcq.) fronds on ftty cid profiles of got muscles. J. Anim. Physiol. Anim. Nutr. 96, ˇErhimi, M., Rjion, M.A., Goh, Y.M., Frjm, A.S., Szili, A.Q. & Schonewille, J.T., The effects of dding lctic cid cteri nd cellulse in oil plm (Elis guineensis Jcq.) frond silges on fermenttion qulity, chemicl composition nd in vitro digestiility. Itl. J. Anim. Sci. 13, Erhimi, M., Rjion, M.A., Goh, Y.M., Shokryzdn, P., Awis, Q.S. & Jhromi, M.F., Feeding oil plm (Eleis guineensis, Jcq.) fronds lters rumen protozol popultion nd ruminl fermenttion pttern in gots Itl. J. Anim. Sci. 14, FAO, Greenhouse gs emissions from the diry sector. Food nd Agriculture Orgniztion. Fseleh Jhromi, M., Ling, J.B., Mohmd, R., Goh, Y.M., Shokryzdn, P. & Ho, Y.W., Lovsttinenriched rice strw enhnces iomss qulity nd suppresses ruminl methnogenesis. Biomed Res. Int. [seril online]. Aville from Fievez, V., Byemi, O. & Demeyer, D., Estimtion of direct nd indirect gs production in syringes: A tool to estimte short chin ftty cid production tht requires miniml lortory fcilities. Anim. Feed Sci. Tech. 123, Folch, J., Lees, M. & Slone-Stnley, G.H., A simple method for the isoltion nd purifiction of totl lipids from niml tissues. J. Biol. Chem. 226, Frndson, R.D., Wilke, W.L. & Fils, A.D. 2009: Antomy nd physiology of frm nimls. John Wiley & Sons, Colordo, USA. Getchew, G., Mkkr, H. & Becker, K., Tnnins in tropicl rowses: Effects on in vitro microil fermenttion nd microil protein synthesis in medi contining different mounts of nitrogen. J. Agr. Food Chem. 48,
12 430 Shokryzdn et l., S. Afr. J. Anim. Sci. vol. 46 Guo, Y., Liu, J.X., Lu, Y., Zhu, W., Denmn, S. & McSweeney, C., Effect of te sponin on methnogenesis, microil community structure nd expression of mcra gene, in cultures of rumen micro orgnisms. Lett. Appl. Microiol. 47, Hssnt, F. & Benchr, C., Assessment of the effect of condensed (cci nd quercho) nd hydrolysle (chestnut nd vlone) tnnins on rumen fermenttion nd methne production in vitro. J. Sci. Food Agr. 93, Hess, H.D., Kreuzer, M., Dız, T.E., Lscno, C.E., Crull, J.E., Soliv, C.R. & Mchmüller, A., Sponin rich tropicl fruits ffect fermenttion nd methnogenesis in funted nd defunted rumen fluid. Anim. Feed Sci. Tech. 109, Hoson, P.N. (1997): The Rumen Microil Ecosystem. Chpmn nd Hll, London, UK. Istsse, L., Reid, G., Tit, C. & Orskov, E., Concentrtes for diry cows: effects of feeding method, proportion in diet nd type. Anim. Feed Sci. Tech. 15, Jynegr, A., Goel, G., Mkkr, H.P.S. & Becker, K Reduction in methne emissions from ruminnts y plnt secondry metolites: effects of polyphenols nd sponins, In: Odongo N.E., M. grci & G.J. Viljoen (ed.) Sustinle improvement of niml production nd helth. Food nd Agriculture Orgniztion, Rome, Itly, Jynegr, A., Kreuzer, M., Win, E. & Leier, F., Significnce of phenolic compounds in tropicl forges for the ruminl ypss of polyunsturted ftty cids nd the ppernce of iohydrogention intermedites s exmined in vitro. Animl Production Science. 51, Ky, R., Rumen function nd physiology. Vet. Rec. 113, 6 9. Khios-Ard, R., Bryner, S., Scheeder, M., Wettstein, H.-R., Leier, F., Kreuzer, M. & Soliv, C., Evidence for the inhiition of the terminl step of ruminl α-linolenic cid iohydrogention y condensed tnnins. J. Diry Sci. 92, Lu, C.D. & Jorgensen, N.A., Alflf sponins ffect site nd extent of nutrient digestion in ruminnts. J. Nutr. 117, Mkkr, H., Norvsmuu, T., Lkhgvtseren, S. & Becker, K., Plnt secondry metolites in some medicinl plnts of Mongoli used for enhncing niml helth nd production. Tropicultur. 27, Mkkr, H.P.S., Siddhurju, S., Siddhurju, P. & Becker, K. 200: Plnt secondry metolites. Humn Press: Totow, New Jersey, USA, McDonld, P., Edwrds, R.A., Greenhlgh, J.F.D. & Morgn, C.A. 2002: Animl nutrition. Person Eduction Ltd, Hrlow, UK. Morimoto, K.C., Vn Eenennm, A.L., DePeters, E.J. & Medrno, J.F., Hot topic: Endogenous production of n-3 nd n 6 ftty cids in mmmlin cells. J. Diry Sci. 88, Nvidshd, B., Ling, J.B. & Jhromi, M.F., Correltion coefficients etween different methods of expressing cteril quntifiction using rel-time PCR. Int. J. Mol. Sci. 13, Ngmseng, A. & Wnpt, M., Effects of mngosteen peel (Grcini mngostn) supplementtion on rumen ecology, microil protein synthesis, digestiility nd voluntry feed intke in eef steers. OJEU, Regultion (EC) No. 1831/2003 of Europen Prliment nd the Council of 22 Septemer 2003 on dditives for use in niml nutrition. Off. J. Eur. Union. Pge L268/36 in OJEU of 10/18/2003. Brussels, Belgium. Orskov, E.R. (2012): Energy nutrition in ruminnts. Springer Science & Business Medi, New York, USA. Plmquist, D.L., Lock, A.L., Shingfield, K.J. & Bumn, D.E., Biosynthesis of conjugted linoleic cid in ruminnts nd humns. Adv Food Nutr Res. 50, Priz, M.W., Prk, Y. & Cook, M.E., The iologiclly ctive isomers of conjugted linoleic cid. Prog. Lipid Res. 40, Ptr, A.K. & Sxen, J., Exploittion of dietry tnnins to improve rumen metolism nd ruminnt nutrition. J. Sci. Food Agr. 91, Porter, L.J., Hrstich, L.N. & Chn, B.G., The conversion of procynidins nd prodelphinidins to cynidin nd delphinidin. Phytochemistry. 25, Rjion, M.A., McLen, J.G. & Chill, R.N.P., Essentil ftty cids in the fetl nd neworn lm. Aust. J. Biol. Sci. 38, Rjion, M., Goh, Y., Dhln, I. & Slm Adullh, A., Dietry mnipultion nd increse in plsm unsturted ftty cids in sheep. Asin Austrls. J. Anim. Sci. 14, SAS, Sttisticl Anlysis System. SAS online documenttion 9.2. SAS Institute Incorportion. Slyter, L., Nelson, W. & Wolin, M., Modifictions of device for mintennce of the rumen microil popultion in continuous culture. Appl. Microiol. 12,
13 Shokryzdn et l., S. Afr. J. Anim. Sci. vol Solorzno, L., Determintion of mmoni in nturl wters y the phenolhypochlorite method. Limnol. Ocenogr. 14, Szumcher-Strel, M. & Cieslk, A Dietry possiilities to mitigte rumen methne nd mmoni production, In: Liu G. (ed.) Greenhouse Gses Cpturing, Utiliztion nd Reduction. Intech, Rijek, Croti. Intech, Rijek, Croti, Tn, H.Y., Sieo, C.C., Adullh, N., Ling, J.B., Hung, X.D. & Ho, Y.W., Effects of condensed tnnins from Leucen on methne production, rumen fermenttion nd popultions of methnogens nd protozo in vitro. Anim. Feed Sci. Tech. 169, Tvendle, M.H., Megher, L.P., Pcheco, D., Wlker, N., Attwood, G.T. & Sivkumrn, S., Methne production from in vitro rumen incutions with Lotus peduncultus nd Medicgo stiv, nd effects of extrctle condensed tnnin frctions on methnogenesis. Anim. Feed Sci. Tech. 123, Theodoridou, K., Aufrère, J., Niderkorn, V., Anduez, D., Le Morvn, A., Picrd, F. & Bumont, R., In vitro study of the effects of condensed tnnins in sinfoin on the digestive process in the rumen t two vegettion cycles. Anim. Feed Sci. Tech. 170, US Environmentl Protection Agency, Ruminnt livestock. How much methne is produced y livestock. Vst, V., Mkkr, H.P.S., Mele, M. & Priolo, A., Ruminl iohydrogention s ffected y tnnins in vitro. Brit. J. Nutr. 102, Vst, V., Mele, M., Serr, A., Scerr, M., Lucino, G., Lnz, M. & Priolo, A., Metolic fte of ftty cids involved in ruminl iohydrogention in sheep fed concentrte or herge with or without tnnins. J. Anim. Sci. 87, Wng, Y., McAllister, T., Ynke, L. & Cheeke, P., Effect of steroidl sponin from Yucc schidiger extrct on ruminl microes. J. Appl. Microiol. 88,
Roughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationEffect of inclusion of Myristica fragrans on methane production, rumen fermentation parameters and methanogens population
Vet. World, 212, Vol.5(6):335-34 RESEARCH Effect of inclusion of Myristic frgrns on methne production, rumen fermenttion prmeters nd methnogens popultion S K Sirohi, P P Chudhry, Nvneet Goel Nutrition
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationIntroduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010
Introduction Lnce Bumgrd Associte Professor Ntive of southwest Minnesot BS: U of Minnesot MS: U of Minnesot Advisor: Brin Crooker Thesis: Effects of genetic selection for milk yield on somtotropin prmeters
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationThe Ever Changing World of Feed Additives in The Poultry Industry
The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of
More informationEffect of Field Pea Replacement and Yucca schidigera extract on weaning transition growth and feedlot performance
Effect of Field Pe Replcement nd Yucc schidiger extrct on wening trnsition growth nd feedlot performnce D.G. Lndblom 1 nd J. Pennington 2 1 Dickinson Reserch Extension Center, Dickinson, ND 2 Dickinson
More informationSoybean Hulls as an Alternative Feed for Horses
Animl Industry Report AS 650 ASL R1931 2004 Soyben Hulls s n Alterntive Feed for Horses Josie Booth Iow Stte University Howrd Tyler Iow Stte University Peggy Miller-Auwerd Iow Stte University Jenette Moore
More informationAOAC Official Method Determination of Isoflavones in Soy and Selected Foods Containing Soy
45.4.14 AOAC Officil Method 2001.10 Determintion of Isoflvones in Soy nd Selected Foods Contining Soy Extrction, Sponifiction, nd Liquid Chromtogrphy First Action 2001 (Applicble to the determintion of
More informationPreliminary investigation of antimicrobial effects of pomegranate (Punica granatum L.) leathery exocarp extract against some serious phytopathogens
Preliminry investigtion of ntimicroil effects of pomegrnte (Punic grntum L.) lethery exocrp extrct ginst some serious phytopthogens Elshfie H.S. 1,*, Skr S.H. 2, Mng S.M. 1, Frisullo S. 3, Cmele I. 1 1
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationProducts for weaners Benzoic acid or the combination of lactic acid and formic acid
Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for
More informationAsian-Aust. J. Anim. Sci. Vol. 22, No. 11 : November 2009
52 Asin-Aust. J. Anim. Sci. Vol. 22, No. : 52-530 Novemer 2009 www.js.info Conjugted Linoleic Acid in Rumen Fluid nd Milk Ft, nd Methne Emission of Lctting Gots Fed Soyen Oil-sed Diet Supplemented with
More informationHPLC Analysis of Six Active Components of Caulis Lonicerae Using a Phenyl-1 Column
HPLC Anlysis of Six Active Components of Culis Lonicere Using Phenyl- Column Xu Qun, Hung Xiongfeng, nd Jeffrey Rohrer Thermo Fisher Scientific Inc., Shnghi, People s Repulic of Chin Thermo Fisher Scientific
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationEffect of adding linseed oil on in vitro gas and methane production and some fermentation characteristics
EUROPEAN ACADEMIC RESEARCH Vol. VI, Issue 1/ April 2018 ISSN 2286-4822 www.eucdemic.org Impct Fctor: 3.4546 (UIF) DRJI Vlue: 5.9 (B+) Effect of dding linseed oil on in vitro gs nd methne production nd
More informationProtein Quality Dynamics During. Grass-Legume Forage
Protein Qulity Dynmics During Wilting nd Preservtion of Grss-Legume Forge Eliset Ndeu 1, Wolfrm Richrdt 2, Michel Murphy 3 nd Horst Auerch 4 1 Swedish University of Agriculturl Sciences, Skr, Sweden 2
More informationINTRODUCTION. Key Words : Forage Oats, Italian Ryegrass, Silage, Additives, Mono- and Di-saccharides
1582 Effect of Additives on the Fermenttion Qulity nd Residul Mono- nd Discchrides Compositions of Forge Ots (Aven stiv L.) nd Itlin Ryegrss (Lolium multiflorum Lm.) Silges To Sho, *, M. Shimojo 1, T.
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationThe study of Forage Quality of Smirnovia iranica In Different phonological stages in sandy areas-case-study: Band-e-Rig-Kashan
BIABAN (Desert Journl), Vol 11, No. 2, 2006. pp. 1-10 1 The study of Forge Qulity of Smirnovi irnic In Different phonologicl stges in sndy res-cse-study: Bnd-e-Rig-Kshn H. Azrnivnd 1*, H. Joneidi 2, M.
More informationSaponin rich tropical fruits affect fermentation and methanogenesis in faunated and defaunated rumen fluid
Animl Feed Science nd Technology 109 (2003) 79 94 Sponin rich tropicl fruits ffect fermenttion nd methnogenesis in funted nd defunted rumen fluid H.D. Hess, M. Kreuzer,, T.E. Díz b, C.E. Lscno c, J.E.
More informationInvasive Pneumococcal Disease Quarterly Report July September 2018
Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.
More informationImplication of fermentable carbohydrates targeting the gut microbiota on conjugated linoleic acid production in high-fat-fed mice
British Journl of Nutrition, pge 1 of 14 q The Authors 213 doi:1.117/s7114513123 Impliction of fermentle crohydrtes trgeting the gut microiot on conjugted linoleic cid production in high-ft-fed mice Céline
More informationEffects of Intraruminal Saliva Flow on Feed Intake in Goats Fed on Alfalfa Hay Cubes
1738 Effects of Intrruminl Sliv Flow on Feed Intke in Gots Fed on Alflf Hy Cues Ktsunori Sungw*, Yoshifumi Nktsu, Yoriko Nishikuo, Tkeshi Ooshiro, Kout Nitou nd Itsuki Ngmine Fculty of Agriculture, University
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationThe Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes
The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationSupplementation and Cooking of Pearl Millet: Changes in Protein Fractions and Sensory Quality
World Journl of Diry & Food Sciences 4 (1): 41-45, 29 ISSN 1817-38X IDOSI Pulictions, 29 Supplementtion nd Cooking of Perl Millet: Chnges in Protein Frctions nd Sensory Qulity Mh A.M. Ali, Adullhi H. El
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationOverview Background production, fermentable
Microes sustinle qufeed resource for the future Liv Torunn Mydlnd, Odd Helge Romrheim, Thor Lndsverk, Anders Skrede nd Mrgreth Øverlnd. Overview Bckground production, fermentle sustrtes, cell growth type
More informationSterolsland the Production of Oospores by Phytophthova cactovum
Journl of Generl Microiology (I972), 72, 321-327 Printed in Gret Britin 321 Sterolslnd the Production of Oospores y Phytophthov cctovum By C. G. ELLIOTT Deprtment of Botny, The University of Glsgow, Glsgow,
More informationNozzi Valentina, Graber Andreas, Mathis Alex, Schmautz Zala, Junge Ranka
Nozzi Vlentin, Grer ndres, Mthis lex, Schmutz Zl, Junge Rnk Interntionl conference quponics reserch mttes Ljuljn, 22-24 Mrch 216 Some nutrients from the quculture effluents re present in insufficient quntities
More informationEffect of integrated use of organic and mineral fertilizer on some quality parameters of maize (Zea mays L.)
Interntionl Journl of Innovtion nd Scientific Reserch ISSN 351-01 Vol. 9 No. Sep. 01, pp. -3 01 Innovtive Spce of Scientific Reserch Journls http://www.ijisr.issr-journls.org/ Effect of integrted use of
More information2012 Small Grain Forage Trial Nitrogen Fertility and Harvest Date
212 Smll Grin Forge Tril Nitrogen Fertility nd Hrvest Dte Dr. Hether Dry, UVM Extension Agronomist Susn Monhn, Eric Cummings, Hnnh Hrwood, nd Roslie Mdden UVM Extension Crops nd Soils Technicins 82-524-651
More informationXII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV
XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies
More informationDetermination of digestibility of almond hull in sheep
Africn Journl of Biotechnology Vol. 10(15), pp. 3022-3026, 11 April, 2011 Avilble online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB10.1631 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationEffect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows
Ksetsrt J. (Nt. Sci.) 37 : 145-149 (2003) Effect of Orl Administrtion of Propylene Glycol on Serum Glucose Concentrtions in Periprturient Diry Cows Theer Rukkwmsuk, Nrongpol Petploi, Ing-orn Preechnvinit,
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationEffects of Dietary Methionine-Supplementation on the General Performance and Economic Value of Rahmani Lambs
Avilble online t www.scinzer.com ISSN 0000-0000 Effects of Dietry Methionine-Supplementtion on the Generl Performnce nd Economic Vlue of Rhmni Lmbs A. S. El-Thwy 1 *, A. M. Ismeil 2, H. A. Ahmed 3 1. Deprtment
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationResearch Article Lovastatin Production by Aspergillusterreus Using Agro-Biomass as Substrate in Solid State Fermentation
indwi Pulishing Corportion Journl of iomedicine nd iotechnology Volume 212, Article ID 196264, 11 pges doi:1.1155/212/196264 Reserch Article Lovsttin Production y Aspergillusterreus Using Agro-iomss s
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More informationThe Journal of Physiology
J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler
More informationEffects of Replacing Concentrate with Soybean Curd Residue Silage on Ruminal Characteristics, Plasma Leucine and Glucose Turnover Rates in Sheep
Journl of Animl Science Advnces Effects of Replcing Concentrte with Soyen Curd Residue Silge on Ruminl Chrcteristics, Plsm Leucine nd Glucose Turnover Rtes in Sheep Hrjnti D. W., Sugwr Y., Al-Mmun M. nd
More informationEnhanced glutathione peroxidases (GPx) activity in young barley seedlings enriched with selenium
Africn Journl of Biotechnology Vol. 10(55), pp. 11483-11487, 21 Septemer, 2011 Aville online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB11.1480 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationUtilization of Celluloses from Pomelo (Citrus grandis) Albedo as Functional Ingredient in Meat Marination
Interntionl Proceedings of Chemicl, Biologicl nd Environmentl Engineering, Vol. 92 (2016) DOI: 10.7763/IPCBEE. 2016. V92. 3 Utiliztion of Celluloses from Pomelo (Citrus grndis) Aledo s Functionl Ingredient
More informationZinc and Boron Fertilization on Concentration and Uptake of Iron and Manganese in the Corn Grain
Journl of Americn Science 2010;6(8) Zinc nd oron Fertiliztion on Concentrtion nd Uptke of Iron nd Mngnese in the Corn Grin Frshid Aref 1 1 Deprtment of Soil Science, Fculty of Agriculture, Islmic Azd University
More informationPerformance of Periparturient Dairy Cows Fed Alfalfa Hay in Total Mixed Ration : A Field Trial in Thailand
Ksetsrt J. (Nt. Sci.) 42 : 11-18 (2008) Performnce of Periprturient Diry Cows Fed Alflf Hy in Totl Mixed Rtion : A Field Tril in Thilnd Theer Rukkwmsuk 1, *, Sunthorn Rungrung 2, Apssr Choothes 1 nd Theo
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationNot for Citation or Publication Without Consent of the Author
Not for Cittion or Puliction Without Consent of the Author AN AUTOMATED SEX PHEROMONE TRAP FOR MONITORING ADULT CM AND OFM AND THE INFLUENCE OF TRAP COLOR ON MOTH AND NON-TARGET CAPTURES Brin L. Lehmn
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationThe Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers
Beef Reserch Report, 2000 Animl Science Reserch Reports 2001 The Effects of High-Oil Corn or Typicl Corn with or without Supplementl Ft on Diet Digestibility in Finishing Steers Crig R. Belknp Iow Stte
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationThe evaluation of metabolizable protein content of some indigenous feedstuffs used in ruminant nutrition
Veterinry World, EISSN: 2231-0916 Aville t www.veterinryworld.org/vol.7/april-2014/14.pdf RESEARCH ARTICLE Open Access The evlution of metolizle protein content of some indigenous feedstuffs used in ruminnt
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationAgilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide
Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationInfluence of Supplemental Dried Whey on Broiler Performance and Cecal Flora
Interntionl Journl of Poultry Science 5 (6): 58-54, 006 ISSN 68-856 Asin Network for Scientific Informtion, 006 Influence of Supplementl Dried Whey on Broiler Performnce nd Cecl Flor H. Kermnshhi nd H.
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationEffect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant
Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform
More informationSession 71 Theatre 5. Session 71 Theatre 6
Session 71 Thetre 5 J. McKinnie-Hill 1, A. Aury 1, T. Hgn 1, L. Frmer 1 nd F. Monhn 2 1 Agri-Food nd Biosciences Institute (AFBI), Food Reserch Brnch, 18 Newforge Lne, Belfst, BT9 5PX, United Kingdom,
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationEffect of processing on in vitro bioaccessibility of phenolics, flavonoids and antioxidant activity of vegetables with/without yoghurt
Effect of processing on in vitro ioccessiility of phenolics, flvonoids nd ntioxidnt ctivity of vegetles with/without yoghurt Assoc. Prof. Dr. Esr ÇAPANOĞLU GÜVEN Deprtment of Food Engineering Istnul Technicl
More informationA comparative study on the extraction of membranebound bilirubin from erythrocyte membranes using various methods
J. Biochem. Biophys. Methods 39 (1999) 39 45 A comprtive study on the extrction of membrnebound bilirubin from erythrocyte membrnes using vrious methods * Sd Tyyb, Mohmmd Kutub Ali Interdisciplinry Biotechnology
More informationScholars Research Library
Aville online t www.scholrsreserchlirry.com Scholrs Reserch Lirry Annls of Biologicl Reserch, 2011, 2 (5) :62-66 (http://scholrsreserchlirry.com/rchive.html) ISSN 0976-12 CODEN (USA): ABRNBW The replcement
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationTHE EFFECT OF DIFFERENT STIMULI ON MEAGRE (Argyrosomus regius) FEEDING BEHAVIOUR.
THE EFFECT OF DIFFERENT STIMULI ON MEGRE (rgyrosomus regius) FEEDING EHVIOUR. Ionnis E. Ppdkis, Nikos Ppndroulkis, lkioni Sfendourki, Veronic Cmporesi 3, Mnolis Vsilkis, Constntinos C. Mylons Institute
More informationScientific research on the biological value of olive oil
Scientific reserch on the biologicl vlue olive oil Cov F.G. Ally M. (ed.). L' économie de l' olivier Pr : CIHEAM Options Méditerrnéennes : Série Etudes; n. 1988-V 1988 pges 149-152 Article vilble on le
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationIbrahim, I. Hamid Animal Production Research Center-Khartoum North, Sudan
Interntionl Journl of Poultry Science 13 (8): 484-488, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 Investigtions into the Addition of Herl Methionine (Phytonin) As Sustitute of Synthetic
More informationEffect of 1-Methylcyclopropene on the Physiology and Yield of Cotton. Derrick Oosterhuis Eduardo Kawakami and Dimitra Loka University of Arkansas
Effect of 1-Methylcyclopropene on the Physiology nd Yield of Cotton Derrick Oosterhuis Edurdo Kwkmi nd Dimitr Lok University of Arknss Cotton Crop Gossypium hirsutum Unique out cotton Perennil grown s
More information3 Results RESULTS Cell growth and segregation in recombinant bioprocesses
RESULTS 3 3 Results In this thesis, yest α-glucosidse produced in E. coli ws used s model system in order to otin more comprehensive knowledge out cell physiology in response to overexpression of heterologous
More informationB. Koven 1*, E. Gisbert 2, O. Nixon 1, I. Meiri-Ashkenazi 1, A. Gaon 1, M.M. Solovyev 3,4, A. Tandler 1, H. Rosenfeld 1
DESIGNING WEANING DIETS BASED ON THE ONTOGENY OF DIGESTIVE TRACT ENZYME ACTIVITY DURING THE CARNIVOROUS-OMNIVOROUS TRANSITION IN GREY MULLET (MUGIL CEPHALUS) JUVENILES B. Koven 1*, E. Gisert 2, O. Nixon
More informationINFLUENCE OF DAILY SUPPLEMENTATION OF CARIB PODS (Ceratonia Siliqua L.) AS POLYPHENOL RICH PLANTS ON RUMEN FERMENTATION AND LAMBS GROWTH PERFORMANCE
Scientific Ppers Series Mngement, Economic Engineering in Agriculture nd Rurl Development INFLUENCE OF DAILY SUPPLEMENTATION OF CARIB PODS (Certoni Siliqu L.) AS POLYPHENOL RICH PLANTS ON RUMEN FERMENTATION
More informationCurrent and New Tools for Controlling Postharvest Decay of Fresh Citrus
Current nd New Tools for Controlling Posthrvest Decy of Fresh Citrus Mrk Ritenour & Jiqi Yn Indin River Reserch nd Eduction Center, Fort Pierce Control Options Prehrvest - No relile replcement yet for
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationEvaluation of Sun and Oven-Dried Broiler Offal Meal as Replacement for Fishmeal in Broiler and Layer Rations
Interntionl Journl of Poultry Science 5 (7): 646-650, 2006 ISSN 1682-8356 Asin Network for Scientific Informtion, 2006 Evlution of Sun nd Oven-Dried Broiler Offl Mel s Replcement for Fishmel in Broiler
More information