The Secretory Response of Rat Peritoneal Mast Cells on Exposure to Mineral Fibers
|
|
|
- Mark Dickerson
- 5 years ago
- Views:
Transcription
1 Supplementary Material The Secretory Response of Rat Peritoneal Mast Cells on Exposure to Mineral Fibers Violetta Borelli, Elisa Trevisan, Vita Francesca and Giuliano Zabucchi Figure S1. Crocidolite characterization by ultrastructural and EDX analysis. The ultrastructural morphology (upper panel) and chemical composition (lower panel) of the mineral fibers is shown. The chemical composition of crocidolite was found compatible with that already reported by other authors (see Material and Method section). The detailed morphological analysis carried out on at least one hundred fibers showed that crocidolite fibers has on the average a length of 9.2 ± 1.5 (SE) (range min max ) μm.
2 Figure S2. Titanium dioxide nanowires characterization by ultrastructural and EDX analysis. The ultrastructural morphology (upper panel) and chemical composition (lower panel) of the mineral fibers is shown. Nanowires were prepared from a mixture of two mineral forms of TiO2, rutile and anatase. The chemical composition TiO2NW was found compatible with that already reported by other authors (see Material and Method section). The detailed morphological analysis carried out on at least one hundred fibers showed that TiO2 NW fibers, has on the average, a length of 2.9 ± 0.5 (SE) (range min max ) μm. S2 of S8
3 S3 of S8 Figure S3. Wollastonite characterization by ultrastructural and EDX analysis. The ultrastructural morphology (upper panel) and chemical composition (lower panel) of the mineral fibers is shown. As expected WOLLA (a Calcium inosilicate) was revealed to be mainly composed of calcium and silicium. The detailed morphological analysis carried out on at least one hundred fibers showed that wollastonite fibers has on the average a length of 4.2 ± 0.79 (SE) (range min max ) μm.
4 S4 of S8 Figure S4. Ultrastructural (SEM) appearance of membrane- covered isolated granules and isolated granule remnants. Membrane covered granules, isolated with mild sonication (see Materials and Methods) are shown in panel a. Granule remnants, isolated by mild 48/80 stimulation (see Materials and Methods) are shown in panel d. Granules were immediately fixed after isolation and processed for ultrastructural analysis. The granule remnants appear similar to the membrane covered counterpart, however a detailed analysis showed that they were larger ( SE m vs SE m p ). 0n panel b and c the adhesion of membrane covered granules (b) and granule remnants (c) to crocidolite fibers is shown respectively. On the average the affinity of membrane covered granules is about 10 fold higher with respect to that shows by granule remnants. Higher magnification analysis showed that membrane covered granules adhere intimately with the fiber (arrowheads in panel e), while granule remnants maintain their round morphology (arrowhead in panel f).
5 S5 of S8 Figure S5. Serial sections of the same RPMC spanning 120 nm in depth. Black arrowheads show that in each picture one cytosol free asbestos fiber is shown in the same site of the cell. a) starting zero level; b) 120 nm deep. Magnifications: bars = 1 µm.
6 S6 of S8 Figure S6. Serial sections of the same RPMC spanning 720 nm in depth. Black arrowheads show that in each picture two cytosol free asbestos fibers are shown in the same cell site. a) starting zero level; b) 360 nm deep; c) 600 nm deep; d) 720 nm deep. Magnifications: bars = 2 μm.
7 Figure S7. Serial sections of the same eosinophil spanning 300 nm in depth. Black arrowheads show that in each picture two cytosol free asbestos fiber in the same site of the cell. a) starting zero level; b) 150 nm; c) 300nm. Magnifications: bars = 2 µm. S7 of S8
8 Figure S8. Effects of the interaction of mineral fibers with pure human enzymes. Human enzymes were incubated for 30 min with mineral fibers (100 µg/ml). The supernatant was obtained by centrifuging the mixture at 250 xg for 15 min at 4 C. a) myeloperoxidasae (MPO) and b) eosinophilperoxidase (EPO). The values reported are the mean + SD of at least five different experiments. The extent of enzyme activity was calculated taking the total enzyme activity present in the no treated samples as 100% (0,116±0,020 for MPO and for EPO; OD/2min of reaction). The statistically significant (p00.05) changes in activity in the samples exposed to mineral fibers vs the baseline value, are indicated by asterisks. Ctrl= starting enzyme activity; CRO= crocidolite exposed enzyme; WOLLA= wollastonite exposed enzyme; TiO2 = TiO2NW exposed enzyme. S8 of S8
Mast Cells. in the brain
Mast Cells in the brain FRANCES K. JOHNSON MCB 5255 SPRING 2015 MAST CELLS - 1. Basic information Produced in bone marrow - myeloid lineage Develop from CD34/CD117 pluripotent progenitor Immature committed
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
Monitoring and assessment of exposure to elongate mineral particles and fibres. Dr Garry Burdett
Monitoring and assessment of exposure to elongate mineral particles and fibres Dr Garry Burdett The Problem The commercial mining and use of asbestos fibre has resulted in widespread early mortality for
Nanoparticles: Conclusions. 1. Nanoparticles are not new. Six messages. -health hazards and risks. Nano-1. Nano-1
Nanoparticles: -health hazards and risks Kaarle Hämeri University of Helsinki/ Finnish Institute of Occupational Health Conclusions There is no evidence on the significant health and environmental risks
Nanoparticles: -health hazards and risks. Nano-1. Kaarle Hämeri University of Helsinki/ Finnish Institute of Occupational Health
Nanoparticles Health hazards and risks, Kaarle Hämeri 8.11.2010 Nano-1 Nanoparticles: -health hazards and risks Kaarle Hämeri University of Helsinki/ Finnish Institute of Occupational Health Conclusions
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
SUPPORTING INFORMATION
SUPPORTING INFORMATION SUPPLEMENTARY FIGURE LEGENDS Fig. S1. Separation of non-dissolved nanoparticles. Tests were conducted on the separation of non-dissolved nanoparticles added in excess to BEGM (A)
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
Supplementary Figure S1
Supplementary Figure S1 12 1 8 6 4 2 1-3 1-2 1-1 1 1 1 1 2 1 3 PF-364422 (µm) U87 (EC 5 = 52.2 ± 8.8 µm) 12 1 8 6 4 2 1-4 1-3 1-2 1-1 1 1 1 1 2 CMPD1 (µm) Primary GM (EC 5 = 1.55 ±.3 µm) U138 (EC 5 = 1.7
Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
Nanopigments For Broad Spectrum Sun Protection. Patricia Aikens NAFTA Technical Services
Nanopigments For Broad Spectrum Sun Protection Patricia Aikens NAFTA Technical Services UV radiation and the skin UV absorbers Nanopigments Titanium dioxide Zinc Oxide Electromagnetic Radiation Longer
Supplementary Material
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2018 Supplementary Material 1 Supplemental Figures Supplemental Figure S1. Mechanical properties
Figure 4.25: SEM Photo of Hyaluronic Acid Specimen, High Load, 22X
Figure 4.25 shows the specimen from test CS18 at a magnification of 22X. Hyaluronic acid, dissolved at a concentration of 0.375 wt.% in buffered saline solution, was the lubricant in this test, with high
Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)
1 Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) Serum IgG1 (a), IgM (b) and IgG2 (c) concentrations in response to papain immediately before primary immunization (day
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Risk assessment of TiO 2 nanoparticles via oral exposure, including toxicokinetic considerations
1 Risk assessment of TiO 2 nanoparticles via oral exposure, including toxicokinetic considerations This presentation Overview main findings Relevance to safety assessment of E171 2 Overview of main findings:
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Drd1a-Cre driven ChR2 expression in the SCN. (a) Low-magnification image of a representative Drd1a-ChR2 coronal brain section (n = 2) showing endogenous tdtomato fluorescence (magenta).
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
A genetically targeted optical sensor to monitor calcium signals in astrocyte processes
A genetically targeted optical sensor to monitor calcium signals in astrocyte processes 1 Eiji Shigetomi, 1 Sebastian Kracun, 2 Michael V. Sofroniew & 1,2 *Baljit S. Khakh Ψ 1 Departments of Physiology
Influenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
Supplementary figure 1
Supplementary figure 1 (A) Quantitative analysis of F-actin signal intensity in NIH3T3 cells treated with PTD4-myc- RBD. NIH3T3 cells were treated with PTD4-myc-RBD as described. Please note the increase
Protease Assay. (Cat. # ) think proteins! think G-Biosciences
389PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Protease Assay (Cat. # 786 028) think proteins! think G-Biosciences www.gbiosciences.com
NAME: OPTION GROUP: WJEC
NAME: OPTION GROUP: WJEC MATHS FOR AS BIOLOGY MAKING SOLUTIONS MATHS COVERED IN THIS BOOKLET ARE: 1. Revision of scientific notation. 2. Molar solutions. 3. Concentrations. 4. Volumes of liquids. 5. Dilutions.
Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
RBM dental implants by CST Process Technical Release September 2012
Page 1 of 7 RBM dental implants by CST Process Technical Release September 2012 Summary Finish Line operates technologically validated RBM (Resorbable Blasting Media) Process, based on its CST (Comprehensive
Supplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
d e f Spatiotemporal quantification of subcellular ATP levels in a single HeLa cell during changes in morphology Supplementary Information
Ca 2+ level (a. u.) Area (a. u.) Normalized distance Normalized distance Center Edge Center Edge Relative ATP level Relative ATP level Supplementary Information Spatiotemporal quantification of subcellular
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Current density profiles for backside-plating configuration cells and the cycle stability curve with and without carbon coating. Current density profiles of
Supplementary Figure 1: Equilibrium binding analyses of the interaction of efgartigimod with human FcRn
SULEMENTARY DATA Supplementary Figure 1: Equilibrium binding analyses of the interaction of with human FcRn using SR. The coupling density of was 275 RU. Human FcRn was injected over the flow cells at
QUARTZ SPLINT. Our fiber expertise is your strength TM.
QUARTZ SPLINT Our fiber expertise is your strength TM www.rtddental.com QUARTZ SPLINT MESH QUARTZ SPLINT MESH has been especially designed for reinforcing acrylic resin dentures. QUARTZ SPLINT is pre-impregnated
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
Understanding the mechanisms of asbestos related diseases
University of Hawai i Cancer Center Understanding the mechanisms of asbestos related diseases Haining Yang, PhD Professor University of Hawai i Cancer Center Marker of exposure: Bilateral pleural plaques
University of Ulsan College of Medicine, Seoul 05505, Republic of Korea.
Nanoparticle-Assisted Transcutaneous Delivery of a Signal Transducer and Activator of Transcription 3-Inhibiting Peptide Ameliorates Psoriasis-like Skin Inflammation Jin Yong Kim 1,5, Jinhyo Ahn 3,4, Jinjoo
Dunaliella salina and Iodine in search of Thyroxine
Dunaliella salina and Iodine in search of Thyroxine Purpose: Certain sea-water invertebrates are affected by Thyroid-like Hormones, most of which are provided for by their food. One of the discovered providers
International Conference on Biomedical and Biological Engineering (BBE 2016)
International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry Please do 2017 not adjust margins Nanoscale Electronic Supplementary Information Mono-fullerenols modulating
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Information
Supplementary Information Supplementary Figure 1: cholesterol manipulation alters the positioning of autophagosomes in cells, related to figure 1. (a) HeLa cells were treated for 24h under conditions reducing
Round 60 October 2016
Round 6 October 16 Round 6 Sample Details All samples were prepared for circulation following our normal internal screening process and were scanned using stereo-zoom microscopy to assess homogeneity and
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Dep. Control Time (min)
aa Control Dep. RP 1s 1 mv 2s 1 mv b % potentiation of IPSP 2 15 1 5 Dep. * 1 2 3 4 Time (min) Supplementary Figure 1. Rebound potentiation of IPSPs in PCs. a, IPSPs recorded with a K + gluconate pipette
Supplementary Figure S1 (a) (b)
Supplementary Figure S1: IC87114 does not affect basal Ca 2+ level nor nicotineinduced Ca 2+ influx. (a) Bovine chromaffin cells were loaded with Fluo-4AM (1 μm) in buffer A containing 0.02% of pluronic
Current Opinions on the Human Safety of Titanium Dioxide and Zinc Oxide
Current Opinions on the Human Safety of Titanium Dioxide and Zinc Oxide J F. Nash, Ph.D. Central Product Safety The Procter & Gamble Company Cincinnati, OH 45241 nash.jf@pg.com Human Safety: Objective
Pt 8 mm. 12 mm ITO ~ Figure S1. Top view of the Pt-IDA electrode on the glass slide with 50-µm and 50-µm
Supplementary data A 50 μm Pt 8 mm 12 mm B ITO 50 μm ~ +V 100 nm ~ -V Figure S1. Top view of the Pt-IDA electrode on the glass slide with 50-µm and 50-µm gap distance (A). Side view of the design for the
SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Supplementary Material
Supplementary Material Supplementary Figure 1. NOS2 -/- mice develop an analogous Ghon complex after infection in the ear dermis and show dissemination of Mtb to the lung. (A) WT and NOS2 -/- mice were
Supplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*
SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* Catalog # 72146 Kit Size 500 Assays (96-well plate) Optimized Performance: This kit is optimized to detect alkaline phosphatase activity Enhanced
Science, Hazard and Risk in the European Union: The Case of TiO 2 Exposures
Science, Hazard and Risk in the European Union: The Case of TiO 2 Exposures David B. Warheit Ph.D, Chemours Company, Wilmington, Delaware USA Inhaled Particles XII Meeting, Glasgow, UK September 25, 2017
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Dr. Heyam Awad Pathology sheet #5 cont. Restrictive lung diseases
We were talking about the restrictive lung diseases (interstitial lung diseases) and they're:- Fibrosing diseases. Granulomatous diseases. Eosinophilic. smoking related. * Notes:- 1) Cough occur in restrictive
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse
Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Ivan Zanoni*, Renato Ostuni*, Simona Barresi, Marco Di Gioia, Achille Broggi, Barbara Costa, Roberta
Product Information. MIS Corporation. All Rights Reserved.
Product Information MIS Corporation. All Rights Reserved. MIS Warranty: MIS exercises great care and effort in maintaining the superior quality of its products. All MIS products are guaranteed to be free
Nature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal. Glucose Transport in Goldfish (Carassius auratus)
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal Glucose Transport in Goldfish (Carassius auratus) Ayelén Melisa Blanco 1,2, Juan Ignacio Bertucci 2,3, Naresh Ramesh 2, María Jesús Delgado
LYMPH GLAND. By : Group 1
LYMPH GLAND By : Group 1 ANATOMY LYMPH NODE Lymphatic Organs Red bone marrow Thymus gland Lymph nodes Lymph nodules Spleen Primary organs Secondary organs Lymph Nodes Firm, smooth-surfaced, bean-shaped
Supplementary legends
Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Focus Application. Compound-Induced Cytotoxicity
xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity Featured Study: Using the Time Resolving Function of the xcelligence System to Optimize Endpoint Viability and
Ionic Brushing Superpowers
Ionic Brushing Superpowers EN Technical Brochure At Sanyei we believe, true to the Japanese way of thinking, that mouth care directly relates to being healthier and happier in body and therefore happier
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with
Nature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
J. Cell Sci. 129: doi: /jcs : Supplementary information
Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.
SUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
SelectScreen Biochemical Kinase Profiling Service
Page 1 of 11 ASSAY THEORY 2 ADAPTA ASSAY CONDITIONS 3 ADAPTA ASSAY CONTROLS 4 ADAPTA DATA ANALYSIS 5 KINASE-SPECIFIC ASSAY CONDITIONS 6 CAMK1 (CaMK1) 6 CDK7/cyclin H/MNAT1 6 CDK9/cyclin T1 6 CHUK (IKK
This is the second learning component (Learning Component 2) in our first learning module (Learning Module 1). In this component we review a very
This is the second learning component (Learning Component 2) in our first learning module (Learning Module 1). In this component we review a very basic response to injury inflammation. We ll look at examples
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Engineering a polarity-sensitive biosensor for time-lapse imaging of apoptotic processes and degeneration
nature methods Engineering a polarity-sensitive biosensor for time-lapse imaging of apoptotic processes and degeneration Yujin E Kim, Jeannie Chen, Jonah R Chan & Ralf Langen Supplementary figures and
Mammalian Membrane Protein Extraction Kit
Mammalian Membrane Protein Extraction Kit Catalog number: AR0155 Boster s Mammalian Membrane Protein Extraction Kit is a simple, rapid and reproducible method to prepare cellular protein fractions highly
The Toxicology of Nanoparticles
The Toxicology of Nanoparticles Rodger Duffin ELEGI Laboratory, QMRI Edinburgh University Edinburgh Scotland Nanoparticle toxicology: the knowledge gap between accidental versus engineered nanoparticles
Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2