General and Comparative Endocrinology

Transcription

1 Generl n Comprtive Enorinology 19 (1) 8 1 Contents lists ville t SieneDiret Generl n Comprtive Enorinology journl homepge: Spontneous intr-uterine growth restrition moultes the enorine sttus n the evelopmentl expression of genes in porine fetl n neontl ipose tissue Florene Gonret,,, Mrie-Christine Père,, Snrine Ther,, Sophie Dré,, Christine Trefeu,, Iselle Le Huërou-Luron, Iselle Louveu, INRA, UMR18 PEGASE, F-559 Sint-Gilles, Frne AgrompusOuest, UMR18 PEGASE, F-5 Rennes, Frne INRA, UR11 ADNC, F-559 Sint-Gilles, Frne rtile info strt Artile history: Reeive 5 Mrh 1 Revise 1 Septemer 1 Aepte 1 Septemer 1 Aville online Otoer 1 Keywors: Aipoyte ifferentition Gene expression IGF Insulin Intr-uterine growth retrtion Pig Low irth weight is orrelte with low iposity t irth, phenotype tht influenes neontl survivl n lter iposity. A etter unerstning of events ffeting the fetl ipose tissue evelopment n its funtionlity roun irth is thus neee. This stuy ws unertken to exmine the impt of spontneous intr-uterine growth restrition (IUGR) on irulting onentrtions of hormones n nutrients together with the evelopmentl expression ptterns of vrious genes in suutneous ipose tissue of pig fetus uring the lst thir of pregnny n just fter irth. At 71 n 11 ys post-oneption n ys postntl, pirs of sme-sex piglets were hosen within litters to hve either meium () or low () weight (n = pirs t eh stge). The results inite tht IUGR ounterts the temporl fll of DLK1 gene expression in eveloping ipose tissue ross gesttion. It lso ttenutes the time-epenent inrese in expression levels of mny genes promoting ipoyte ifferentition (PPARG, CEBPA) n lipogenesis (LPL, SREBF1, FASN, FABP). Opposite responses to IUGR were oserve for the IGF system, so tht IGF1 were lower (P <.1) ut IGF were greter in ipose tissue of piglets ompre with piglets. The plsm insulin onentrtion n the of insulin reeptor (INSR) n insulin-responsive gluose trnsporter (GLUT) in ipose tissue were lso greter in piglets t y postntl. The t inite tht IUGR elys the norml ontogeny of ipose tissue ross gesttion n ffets the insulin n IGF xes roun irth. Ó 1 Elsevier In. All rights reserve. 1. Introution Birth weight hs een ientifie s key ftor in neontl survivl n lter-life onitions suh s the ourrene of metoli iseses. In the pig, speies of importne for met inustry worlwie n roly use experimentl iomeil moel (Wlters et l., 11), there re huge ifferenes in irth weights within litters. Mternl hrteristis ontriute only to smll prt of this heterogeneity (Quesnel et l., 8), n fetl unernutrition ue to plentl insuffiieny hs een rther reognize s the min use of the seletive intr-uterine growth retrtion (IUGR) in some piglets (Wrshw, 199). Differenes in irth Arevitions: IUGR, intr-uterine growth retrtion; p, ys post-oneption; pn, ys post-ntl;, meium oy weight;, low oy weight; SCAT, suutneous ipose tissue. Corresponing uthor t: INRA, UMR18 PEGASE, Domine e l Prise, F-559 Sint-Gilles, Frne. Fx: E-mil ress: florene.gonret@rennes.inr.fr (F. Gonret). weights re lso ssoite with ifferenes in oy omprtments. Similrly to humn where suutneous ft tissue thikness is positively ssoite with irth weight (Assimkopoulos et l., 7) n sheep where fetl ipose tissue evelopment is highly-sensitive to nutritionl hnges in lte gesttion (Symons et l., 1998; Buge et l., ), vrious stuies hve reporte tht low-weight piglets h lower oy ft ontent t irth thn their ppropritely-grown littermtes (Rehfelt n Kuhn, ; Morise et l., 9; Frons-Chuty et l., 1). The lowere irth weight in response to high or low protein mternl iets ws lso ompnie y reue oy ft in piglets t irth (Rehfelt et l., 1). During sukling, low-irth weight piglets isply more rpi th-up ft growth thn their silings of norml oy weight (Morise et l., 9). Together, spontneous vrition in piglet s weight n e use s n experimentl moel of IUGR without the omplition of mternl phenotype, to etermine the impts of fetl events on the mturtion of ipose tissue ross gesttion n its funtionlity roun irth. 1-8/$ - see front mtter Ó 1 Elsevier In. All rights reserve.

2 F. Gonret et l. / Generl n Comprtive Enorinology 19 (1) To te, the influene of fetl nutrient restrition on the enorine sttus n ipose tissue evelopment efore irth hs een poorly investigte. Most of the ville t hve een otine in the sheep (Symons et l.,, 1; Mostyn et l., ), speies orn with mture hypothlmi-pituitry xis, n in whih rown perirenl ipose tissue preomintes in lte gesttion. In ontrst, the pig neonte is generlly onsiere s unique ompre to other mmmls with its lk of rown ft (Tryhurn et l., 1989). In this speies, white ipose tissue is minly lote in suutneous re, n fetl ft gin elertes mrkely from 9 ys post-oneption onwrs (i.e., % of gesttion) in ppropritely-grown fetuses (MPherson et l., ). At 75 ys post-oneption (p), we hve reently shown tht expressions of vrious ipoyte-ifferentiting genes were lower in suutneous ipose tissue of smll fetuses thn in their lrger littermtes (Gonret et l., 11). It remins to lrify whether this reflets only trnsient ely in the evelopmentl gene expression uring the lst trimester of gesttion (timing of hnges) or permnent ltertion. Moreover, euse the weights of fetl ft epots re highly responsive to gluose supply through insulin tion in the sheep (Stevens et l., 199), etter esription of the time-relte hnges in irulting onentrtions of nutrients n noli hormones is neee for etter unerstning of the impt of IUGR on fetl ft evelopment. Therefore, this stuy ws unertken to estlish the effets of IUGR in piglets on the evelopmentl expression ptterns of vriety of genes involve in the initition n progression of ipoyte ifferentition or relte to the insulin n IGF xes in suutneous ipose tissue, s well s on the irulting nutrients n hormone onentrtions ross lte gesttion n just fter irth.. Mterils n methos.1. Animls n smple olletions The re n use of nimls (Sus srof) were performe in ompline with the Europen Union legisltion (iretive 8/9/CEE) n the Frenh legisltion (Déret n 1-9/5/1; ethique.ips.fr/sv/hrteexpenimle.pf; greement for niml housing numer C-5-75-). Moreover, the sientifi n tehnil stff involve in the experiment otine n iniviul greement from the Frenh Veterinry Servies to experiment on living nimls. Fetuses n -y-ol neontes originte from totl of 18 Lnre Lrge White rossre hyper-prolifi sows fe stnr iet (1.% proteins,.% ft, 9.5 MJ/kg net energy) uring gesttion. This iet ws provie to sows t. kg/ from insemintion to the onfirmtion of the gesttion n t.9 kg/ therefter. Pregnnt sows were srifie t 71 (% of gesttion) or 11 (98% of gesttion) ys post-oneption (p; n = t eh stge). Foo ws withrwn from the sows t pproximtely 1: h on the y efore slughter. Sows were stunne y eletronrosis. After leeing, the uteri were immeitely remove, n eh uterine horn ws then opene. Bloo ws immeitely ollete from umilil vein (whih rries oxygen n nutrients from plent to fetus), efore ll fetuses were kille y n intrri injetion of T1 Ò, numere, sexe n weighe. Within eh litter, pirs onsisting eh of low-weight fetus () n its siling of men litter oy weight () of the sme sex ( mles n femles t 71 p; mles n femles t 11 p) were then selete for tissue smpling (n = pirs t eh gesttionl ge, Tle 1), so tht weight of iniviuls ws t lest 5% less thn tht of ounterprts. Two ys fter sow frrowing, pirs of n neontes were lso selete (n = pirs, with mles n 8 femles) se on the istriution of piglet s irth weight within eh litter. All these neontes hve Tle 1 Litter fetures n men weights of selete piglets. Developmentl stges P-level Prity of sows 5. ± ± ±.7. Litter size, n 1. ± ± ±.9.7 Men piglet weight, g Piglets in the litter ± 1 11 ± 5 19 ± 57 <.1 piglets 7 ± ± 9 11 ± 5 <.1 piglets 175 ± 1 9 ± 87 ± 1 <.1 Within sme row, mens (± sem) tht shre ommon supersript letter i not iffer (P >.5) for the effet of evelopmentl stge (p: ys post-oneption; pn: ys post-ntl). suessfully sukle olostrum, s ssesse y their positive weight gin from irth to y postntl (pn). Two hours fter the lst ingestion of olostrum, piglet neontes were nesthetize y eletronrosis n kille y jugulr leeing. Bloo ws ollete t leeing. Dorsl suutneous ipose tissue (SCAT) ws ollete from the selete fetuses n neontes immeitely fter eth. Tissue smples were ut in smll piees, immeitely frozen in liqui nitrogen, n store t 7 C. Plsm ws prepre from ollete loo, y low-spee entrifugtion (5g uring 15 min.) n store t C efore etermintions of metolite or hormone onentrtions... Plsm prmeters Plsm onentrtions of gluose, ltte, frutose, lumin, non-esterifie ftty is (NEFA) n triglyeries were ssesse in ll fetuses n neontes using ommeril kits (Gluose RTU, Ltte PAP, Triglyeries enzymti PAP n Alumin-kit from Biomérieux, Mry l Etoile, Frne; Frutose-kit from Thermo Eletron, Cergy-Pontoise, Frne, n NEFA-HR() from Wko Chemils GmH, Neuss, Germny). These trits were mesure with linil hemistry nlyzer Konel i (Thermo Fisher Sientifi, Courtoeuf, Frne). Due to the very smll volumes of ollete loo t 71 p, plsm onentrtions of hormones were mesure in only 11 p n pn smples. Plsm onentrtion of insulin ws mesure with RIA kit (INSULIN-CT, CIS Bio Interntionl, Gif-sur-Yvette, Frne). The sensitivity ws 8.5 lu/ml, n the intr-ssy oeffiient of vrition ws.5% t lu/ml. Plsm IGF-I onentrtion ws etermine fter n i-ethnol extrtion (Louveu n Bonneu, 199) using the IRMA IGF-I kit (Immunoteh, Mrseille, Frne). The intr-ssy oeffiient of vrition ws 1% for men IGF-I onentrtion of 8 ng/ml. Plsm leptin onentrtion ws quntifie using the multi-speies RIA kit (Millipore, St Chrles, MO, USA). Detetion limit ws.5 ng/ml, n the intr-ssy oeffiient of vrition ws 5% t 1.8 ng/ml... RNA isoltion in ipose tissue n DNA synthesis Totl RNA in SCAT smples ws isolte using Trizol regent (Invitrogen, Crls, CA). All tissue smples were first eprive from lipis y hloroform ition (. v/v). Totl RNA ws then purifie using sili-memrne tehnology (Nuleospin RNA II kit, Mhery-Ngel, Düren, Germny), n ws further DNA trete (DNA-free kit, Amion). RNA quntity, purity, n integrity were etermine with the Bio nlyzer 1 L Chip tehnology (Agilent Tehnologies, Snt Clr, CA) n n UV spetrophotometer (NnoDrop, Thermo Sientifi, Illkirh, Frne). The qulity ws heke y the 8S:18S rrna rtio n the RNA Integrity Numer (RIN). The RNA smples h RIN vlues of 7.8 ±.9 on verge. First strn DNA synthesis ws performe using 1 lg of

3 1 F. Gonret et l. / Generl n Comprtive Enorinology 19 (1) 8 1 totl RNA s templte, n rnom hexmer primers n murine Moloney leukemi virus reverse trnsriptse oring to the mnufturer s instrutions (Applie Biosystems; Foster City, CA). Trete-DNAse totl RNA ( lg) ws reverse-trnsrie using High Cpity DNA Reverse Trnsription kit... Quntittive rel-time PCR (qpcr) Expression levels of vrious genes tht re involve in the progression of mitoti ell yle (ylin D1: CCND1) n the mintenne of n unifferentite phenotype (preipoyte ftor 1/ elt-like 1 homolog: DLK1; serete frizzle-relte protein 1: SFRP1; wingless-type fmily memer 1B: WNT1B), together with those triggering ipoyte ifferentition (CCAAT/enhner ining protein lph: CEBPA; peroxisome prolifertor-tivte reeptor gmm: PPARG; sterol regultory element ining trnsription ftor 1: SREBF1) n lipi filling (lipoprotein lipse: LPL; ftty i synthse: FASN; ipoyte-type ftty i ining protein : FABP) in ifferentite ipoytes were onsiere. Expression levels of genes oing for the insulin-responsive gluose trnsporter (GLUT/SLCA), insulin reeptor (INSR), IGFs (IGF1, IGF) n their ining proteins (IGFBP, IGFBP5) were lso exmine. Expression levels of trget genes were ssesse y qpcr (Tle ). Primers for the selete genes were erive from our previous experiments (Grn et l., 8; Gonret et l., 11) or were newly esigne using Primer Express softwre (version., Applie Biosystems) from pig sequenes n generte in highly-purifie slt-free form (Euroio, Les Ulis, Frne). The qpcr nlyses were performe with.5 ng of reverse-trnsrie RNA using fst SYBR Ò Green I regents in StepOnePlus RT-qPCR System instrument with the fst moe (Applie Biosystems). Forty yles of mplifition were performe, with eh yle onsisting of enturtion t 95 C for s, n hyriiztion n extension t C for s. An internl lirtor (pool of totl RNA reversetrnsrie from ll smples) n negtive ontrols were use for eh run of qpcr. Quntifition yle vlues (C q, orresponing to the numer of yles t hlf of the exponentil phse of the urve of the qpcr retion) re mens of uplite mesurements. DC q for eh gene ws lulte s the ifferene in C q vlues erive from the uplite smples n the internl lirtor. Amplifition effiieny (E) of the qpcr retion ws etermine for eh trget using stnr urves generte with eresing onentrtion of DNA smples (1.9 ng), n lulte s E = 1 (1/slope). As expete, E rnge from 1.8 to.9 (men: 1.95) for eh gene. The liner orreltion oeffiient (R ) of ll the genes rnge from.99 to 1. The trnsript level of trget gene ws normlize using ftor (NF) whih ws the geometri men of three stle referene genes (HPRT1, TBP1 n TOPB) s lulte using GeNorm lgorithm (megen.ugent.e/jvesomp/genorm/). The reltive expression of eh trget gene ws expresse s follows: E DCq(smple-lirtor) /NF..5. Sttistis The SAS softwre (SAS Institute, Cry NC, NY) ws use for t nlysis. Litter hrteristis were nlyze y generl liner moel (ANOVA) with the min effet of the evelopmentl stge. Gene expression levels in ipose tissue, n nutrients n hormonl onentrtions in plsm were lso nlyze y ANOVA proeure inluing the evelopmentl stge (71 p, 11 p or pn), weight group ( or ), the intertion etween evelopmentl stge n weight, n the litter neste within evelopmentl stge s the min ftors. Signifine ws enote for P vlue less thn.5;.5 < P <.1 ws isusse s tren. Tle Primers use for nlysis of gene expression y RT-qPCR. Gene Aession numer Primer sequene (5 - ) Selete genes WNT1B DQ F: CCAGGCACGAATGCGAAT R: CCGCTTCAGATTTTCAGTTACCA SFRP1 XM_5988. F: CCACAACGTGGGCTACAAGA R: CTTCACCTCGGCCATGGT CCND1 EST AK.1 F: CACGACTTCATCGAGCACTT R: GTTTGCGGATGATCTGTTTG DLK1 DQ958 F: CCCATGGAGCTGAATGCCT R: TTGCAAATGCACTGCCAGGG CEBPA AF19 F: GTGGACAAGAACAGCAACGA R: CTCCAGCACCTTCTGTTGAG PPARG AF19 F: ATTCCCGAGAGCTGATCCAA R: TGGAACCCCGAGGCTTTAT SREBF1 AF187 F: CGGACGGCTCACAATGC R: GCAAGACGGCGGATTTATTC LPL X98 F: CCCGACGACGCAGATTTC R: GGATGGCTTCCCCAATGTTA FASN AY188 F: AGCCTAACTCCTCGCTGCAAT R: ATTCCTTGGAACCGTCTGTGTTC FABP AJ1 F: GGAAAGTCAAGAGCACCATAACCT R: TCCACCACCAACTTATCATCTACTATTT GLUT NM118 F: GGCAGCCCCTCATCATTG (SLCA) R: TCGAAGATGCTGGTTGAATAGTAGAA INSR AF1858 F: TTCTTCGAACCCCGAGTACCT R: CGATGTCCCTGGCGTTTC IGF1 NM15 F: GCTGGACCTGAGACCCTCTGT R: TACCCTGTGGGCTTGTTGAAAT IGF NM188. F: AGGGCATCCAAACCACAAAC R: GGGTTCAATTTTTGGTATGTAACTTG IGFBP AF858 F: CATCCCCAACTGCGACAAG R: ATCCACGCACCAGCAGAAG IGFPB5 NM199 F: CGTGGACAAGTACGGGATGA R: CGAAGCTGTGGCACTGGAA Housekeeping genes TOPB AF91 F: AACTGGATGATGCTAATGATGCT R: TGGAAAAACTCCGTATCTGTCTC HPRT DQ85175 F: TACCTAATCATTATGCCGAGGATTT R: AGCCGTTCAGTCCTGTCCAT TBP DQ85178 F: AACAGTTCAGTAGTTATGAGCCAGA R: AGATGTTCTCAAACGCTTCG Aession numer in the Ntionl Center for Biotehnology Informtion (NCBI). F n R inite forwr n reverse primers, respetively. WNT1B: winglesstype MMTV integrtion site fmily memer 1B; SFRP1: serete frizzle-relte protein 1-like; CCND1: ylin D1 (preite from EST sequene se on Ire tool n showing the est sore for homology with Humn genome); DLK1: elt-like 1 homolog; CEBPA: CCAAT/enhner ining protein lph; PPARG, peroxisome prolifertor-tivte reeptor-gmm; SREBF1, sterol-regultory-element-ining protein-1; LPL: lipoprotein lipse; FASN, ftty i synthse; FABP: ftty-i ining protein ; GLUT, solute rrier fmily, filitte gluose trnsporter memer -like; INSR: insulin reeptor; IGF: insulin-like growth ftor ; IGFBP: insulin-like growth ftor-ining protein ; IGFBP5: insulin-like growth ftorining protein 5; TOPB: topoisomerse II et; HPRT, hypoxnthine phosphoriosyltrnsferse; TBP, TATAox ining protein.. Results.1. Boy weights n plsm onentrtions of metolites n hormones The men weights of the selete fetuses t 71 n 11 p s well s those of the neontes ( pn) were %, % or % lower (P<.1) in the group thn in the group, respetively (Tle 1). Plsm onentrtions of gluose, NEFA, triglyeries n lumin were muh higher (P<.1) fter thn efore irth (Fig. 1). In ontrst, plsm onentrtions of frutose n ltte were lower (P<.1) in neontes thn in fetuses. Metolite plsm onentrtions i not iffer etween n littermtes, with the exeption of frutose onentrtions in 71-p fetuses whih were lower (P <.1) in fetuses thn in fetuses.

4 F. Gonret et l. / Generl n Comprtive Enorinology 19 (1) mm Gluose Stge: P <.1 BW: P =.8 SxBW: P =.55 mm Ltte Stge: P <.1 BW: P =.1 SxBW: P =.9 71 pn 11 pn p 71 pn 11 pn p mm Frutose Stge: P <.1 BW: P =. SxBW: P =. 71 pn 11 pn p g/l Alumin Stge: P <.1 BW: P =.1 SxBW: P =.8 71 pn 11 pn p µm 5 NEFA Stge: P <.1 BW: P =.9 SxBW: P =.7 g/l Stge: P <.1 BW: P =.8 SxBW: P =.7 Triglyeries pn 11 pn p 71 pn 11 pn p Fig. 1. Plsm onentrtions of metolites in eveloping porine silings. Littermtes of low (, h) or meium (, j) oy weights were ompre t 71 or 11 ys post-oneption (p) n ys post-ntlly (pn) for the min effets of stge (S) of evelopment, weight (BW) group n the intertion etween stge n weight (S BW). N = per weight group t eh stge.,, : mens tht shre ommon supersript letter i not iffer. Plsm onentrtions of hormones were exmine in 11 p n pn smples. Plsm onentrtions of IGF-I n leptin were greter t pn thn t 11 p (Tle ), without ny ifferenes etween n piglets. Plsm insulin onentrtions were lso greter (P<.1) in neontes thn in fetuses. Moreover, this time-relte inrese in insulin onentrtions roun irth ws higher (P <.) in (5.) thn in (.) piglets. The insulin:gluose rtio fell from 11 p to pn in the group, wheres it remine rther unhnge in the group (Tle )... Developmentl expression ptterns of key genes in ipose tissue..1. Genes ssoite with growth rrest n Wnt signling The mrna level of ylin D1 (CCND1), gene whose expression regultes ell yle progression, inrese (P <.1) etween 71 p n 11 p in ipose tissue of oth n fetuses (Fig. ). A tren (P =.7) ws enote for greter expression level of CCND1 in neontes thn in their littermtes t pn. An intertion etween evelopmentl pttern n weight group ws oserve for the preipoyte ftor DLK1. Inee, its Tle Plsm onentrtions of hormones in piglets with low weight () n their meium silings () roun irth. 11 p pn P-level Stge BW S BW IGF-I, ng/ml ± ± ± 7 7 ± Leptin, ng/ml.8 ±.1.8 ±..8 ±..7 ±. < Insulin, lui/ml.8 ±..8 ±.. ± ±.1 <.1.. Insulin/Gluose, lui/lm.7 ±. ±..9 ±.1. ± Within sme row, mens (± sem) with ifferent supersript letter iffere (P <.5) for the effet of evelopmentl stge (Stge, S; p: ys post-oneption; pn: ys post-ntl) n oy weight group (BW; smll: SBW or meium: ).

5 1 F. Gonret et l. / Generl n Comprtive Enorinology 19 (1) A Stge: P <.1 BW: P =.17 SxBW: P =. CCND DLK1 Stge: P =.7 BW: P =. SxBW: P =....8 B Stge: P =.5 BW: P =. SxBW: P =. WNT1B...8 SFRP1 Stge: P =.1 BW: P =.9 SxBW: P =.7 Fig.. Expressions of genes involve in erly ommitment of preipoytes. Expression levels of genes ssoite with growth rrest (A) n Wnt signling (B) were mesure in suutneous ipose tissue of low (, h) or meium (, j) porine silings. For eh gene, reltive expression levels were ompre for the min effets of stge (S), weight (BW) group n the intertion etween stge n weight group (S BW). N = iniviuls per weight group t eh evelopment stge.,, : mens tht shre ommon supersript letter i not iffer. expression level shrply eline (P =.8) ross gesttion in group, wheres it ws mintine t n lmost stle level uring the sme perio in group. As result, while DLK1 i not iffer etween n fetuses ross gesttion, its expression ws greter (P <.5) in neontes thn in their meium-size littermtes t pn. The expression ptterns of the wingless-type fmily memer 1B (WNT1B) gene n its solule ntgonist SFRP1 were not ffete y weight group, with pek in WNT1B expression t 11 p n grute erese in SFRP1 ross gesttion in oth groups.... Genes involve in ipoyte ifferentition n lipi filling Expression levels of most of the exmine genes promoting ipoyte ifferentition n lipi filling were inrese (P <.5) ross gesttion in the norml size piglets, ut these inreses were loke or prtilly-lunte in low weight nimls. As illustrte in Fig., the expression levels of the investigte genes were similr in n fetuses t 71 p. With respet of ipogeni ftor CEBPA, its mrna level ws grully inrese (P =.) with ge in the group, ut i not exhiit temporl hnges in the group. An inrese in PPARG ourre in ipose tissue ross gesttion in oth groups, ut this inrese ws less pronoune in the group thn in the group. The evelopmentl pttern of the SREBF1 gene, nother trnsription ftor tht is inue erly in ifferentition, ws rther ifferent with pek of expression lose to gesttionl term in oth groups. The erese in expression level of SREBF1 oserve etween 11 p n pn ws however more severe (P =.5) in the group ( 8%) thn in group ( 18%).Our nlysis lso inites signifint influene of weight group on the evelopmentl pttern of genes ssoite to lipi filling. The of the lipoprotein lipse (LPL), the prolipogeni ftty i synthse (FASN) n the ipoyte-speifi mrker ftty i ining protein (FABP) inrese (P <.1) ross gesttion in oth groups. However, these inreses were prtilly-lunte in piglets. As onsequene, wheres LPL, FASN n FABP i not iffer etween the two weight groups ross gesttion, expression levels of these genes were muh lower (P <.5), in piglets thn in piglets t pn.... Genes relte to insulin tion The expression of the insulin-responsive gluose trnsporter GLUT ws mrkely inue (P <.1) uring the lst trimester of pregnny in oth groups (Fig. ). From 11 p onwrs, GLUT mrna level ws however greter in the group thn in the group (P <.5), n the ifferene ws exerte fter irth (+155% t pn for the smllest littermtes ompre with their norml-size piglets). Regring insulin reeptor (INSR) expression in ipose tissue, it peke shortly efore irth in n fetuses. The erese in its expression level fter irth ws less pronoune in growth-restrite piglets thn in piglets.... Genes ssoite with the IGF system Mrke evelopmentl moifitions were lso oserve for expressions of genes of the IGF system (Fig. ). Wheres IGF1 expression levels were inrese (P <.1) ross pregnny n the few ys fter irth in piglets, these levels i not hnge in the group. This results in out two-fol lower expression levels (P <.1) of IGF1 from 11 p onwrs in pigs smll for their gesttionl ge. The pttern of expression of the IGF gene ws opposite, with grul erese in its expression from 71 p onwrs in the group ut stey-stte level in the group uring the sme perio. Finlly, oth IGFBP n IGFBP5 were trnsiently inue uring the stuie perio in the two groups. IGFBP expression i not respon to ifferenes in weight within litters, ut the expression level of IGFBP5 t the pek (11 p) ws lower (P<.1) in fetuses ompre with littermtes.

6 F. Gonret et l. / Generl n Comprtive Enorinology 19 (1) A Stge: P =. BW: P =. SxBW: P =. CEBPA Stge: P <.1 BW: P =. SxBW: P =.5 PPARG B Stge: P <.1 SREBF1 BW: P =.1 SxBW: P = Stge: P <.1 BW: P =. SxBW: P =. LPL C Stge: P =.1 BW: P =. SxBW: P =.1 FASN 5 1 Stge: P <.1 BW: P =.1 SxBW: P =. FABP Fig.. Expressions of genes involve in ipoyte ifferentition. Expression levels of genes were mesure in suutneous ipose tissue of low (, h) or meium (, j) porine silings. (A) Mster regultors of ipoyte ifferentition; (B) Erly mrkers of ipoyte ifferentition (C) Genes involve in lipi nolism. For eh gene, reltive expression levels were ompre for the min effets of stge (S), weight (BW) group n the intertion etween stge n weight group (S BW). N = iniviuls per weight group t eh evelopment stge.,,, : mens tht shre ommon supersript letter i not iffer.. Disussion First, the urrent stuy enrihes our knowlege on the temporl expression of severl genes involve in porine fetl ipose tissue evelopment. Inee, the mjor events involve in porine ipogenesis hve een minly esrie from stuies se on the investigtion of preursor ells in primry ulture (Ding et l., 1999; Smulin et l., 8, 9). Aville in vivo t onern only limite numer of genes uring the fetl perio (Kim et l., ). Seon, this stuy provies new eviene tht spontneous IUGR mrkely interts with the evelopmentl pttern of mny genes in suutneous ipose tissue uring gesttion. Even though the evelopment of suutneous ipose tissue egins from 5 p onwrs in the pig (Husmn n Kuffmn, 198), ifferenes etween low- n norml-size nimls for the urrent exmine genes were etete fter 71 p n were prtiulrly exerte two ys fter irth. The urrent stuy inites tht the expression pttern of genes ssoite to the IGF ws lerly ffete y IUGR. For IGF1 n IGFBP5, the ifferene etween the two weight groups ws lerly etete t 11 p. Espeilly, IGF1 expression file to inrese in ipose tissue of piglets. Similrly to our results in pigs, restrition of plentl, n hene of fetl growth, lso reue IGF1 expression in perirenl ipose tissue of lte gesttionl sheep fetuses (Duffiel et l., 8). In our stuy, the temporl pttern of expression of IGF1 ws similr to tht oserve for genes ssoite with ipoyte ifferentition n lipi metolism, whih supports signifint role of IGF1 in promoting ipose tissue ifferentition (Louveu n Gonret, ). In ontrst, IGF file to erese ross gesttion in the group. The fining tht expression pttern of IGF iffere from tht of IGF1 is onsistent with previous oservtions in ulture porine preipoytes (Grn et l., 8); it further supports the ie tht these two IGF genes ply istint role on the evelopment of ipose ells. In our stuy, the evelopmentl expression pttern of IGF ws lose to tht of DLK1, gene for whih own-regultion is require for ipose onversion (Sul et l., ), n for whih the own-regultion tht normlly ours in eveloping ipose tissue (Deiuliis et l., ) ws not oserve in piglets. This suggests tht IGF my e relevnt

7 1 F. Gonret et l. / Generl n Comprtive Enorinology 19 (1) A Stge: P =. BW: P =. SxBW: P =.1 GLUT Stge: P <.1 BW: P =.9 SxBW: P =. INSR.8. B Stge: P <.1 BW: P <.1 SxBW: P =. IGF Stge: P =.7 BW: P =.18 SxBW: P =. IGF C...8 Stge: P <.1 BW: P =. SxBW: P =.17 IGFBP...8 Stge: P <.1 BW: P =. SxBW: P =.8 IGFBP5 Fig.. Expressions of genes relte to insulin tion n IGF xis. Expression levels of genes were mesure in suutneous ipose tissue of low (, h) or meium (, j) porine silings. (A) Insulin-epenent gluose trnsporter (GLUT) n insulin reeptor (INSR); (B) IGFs; (C) IGFBPs. For eh gene, reltive expression levels were ompre for the min effets of stge (S), weight (BW) group n the intertion etween stge n weight group (S BW). N = iniviuls per weight group t eh evelopment stge.,, : mens tht shre ommon supersript letter i not iffer. nite to ely ipose ell ifferentition. This ssumption is supporte y reent finings showing tht postntl own-regultions of DLK1 n IGF file to our in some emryonl ners, ontriuting to persistent ell prolifertion n filure in the norml somti growth eelertion (Rezvni et l., 1). A reent stuy hs lso ientifie IGF s fetl mitogen highly expresse uring the prolifertive phse of hemngiom growth, n inites tht high levels of IGF my regulte the tivity of the stem ells preventing terminl ifferentition into ipoytes (Kleimn et l., 1). Finlly, mny of the preite struturl n regultory imprinting fetures of the DLK1 n IGF omins re highly nlogous (Wylie et l., ). The urrent t re then onsistent with ely in the ifferentition of ipose tissue in piglets s result of moifitions in IGFs expressions. This sttement is supporte not only y the persistene of high levels of DLK1 expression roun irth in IUGR piglets ompre with their norml-size littermtes, ut lso y the prtilly-lunte inrese in the expression levels of mny genes involve in the progression of ipoyte ifferentition inluing PPARG. In greement with our results, onstitutive expression of DLK1 inhiits ipogenesis (Sul et l., ) n represses PPARG expression in ells (Jing et l., 9). This ifferene in the evelopmentl pttern of ipose genes s response to IUGR lso onerns CEBPA, gene whih hs een shown to initite the pre-ipoyte ifferentition progrm in the pig (Yu n Husmn, 1998). Altogether, the reution in expression levels of the pro-lipogeni FASN gene n the ipoyte-speifi mrker FABP in piglets t pn my ount for the lower iposity t irth of smll piglets reporte in mny stuies (Rehfelt n Kuhn, ; Morise et l., 9; Frons-Chuty et l., 1). The signifine of these erly post-ntl ifferenes for lter iposity is however less ler. Inee, expression levels of PPARG n FABP hve een lso foun lower t 7 pn in suutneous ipose tissue of smll piglets ut rther similr to those oserve in their norml littermtes t 1 pn (Willims et l., 9). Similrly, FASN expression hs een reporte to e similr in smll piglets n norml-size littermtes t 7 pn n onwrs (Rmsy et l., 1). Together, these t suggest tht the oserve hnges in the exmine genes re trnsient n re followe y n elerte th-up ft uring suking in piglets hving eing

8 F. Gonret et l. / Generl n Comprtive Enorinology 19 (1) smll t irth (Morise et l., 9). Beuse the rise in ipose tissue mss results from oth n inrese in ipoyte size n numer, the ltter eing meite y the evelopment of ell progenitors, we then questione whether genes ssoite with the ommitment of multi-potent ells to ipoyte linege were responsive to IUGR uring the lst thir of gesttion. Among other genes, WNT1B hs een suggeste to mintin preipoytes in n unifferentite stte, through eregultion of the ell yle (Ross et l., ; Christooulies et l., 9). Our stuy inites tht expression level of this gene ws not ffete y IUGR in porine fetl ipose tissue. The temporl expression of the Wnt ntgonist SFRP1, gene whih hs een reporte s pro-ipogeni in murine n humn ipoytes (Lgthu et l., 1), ws similr in n piglets. In ition, CCND1, ell-yle progression ftor for whih expression preees ifferentition of T-L1 murine preipoytes (Hishi et l., 8), ws not rmtilly ltere y IUGR. Therefore, we nnot efinitively nswer whether or not the prolifertion phse in ipose tissue is extene in response to IUGR, mehnism whih oul hve expline the greter numer of ipoytes previously reporte in smll piglet neontes ompre with their norml-size littermtes (Willims et l., 9). Finlly, the urrent stuy provies eviene tht the expression levels of vrious genes relte to insulin tion s well s insulin onentrtion itself were ltere y IUGR in the few ys fter irth. The of the insulin reeptor (INSR) n of the insulin-responsive gluose trnsporter GLUT in ipose tissue were mrkely greter in neontes thn in their littermtes. The plsm onentrtion of insulin, potent ipogeni hormone, ws lso.5-fol higher in neontes. Despite this high onentrtion, gluose onentrtion, the mjor sustrte proviing energy for fetl growth, i not hnge in response to IUGR. A reent stuy using metolomis hs onversely ientifie lower irulting onentrtions of gluose n ltere onentrtion in mino-is, without ny hnges in insulin onentrtion in the umilil vein of IUGR pig fetuses ompre with norml ones t 9 n 11 p (Lin et l., 1). The resons for these isrepnies re not known. With the ientifition of IUGR s risk ftor for impire gluose tolerne in mny speies (Vuguin, 7), our t suggest tht ipoytes of smll piglets might e resistnt to insulin in the few ys fter irth. Nevertheless, we hve no efinitive eviene for the persistene of this tion uring lter postntl life, euse our reent investigtion of gluose homeostsis h shown tht insulin seretion n gluose tolerne were not moifie y piglet s irth weight uring the sukling perio (Blt et l., 1). Beuse IUGR is onsiere s fetl pttion in response to plentl insuffiieny, we lso exmine the irulting onentrtions of other nutrients. Only frutose plsm onentrtion ws signifintly lower in fetuses thn in ones t the onset of the lst trimester of gesttion. These finings suggest tht lipi eposition in fetl pigs might e minly limite y hormonl n moleulr events within the fetus, wheres sustrte onentrtions my not e the rte-limiting ftors (Ksser et l., 198). Moreover, reution in loo flow my e more importnt thn plsm metolite onentrtions for fetl nutrition (Bir et l., ). In onlusion, euse fvoring white ipose tissue evelopment efore irth my ply role in pttion to extr-uterine life y preventing het loss s n isoltive proteting lyer ginst ol, serves s n energy reserve n(or) my simply to overll mturity of piglets, this stuy ontriutes to give lues for next geneti progrms or nutritionl interventions to improve piglet s survivl through hnges in the evelopmentl progrm of gene expressions in ipose tissue. 5. Funing This work ws supporte y grnt from INRA (Phse n AlimH ivisions), Frne. Aknowlegment Authors re grteful to the tehnil stff of UMR PEGASE, with speil mention to G. Svry, for niml re n tissue smpling. Referenes Assimkopoulos, E., Zfrks, M., Grmiris, P., Goulis, D.G., Athnsiis, A.P., Drgoumis, K., Bontis, J., 7. Fetl ominl suutneous tissue thikness mesure y ultrsoun t term is ssoite with irth weight n moe of elivery. Clin. Exp. Ostet. Gyneol., Bir, I.M., Zhng, L., Mgness, R.R.,. Possile mehnisms unerlying pregnny-inue hnges in uterine rtery enothelil funtion. Am. J. Physiol. Regul. Integr. Comp. Physiol. 8, R5 58. Blt, S., Morise, A., Suret, A., Louveu, I., Mé, K., Le Huërou-Luron, I., Sève, B., 1. The protein level of isoenergeti formule oes not moulte postprnil insulin seretion in piglets n hs no onsequenes on lter gluose tolerne. Br. J. Nutr. 18, Buge, H., Dnre, J., Mostyn, A., Evens, Y., Wtkins, R., Sullivn, C., Ingleton, P., Stephenson, T., Symons, M.E.,. Differentil effets of fetl numer n mternl nutrition in lte gesttion on proltin reeptor unne n ipose tissue evelopment in the neontl lm. Peitr. Res. 5, 8. Christooulies, C., Lgthu, C., Sethi, J.K., Vil-Puig, A., 9. Aipogenesis n WNT signlling. Trens Enorin. Metol., 1. Deiuliis, J.A., Li, B., Lyvers-Peffer, P.A., Moeller, S.J., Lee, K.,. Alterntive spliing of elt-like 1 homolog (DLK1) in the pig n humn. Comp. Biohem. Physiol. B: Biohem. Mol. Biol. 15, Ding, S.T., MNeel, R.L., Mersmnn, H.J., Expression of porine ipoyte trnsripts: tissue istriution n ifferentition in vitro n in vivo. Comp. Biohem. Physiol. B: Biohem. Mol. Biol. 1, Duffiel, J.A., Vuoolo, T., Tellm, R., Yuen, B.S., Muhlhusler, B.S., MMillen, I.C., 8. Plentl restrition of fetl growth ereses IGF1 n leptin mrna expression in the perirenl ipose tissue of lte gesttion fetl sheep. Am. J. Physiol. Regul. Integr. Comp. Physiol. 9, R11 R119. Frons-Chuty, A., Louveu, I., Le Huërou-Luron, I., Rozé, J.C., Drmun, D., 1. Air-isplement plethysmogrphy for etermining oy omposition in neontes: vlition using live piglets. Peitr. Res. 7, 1. Grn, D., Mourot, J., Louveu, I., 8. Derese expression of the IGF-II gene uring porine ipose ell ifferentition. Mol. Cell. Enorinol. 9, 8. Gonret, F., Perruhot, M.H., Ther, S., Bérr, J., Bee, G., 11. Differentil gene expressions in suutneous ipose tissue pointe to elye ipoyti ifferentition in smll pig fetuses ompre to their hevier silings. Differentition 81, 5. Husmn, G.J., Kuffmn, R.G., 198. The histology of eveloping porine ipose tissue. J. Anim. Si., 58. Hishi, T., Nito, K., Os, S., Nishizuk, M., Imgw, M., 8. Cruil roles of D- type ylins in the erly stge of ipoyte ifferentition. Biohem. Biophys. Res. Comm. 7, Jing, K., Heo, J.Y., Song, K.S., Seo, K.S., Prk, J.H., Kim, J.S., Jung, Y.J., Jo, D.Y., Kweon, G.R., Yoon, W., Hwng, B.D., Lim, K., Prk, J.I., 9. Expression regultion n funtion of Pref-1 uring ipogenesis of humn mesenhyml stem ells (MSCs). Biohim. Biophys. At 1791, Ksser, T.R., Husmn, G.J., Cmpion, D.R., Mrtin, R.J., 198. Lipogenesis n pnreti insulin relese in fetl pigs. J. Anim. Si. 5, Kim, H.S., Husmn, G.J., Husmn, D.B., Mrtin, R.J., Den, R.G.,. The expression of peroxisome prolifertor-tivte reeptor gmm in pig fetl tissue n primry stroml-vsulr ultures. Oesity Res. 8, Kleimn, A., Kets, E.C., Chn, N.G., Khn, Z.A., 1. Elevte IGF prevents leptin inution n terminl ipoyte ifferentition in hemngiom stem ells. Exp. Mol. Pthol. 9, 1 1. Lgthu, C., Christooulies, C., Tn, C.Y., Virtue, S., Lues, M., Cmpell, M., Ishikw, K., Orteg, F., Tinhones, F.J., Fernánez-Rel, J.M., Orešič, M., Sethi, J.K., Vil-Puig, A., 1. Serete frizzle-relte protein 1 regultes ipose tissue expnsion n is ysregulte in severe oesity. Int. J. Oes. (Lon.), Lin, G., Liu, C., Feng, C., Fn, Z., Di, Z., Li, C., Li, Z., Wu, G., Wng, J., 1. Metolomi nlysis revels ifferenes in umilil vein plsm metolites etween norml n growth-restrite fetl pigs uring lte gesttion. J. Nutr. 1, Louveu, I., Bonneu, M., 199. Effet of growth hormone infusion on plsm insulin-like growth ftor-i in Meishn n lrge white pigs. Repro. Nutr. Dev., 1 1. Louveu, I., Gonret, F.,. Regultion of evelopment n metolism of ipose tissue y growth hormone n the insulin-like growth ftor system. Domest. Anim. Enorinol. 7, 1 55.

9 1 F. Gonret et l. / Generl n Comprtive Enorinology 19 (1) 8 1 MPherson, R.L., Ji, F., Wu, G., Blnton, J.R., Kim, S.W.,. Growth n ompositionl hnges of fetl tissues in pigs. J. Anim. Si. 8, 5 5. Morise, A., Sève, B., Mé, K., Mgliol, C., Le Huërou-Luron, I., Louveu, I., 9. Impt of intruterine growth retrtion n erly protein intke on growth, ipose tissue, n the insulin-like growth ftor system in piglets. Peitr. Res. 5, 5 5. Mostyn, A., Pere, S., Stephenson, T., Symons, M.E.,. Hormonl n nutritionl regultion of ipose tissue mitohonril evelopment n funtion in the neworn. Exp. Clin. Enorinol. Dietes 11, 9. Quesnel, H., Brossr, L., Vlnogne, A., Quiniou, N., 8. Influene of some sow hrteristis on within-litter vrition of piglet irth weight. Animl, Rmsy, T.G., Stoll, M.J., Cpern, T.J., 1. Aipokine gene trnsription level in ipose tissue of runt piglets. Comp. Biohem. Physiol. B: Biohem. Mol. Biol. 155, Rehfelt, C., Kuhn, G.,. Consequenes of irth weight for postntl growth performne n rss qulity in pigs s relte to myogenesis. J. Anim. Si. 8, E11 E. Rehfelt, C., Lefuheur, L., Blok, J., Stenow, B., Pfuhl, R., Otten, W., Metges, C.C., Kle, C., 1. Limite n exess protein intke of pregnnt gilts ifferently ffets oy omposition n ellulrity of skeletl musle n suutneous ipose tissue of neworn n wenling piglets. Eur. J. Nutr. 51, Rezvni, G., Lui, J.C., Brnes, K.M., Bron, J., 1. A set of imprinte genes require for norml oy growth lso promotes growth of rhomyosrom ells. Peitr. Res. 71, 8. Ross, S.E., Hemti, N., Longo, K.A., Bennett, C.N., Lus, P.C., Erikson, R.L., MDougl, O.A.,. Inhiition of ipogenesis y Wnt signling. Siene 89, Smulin, J., Berget, I., Lien, S., Sunvol, H., 8. Differentil gene expression of ftty i ining proteins uring porine ipogenesis. Comp. Biohem. Physiol. B: Biohem. Mol. Biol. 151, Smulin, J., Berget, I., Grinflek, E., Lien, S., Sunvol, H., 9. Chnges in lipi metolism ssoite gene trnsripts uring porine ipogenesis. Comp. Biohem. Physiol. B: Biohem. Mol. Biol. 15, Stevens, D., Alexner, G., Bell, A.W., 199. Effet of prolonge gluose infusion into fetl sheep on oy growth, ft eposition n gesttion length. J. Dev. Physiol. 1, Sul, H.S., Sms, C., Mei, B., Zhou, L.,. Funtion of pref-1 s n inhiitor of ipoyte ifferentition. Int. J. Oes. Relt. Met. Disor., S15 9. Symons, M.E., Phillips, I.D., Anthony, R.V., Owens, J.A., MMillen, I.C., Proltin reeptor gene expression n foetl ipose tissue. J. Neuroenorinol. 1, Symons, M.E., Mostyn, A., Pere, S., Buge, H., Stephenson, T.,. Enorine n nutritionl regultion of fetl ipose tissue evelopment. J. Enorinol. 179, Symons, M.E., Pope, M., Buge, H., 1. Aipose tissue evelopment uring erly life: novel insights into energy lne from smll n lrge mmmls. Pro. Nutr. So. 71, 7. Tryhurn, P., Temple, N.J., Vn Aere, J., Eviene from immunolotting stuies on unoupling protein tht rown ipose tissue is not present in the omesti pig. Cn. J. Physiol. Phrmol. 7, Vuguin, P.M., 7. Animl moels for smll for gesttionl ge n fetl progrmming of ult isese. Horm. Res. 8, Wlters, E.M., Ag, Y., Gnjm, V., Evns, T., 11. Animl moels got you puzzle?: think pig. Ann. N Y A. Si. 15,. Wrshw, J.B., 199. Nutritionl orreltes of fetl growth. Dev. Phrmol. Ther. 15, 15. Willims, P.J., Mrten, N., Wilson, V., Litten-Brown, J.C., Corson, A.M., Clrke, L., Symons, M.E., Mostyn, A., 9. Influene of irth weight on gene regultors of lipi metolism n utiliztion in suutneous ipose tissue n skeletl musle of neontl pigs. Reproution 18, Wylie, A.A., Murphy, S.K., Orton, T.C., Jirtle, R.L.,. Novel imprinte DLK1/GTL omin on humn hromosome 1 ontins motifs tht mimi those implite in IGF/H19 regultion. Genome Res. 1, Yu, Z.K., Husmn, G.J., Expression of CCAAT/enhner ining proteins uring porine preipoyte ifferentition. Exp. Cell Res. 5, 9.