Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
|
|
- Myrtle Douglas
- 5 years ago
- Views:
Transcription
1 Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella M. Habib 3, Laurie L. Baggio 4, Daniel T. Meier 1, Elisabeth Eppler 5, Karim Bouzakri 6, Stephan Wueest 7, Yannick D. Muller 8, Ann Maria Kruse Hansen 9, Manfred Reinecke 5, Daniel Konrad 7, Max Gassmann 2, Frank Reimann 3, Philippe A. Halban 6, Jesper Gromada 10, Daniel J. Drucker 4, Fiona M. Gribble 3, Jan A. Ehses 11, and Marc Y. Donath 1
2 Supplementary Figure 1. Validation of IL-6 antibody. Supplementary Figure 1. Validation of IL-6 antibody. Plasma Serum Amyloid A (SAA) in response to a single injection of 100 ng IL-6 in the presence of an isotype control or an IL-6 neutralizing antibody (n = 3). Data represents mean ± s.e.m. * P < 0.05 by Student s t test.
3 Supplementary Figure 2. Plasma IL-6 and insulin tolerance after injection with IL-6. a b c Supplementary Figure 2. Plasma IL-6 and insulin tolerance after injection with IL-6. (a) Plasma IL-6 concentrations in male mice in response to a single intraperitoneal injection of IL-6 (n = 6). (b) Insulin tolerance test in male mice after a single injection of IL-6 (n = 6). (c) Plasma IL-6 in male mice in response to a single IL-6 injection (n = 4 6). Data represents mean ± s.e.m.
4 Supplementary Figure 3. IL-6 effects on GLP-2. Supplementary Figure 3. IL-6 effects on GLP-2. Fasting plasma GLP-2 in male mice injected with or without 400 ng IL-6 twice daily for 7 days (n = 10). Data represents mean ± s.e.m.
5 Supplementary Figure 4. Insulin tolerance test. Supplementary Figure 4. Insulin tolerance test. Insulin tolerance test in in male mice injected with or without 400 ng IL-6 twice daily for 7 days (n = 8). Data represents mean ± s.e.m.
6 Supplementary Figure 5. IL-6 effects on DPP-4. a b Supplementary Figure 5. IL-6 effects on DPP-4. (a) Intestinal mrna expression in male mice injected with or without 400 ng IL-6 twice daily for 7 days (n = 6 8). Data expressed relative to ileum control. (b) DPP-4 activity in plasma from male mice 30 min after a single injection of 400 ng IL-6 (n = 5). Data represents mean ± s.e.m.
7 Supplementary Figure 6. Prohormone convertase 2 in GLUTag cells. Supplementary Figure 6. Prohormone convertase 2 in GLUTag cells. GLUTag prohormone convertase 2 (pcsk2) mrna after 24 h ± 100 ng ml -1 IL-6 in the absence (-) or presence (+) of 50 μm AG490. Data expressed relative to control (n = 3). Data represents mean ± s.e.m.
8 Supplementary Figure 7. IL-6 interventions in high fat (HF) diet fed mice. a b c Supplementary Figure 7. IL-6 interventions in high fat (HF) diet fed mice. (a) Fasting blood glucose. (b) Insulin secretion in response to intraperitoneal glucose (c) Insulin tolerance test. Male mice were fed chow or HF diet for 15 weeks, HF-IL6inj mice were injected twice daily with 400 ng IL-6 for the last 7 days of the study, whereas HF-IL6AB mice were injected twice weekly with a neutralizing IL-6 antibody for the last four weeks of the study (n = 7 8). Data represents mean ± s.e.m. * P < 0.05 by Anova comparing chow vs. HF and # comparing HF vs. HF-IL6AB (panel a) and HF vs. HF-IL6inj (panel b).
9 mrna (fold difference relative to chow controls) mrna (fold difference relative to chow controls) mrna (fold difference relative to chow controls) Supplementary Figure 8. Pancreatic islet gene expression IL-1Ra Ins1 Ins2 Ipf1 Gcg 0 Chop Erc1 Perk Supplementary Figure 8. Pancreatic islet gene expression. mrna expression in islets from male mice fed chow or high fat (HF) diet for 18 weeks and Injected with 400 ng IL-6 or NaCl (Ctrl) twice daily for the last 7 days of the experiment (n = 4). Data represents mean ± s.e.m. * P < 0.05 by Student s t test comparing changes from baseline (chow controls and HF controls respectively).
10 Supplementary Table 1. GLP-1 and glucagon in FACS sorted human α cells. Time Active GLP-1 Glucagon (hours) (nm) (nm) ± ± ± ± ± ± ± ± 1.4 Content 17.6 ± ± 4.6 Supplementary Table 1. GLP-1 and glucagon in FACS sorted human α cells. Active GLP-1 and glucagon accumulation into culture media is provided for four consecutive 24 h intervals. Cellular content was extracted after 96 h (n = 4). Data represents mean ± s.e.m
Inflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationa b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationIL-6 Type Cytokine Signaling in Adipocytes Induces Intestinal GLP-1 Secretion
36 Diabetes Volume 67, January 2018 IL-6 Type Cytokine Signaling in Adipocytes Induces Intestinal GLP-1 Secretion Stephan Wueest, 1,2 Céline I. Laesser, 1,2 Marianne Böni-Schnetzler, 3,4 Flurin Item, 1,2
More informationSupplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
More informationDiscussion & Conclusion
Discussion & Conclusion 7. Discussion DPP-4 inhibitors augment the effects of incretin hormones by prolonging their half-life and represent a new therapeutic approach for the treatment of type 2 diabetes
More informationControl of Glucose Metabolism
Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream
More informationYoshihito Nogusa, Ami Mizugaki, Yuri Hirabayashi-Osada, Chie Furuta, Kana Ohyama, Katsuya Suzuki and Hisamine Kobayashi
J Nutr Sci Vitaminol, 60, 188 193, 2014 Combined Supplementation of Carbohydrate, Alanine, and Proline Is Effective in Maintaining Blood Glucose and Increasing Endurance Performance during Long-Term Exercise
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationDiabetes mellitus in cats relevant to human type 2 diabetes current knowledge and new treatment *
Ann. Anim. Sci., Vol. 15, No. 1 (2015) 19 30 DOI: 10.2478/aoas-2014-0067 Diabetes mellitus in cats relevant to human type 2 diabetes current knowledge and new treatment strategies A REVIEW* * Katarzyna
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationIL-6-type Cytokine Signaling in Adipocytes Induces Intestinal GLP-1 Secretion
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-857 Zurich www.zora.uzh.ch Year: 218 IL-6-type Cytokine Signaling in Adipocytes Induces Intestinal GLP-1 Secretion
More informationGLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK
GLP-1 agonists Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK What do GLP-1 agonists do? Physiology of postprandial glucose regulation Meal ❶ ❷ Insulin Rising plasma
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More informationThe Mediterranean Diet: HOW and WHY It Works So Well for T2DM
The Mediterranean Diet: HOW and WHY It Works So Well for T2DM Susan L. Barlow, RD, CDE. Objectives 1. Discuss the effects of meal size on GLP-1 concentrations. 2. Compare and contrast the specific effects
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationOral L-Arginine Stimulates GLP-1 Secretion to Improve Glucose Tolerance in Male Mice. of L-arginine for glucose metabolism.
B R I E F R E S E A R C H R E P O R T Oral L-Arginine Stimulates GLP-1 Secretion to Improve Glucose Tolerance in Male Mice Christoffer Clemmensen, Sanela Smajilovic, Eric P. Smith, Stephen C. Woods, Hans
More informationGlucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon
Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationFigure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
More informationFigure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
More informationUpdate on GLP-1 Past Present Future
Update on GLP-1 p Past Present Future Effects of GLP-1: Glucose Metabolism and Nutritional Balance L-Cells: Glp-1 release Betacellfollowing ingestion Stress Increases satiety reduces appetite Betacell-
More informationScope. History. History. Incretins. Incretin-based Therapy and DPP-4 Inhibitors
Plasma Glucose (mg/dl) Plasma Insulin (pmol/l) Incretin-based Therapy and Inhibitors Scope Mechanism of action ผศ.ดร.นพ.ว ระเดช พ ศประเสร ฐ สาขาว ชาโภชนว ทยาคล น ก ภาคว ชาอาย รศาสตร คณะแพทยศาสตร มหาว ทยาล
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationSpleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
More informationadenosine triphosphate-sensitive K[ Citation Journal of Diabetes Investigation ( modifications or adaptations are ma
Fructose induces glucose-dependent Titleglucagon-like peptide-1 and insulin adenosine triphosphate-sensitive K[ Seino, Yusuke; Ogata, Hidetada; Mae Author(s) Takako; Iida, Atsushi; Harada, Nori Susumu;
More informationTitle Modified Western blotting for insulin and other diabetes-associated peptide hormones
Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationThe Small Intestine. The pyloric sphincter at the bottom of the stomach opens, squirting small amounts of food into your small intestine.
The Small Intestine The pyloric sphincter at the bottom of the stomach opens, squirting small amounts of food into your small intestine. approximately six metres (the longest section of your digestive
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationNew Treatments for Type 2 diabetes. Nandini Seevaratnam April 2016 Rushcliffe Patient Forum
New Treatments for Type 2 diabetes Nandini Seevaratnam April 2016 Rushcliffe Patient Forum Overview Growing population of Type 2 diabetes Basic science on what goes wrong Current treatments Why there is
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationINJECTABLE THERAPIES IN DIABETES. Barbara Ann McKee Diabetes Specialist Nurse
INJECTABLE THERAPIES IN DIABETES Barbara Ann McKee Diabetes Specialist Nurse 1 Aims of the session Describe the different injectable agents for diabetes and when they would be used. Describe some common
More informationAgonists at GPR119 mediate secretion of GLP-1 from mouse enteroendocrine cells through glucoseindependent
2799..2807 British Journal of Pharmacology DOI:10.1111/j.1476-5381.2011.01754.x www.brjpharmacol.org RESEARCH PAPERbph_1754 Agonists at GPR119 mediate secretion of GLP-1 from mouse enteroendocrine cells
More informationPhysiology 12. Overview. The Gastrointestinal Tract. Germann Ch 19
Physiology 12 The Gastrointestinal Tract Germann Ch 19 Overview 1 Basic functions of the GI tract Digestion Secretion Absorption Motility Basic functions of the GI tract Digestion: : Dissolving and breaking
More informationSupplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationENERGY FROM INGESTED NUTREINTS MAY BE USED IMMEDIATELY OR STORED
QUIZ/TEST REVIEW NOTES SECTION 1 SHORT TERM METABOLISM [METABOLISM] Learning Objectives: Identify primary energy stores of the body Differentiate the metabolic processes of the fed and fasted states Explain
More informationTREATMENTS FOR TYPE 2 DIABETES. Susan Henry Diabetes Specialist Nurse
TREATMENTS FOR TYPE 2 DIABETES Susan Henry Diabetes Specialist Nurse How can we improve outcomes in Type 2 diabetes? Earlier diagnosis Better patient education Stress central role of lifestyle management
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationVoglibose, an Alpha-glucosidase Inhibitor, to Increase Active Glucagon-like Peptide-1 Levels
PharmSight TM DOI: 10.4255/mcpharmacol.09.22 Molecular and Cellular Pharmacology www.mcpharmacol.com Voglibose, an Alpha-glucosidase Inhibitor, to Increase Active Glucagon-like Peptide-1 Levels Yusuke
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationINJECTABLE THERAPY FOR THE TREATMENT OF DIABETES
INJECTABLE THERAPY FOR THE TREATMENT OF DIABETES ARSHNA SANGHRAJKA DIABETES SPECIALIST PRESCRIBING PHARMACIST OBJECTIVES EXPLORE THE TYPES OF INSULIN AND INJECTABLE DIABETES TREATMENTS AND DEVICES AVAILABLE
More informationResveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
More informationGLP-2 ELISA. For the quantitative determination of GLP-2 in human serum and plasma samples.
GLP-2 ELISA For the quantitative determination of GLP-2 in human serum and plasma samples. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number: 48-GP2HU-E01.1 Size: 96 wells Version:
More informationSupplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance
Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,
More information18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin
18. PANCREATIC FUNCTION AND METABOLISM ISLETS OF LANGERHANS Some pancreatic functions have already been discussed in the digestion section. In this one, the emphasis will be placed on the endocrine function
More informationSupplementary legends
Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:
More informationType 2 DM in Adolescents: Use of GLP-1 RA. Objectives. Scope of Problem: Obesity. Background. Pathophysiology of T2DM
Type 2 DM in Adolescents: Use of GLP-1 RA Objectives Identify patients in the pediatric population with T2DM that would potentially benefit from the use of GLP-1 RA Discuss changes in glycemic outcomes
More informationOverview. Physiology 1. The Gastrointestinal Tract. Guyton section XI
Overview Physiology 1 The Gastrointestinal Tract Guyton section XI Basic functions of the GI tract Digestion Secretion Absorption Motility Basic functions of the GI tract Digestion: : Dissolving and breaking
More informationHow can we improve outcomes in Type 2 diabetes?
How can we improve outcomes in Type 2 diabetes? Earlier diagnosis Better patient education Stress central role of lifestyle management Identify and treat all risk factors Use rational pharmacological therapy
More informationChief of Endocrinology East Orange General Hospital
Targeting the Incretins System: Can it Improve Our Ability to Treat Type 2 Diabetes? Darshi Sunderam, MD Darshi Sunderam, MD Chief of Endocrinology East Orange General Hospital Age-adjusted Percentage
More informationTargeting the release of anorectic and antidiabetic
ORIGINAL ARTICLE Short-Chain Fatty Acids Stimulate Glucagon-Like Peptide-1 Secretion via the G-Protein Coupled Receptor FFAR2 Gwen Tolhurst, 1 Helen Heffron, 2 Yu Shan Lam, 1 Helen E. Parker, 1 Abdella
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationMaking Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes
University of British Columbia Departments of Surgery and Cellular & Physiological Sciences Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes 2016 International Conference
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationPathogenesis of Type 2 Diabetes
9/23/215 Multiple, Complex Pathophysiological Abnmalities in T2DM incretin effect gut carbohydrate delivery & absption pancreatic insulin secretion pancreatic glucagon secretion HYPERGLYCEMIA? Pathogenesis
More informationDisclosure. Learning Objectives. Case. Diabetes Update: Incretin Agents in Diabetes-When to Use Them? I have no disclosures to declare
Disclosure Diabetes Update: Incretin Agents in Diabetes-When to Use Them? I have no disclosures to declare Spring Therapeutics Update 2011 CSHP BC Branch Anar Dossa BScPharm Pharm D CDE April 20, 2011
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationHigh Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22
Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationSUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)
SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of
More informationMetformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production
activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationEffect of macronutrients and mixed meals on incretin hormone secretion and islet cell function
Effect of macronutrients and mixed meals on incretin hormone secretion and islet cell function Background. Following meal ingestion, several hormones are released from the gastrointestinal tract. Some
More informationHelpful Hints for Taking Care of Your Diabetes. Farahnaz Joarder, MD and Don Kain, MA, RD,CDE Harold Schnitzer Diabetes Health Center
Helpful Hints for Taking Care of Your Diabetes Farahnaz Joarder, MD and Don Kain, MA, RD,CDE Harold Schnitzer Diabetes Health Center Objectives How big of a problem is diabetes? What is diabetes? How is
More informationSYNOPSIS OF RESEARCH REPORT (PROTOCOL BC20779)
TITLE OF THE STUDY / REPORT No. / DATE OF REPORT INVESTIGATORS / CENTERS AND COUNTRIES Clinical Study Report Protocol BC20779: Multicenter, double-blind, randomized, placebo-controlled, dose ranging phase
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationInhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationGlucagon-like peptides (GLPs) and glucagon are hormones. PPAR / Activation Induces Enteroendocrine L Cell GLP-1 Production
GASTROENTEROLOGY 2011;140:1564 1574 PPAR / Activation Induces Enteroendocrine L Cell GLP-1 Production MEHDI DAOUDI,*,,, NATHALIE HENNUYER,, MICHAEL G. BORLAND, VERONIQUE TOUCHE,*,,, CHRISTIAN DUHEM,, BARBARA
More informationHigh-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationZurich Open Repository and Archive. Macrophages, cytokines and beta-cell death in Type 2 diabetes
University of Zurich Zurich Open Repository and Archive Winterthurerstr. 190 CH-8057 Zurich Year: 2008 Macrophages, cytokines and beta-cell death in Type 2 diabetes Ehses, J A; Böni-Schnetzler, M; Faulenbach,
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationImproving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D.
Improving Diabetes Research: Moving Beyond Animal Models Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. July 19, 2014 From Bench-to-Bedside Sulfonylurea Biguanide Dipeptidyl peptidase-4 inhibitor Glucagon-like
More informationSoliqua (insulin glargine and lixisenatide), Xultophy (insulin degludec and liraglutide)
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.30.48 Subject: Insulin GLP-1 Combinations Page: 1 of 5 Last Review Date: September 15, 2017 Insulin GLP-1
More informationIdentification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.
Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification
More informationTITLE: "Impact of Obesity on Tamoxifen Chemoprevention in a Model of Ductal Carcinoma in Situ"
AD Award Number: W81XWH-09-1-0720 TITLE: "Impact of Obesity on Tamoxifen Chemoprevention in a Model of Ductal Carcinoma in Situ" PRINCIPAL INVESTIGATOR: Sarah Dunlap-Smith, Ph.D. CONTRACTING ORGANIZATION:
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationGLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration
GLP 1 agonists Winning the Losing Battle Dr Bernard SAMIA KCS Congress: Impact through collaboration CONTACT: Tel. +254 735 833 803 Email: kcardiacs@gmail.com Web: www.kenyacardiacs.org Disclosures I have
More informationTherapeutic strategy to reduce Glucagon secretion
Clinical focus on glucagon: α-cell as a companion of β-cell Therapeutic strategy to reduce Glucagon secretion Sunghwan Suh Dong-A University Conflict of interest disclosure None Committee of Scientific
More information