VEGFR2 but not VEGFR3 governs integrity and remodeling of thyroid angiofollicular unit in normal state and during goitrogenesis
|
|
|
- Dorcas Baldwin
- 5 years ago
- Views:
Transcription
1 Appendix VEGFR2 but not VEGFR3 gover integrity and remodeling of thyroid angiofollicular unit in normal state and during goitrogenesis Jeon Yeob Jang, Sung Yong Choi, Intae Park, Do Young Park, Kibaek Choe, Pilhan Kim, Young Keum Kim, Byung-Joo Lee, Masanori Hirashima, Yoshiaki Kubota, Jeong-Won Park, Sheue-Yann Cheng, Andras Nagy, Young Joo Park, Kari Alitalo, Minho Shong & Gou Young Koh Table of ntents: Appendix Figures S1-S6 Appendix table S1
2 A Thyroid gland Mesentery VEGF-C +/LacZ B Thyroid gland Bone marrow CD31 Ang1-GFP C Thyroid gland Retinal vessels CD31 Ang2-GFP Appendix Figure S1. Expression patter VEGF-C, Ang1 and Ang2 in thyroid gland and other orga. A Images showing VEGF-C expression in the thyroid gland and mesentery of adult VEGF-C +/LacZ mouse. Yellow arrow indicates the expression of VEGF-C in mesenteric lymphatic vessel as a positive control. Scale bars, 2 µm. B Images showing Ang1 expression in thyroid glands and megakaryocytes (yellow arrows) in bone marrow of Ang1-GFP reporter mouse at adulthood. Scale bars, 5 µm. C Images showing Ang2 expression in thyroid glands at adulthood and tip ECs (yellow arrows) of growing retinal vessels at P5 of Ang2-GFP reporter mice. Scale bars, 5 µm. Similar results were obtained from 3-4 different mice for each experiment.
3 p=.1 Serum TSH (ng/ml) ntrol T4 Appendix Figure S2. Serum concentratio of TSH in control or T4- or -treated mice. Error bars represent mean±s.d. Kruskal- Wallis test followed by Turkey s multiple comparison test was used., not significant.
4 6 PW 1 p=.4 4 PW 2 3 p= PW F p=.1 D 2 Height of thyrocytes (µm) Withdrawal (PW) FITC-Dextran E Vascular deity (%) CD31 C ntrol B Vascular diameter (µm) H&E A Appendix Figure S3. -induced thyroid angiofollicular remodeling is a reversible process. The adult mice were treated with control (), for 3 weeks. The thyroid glands were sampled and analyzed 3 weeks after the withdrawal of administration (PW). A-F Images and compariso of height of thyrocytes, CD31+ BV deity, and intravital FITC-dextran perfused BV diameter in control (), -treated () or -withdrawal (PW) mice. All scale bars, 5 µm. Each group, n = 4. Error bars represent mean±s.d. Kruskal-Wallis test followed by Turkey s multiple comparison test was used., not significant.
5 A ntrol T4 Glioblastoma CD31 GLUT1 CD31 Hypoxyprobe B C Hypoxyprobe + area (%) p=.21 T4 GBM D GLUT1 + area (%) p=.21 T4 GBM Appendix Figure S4. Tissue hypoxia is not detected in thyroid glands of control, T4-treated, -treated mice. A-D Images and compariso of tissue hypoxia status (Hypoxyprobe, GLUT-1) in thyroid glands of control (), T4-treated (T4), -treated () mice and implanted gloiblastoma tumor (GBM, positive control). Scale bars, 5 µm. Error bars represent mean±s.d. Each group, n = 4. Kruskal- Wallis test followed by Turkey s multiple comparison test was used., not significant.
6 ntrol VEGFR2 iec CD31 Appendix Figure S5. Images showing retinal blood vessels in control and VEGFR2 iec mice after tamoxifen administration at adulthood. Scale bars, 5 µm.
7 +VEGF-Trap B Vascular deity (%) ntrol CD31 Vascular diameter (µm) D FITC Dextran C F H&E E H 6 p=.4 p= p=.6 p= p=.16 p=.6 1 p=.5 Thyroid weights (mg) Thyroid gland G Height of thyrocytes (µm) A PVT 12 p=.5 p< Appendix Figure S6. Blockade of VEGF-A ameliorates angiofollicular remodeling during -induced goitrogenesis. A-F Images and compariso of CD31+ BV deity, intravital FITC-dextran perfused BV diameter, and height of thyrocytes in thyroid glands of control (), -treated (), or +VEGF-Trap-treated (PVT) mice. Scale bars, 5 µm. Error bars represent mean±s.d. Each group, n = 4. Kruskal-Wallis test followed by Turkey s multiple comparison test was used. G,H Gross image of thyroid glands and compariso of thyroid weights in control (), treated (), or +VEGF-Trap-treated (PVT) mice. Scale bars, 1mm. Error bars represent mean±s.d. Each group, n = 4. Kruskal-Wallis test followed by Turkey s multiple comparison test was used.
8 Appendix Table S1 Appendix table S1. Primer sets for semi-quantitative RT-PCR or quantitative real-time PCR analysis. Name Sequence (5-3 ) β-actin (housekeeping gene) 5 -GCTCTTTTCCAGCCTTCCTT-3 5 -CTTCTGCATCCTGTCAGCAA-3 VEGF-A (for RT-PCR) 5 -CAGGCTGCTCTAACGATGAA-3 5 -CAGGAATCCCAGAAACAACC-3 5 -CTCCACCATGCCAAGTGGTC-3 VEGF-A TCGTTACAGCAGCCTGCACA-3 VEGFR2 VEGF-C VEGF-D Ang1 Ang2 PDGF-A PDGF-B Pax8 TPO NIS 5 -ACCAGAAGTAAAAGTGATCCCAGA-3 5 -TCCACCAAAAGATGGAGATAATTT-3 5 -GACATGTCCAACAAACTATGTGTGG-3 5 -CTGTTACCATGGTCCCACAGAG-3 5 -GCCAGTATGGACTCACG-3 5 -CAATTATCAGAAGATCC-3 5 -TAGAGCTACCAACAACAACAGCA-3 5 -CCCTTTAGCAAAACACCTTCTTT-3 5 -CTCCAAGAGCTCGGTTGCTATCCG-3 5 -GGCCTTGATCTCCTCTGTGGAGTTG-3 5 -CTGCTCCTCGGCTGCGGATACCTC-3 5 -GAGTCGCTGGAGGTCCCGGATGCTG-3 5 -CACAGAGACTCCGTAGATGAAGATGGG-3 5 -CACTCGGCGATTACAGCAGGCTCTG-3 5 -ATGCCTCACAACTCGATCAGATCCG-3 5 -TGCCAAGGATCTTGCTTACACAGCC-3 5 -GCCACCAAGATGTCCTGACACCTG-3 5 -GGCAGTGGGAAGCCGTGGTATAAG-3 5 -GCCAACACTTCCAGAGGGATCCC-3 5 -TTGGGGCCACAGATGCTGTCTGC-3
SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.
Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Normalization of Tumor Vessels by Tie2 Activation and Ang2 Inhibition Enhances Drug Delivery and Produces a Favorable Tumor Microenvironment
Article Normalization of Tumor Vessels by Tie2 Activation and Ang2 Inhibition Enhances Drug Delivery and Produces a Favorable Tumor Microenvironment Graphical Abstract Authors Jin-Sung Park, Il-Kug Kim,
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
B16F1 B16F10 Supplemental Figure S1
B16F1 B16F1 Supplemental Figure S1 Representative microangiography images of B16F1 and B16F1 tumors grown in the cranial windows. FITC-dextran (2 million MW) was injected systemically to visualize blood
Supporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
University of Ulsan College of Medicine, Seoul 05505, Republic of Korea.
Nanoparticle-Assisted Transcutaneous Delivery of a Signal Transducer and Activator of Transcription 3-Inhibiting Peptide Ameliorates Psoriasis-like Skin Inflammation Jin Yong Kim 1,5, Jinhyo Ahn 3,4, Jinjoo
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Supplementary Information
Supplementary Information Lymphatic endothelial cells support tumor growth in breast cancer Esak Lee a, Niranjan B. Pandey a, and Aleksander S. Popel a,b a Department of Biomedical Engineering, Johns Hopkins
Blockade of Prolymphangiogenic VEGF-C suppresses Dry Eye Disease. Sunali Goyal MD
Blockade of Prolymphangiogenic VEGF-C suppresses Dry Eye Disease Sunali Goyal MD Mentor: Reza Dana, MD, MPH, MSc Claes Dohlman Chair in Ophthalmology Director, Cornea & Refractive Surgery Massachusetts
Supporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
Supplementary information - Table (1), Figures (12), and Videos (5)
Supplementary information - Table (1), Figures (12), and Videos (5) A soft, transparent, freely accessible cranial window for chronic imaging and electrophysiology Chaejeong Heo 1, Hyejin Park 1, 2, Yong-Tae
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Secreted AGR2 Helps Tumor Cells to Establish Its Microenvironment
SJTU-School of Pharmacy Secreted AGR2 Helps Tumor Cells to Establish Its Microenvironment Dawei Li, Prof. Center For Cell Engineering And Antibody Medicine Shanghai Jiao Tong University 1 Tumor Microenvironment:
Sox17 promotes tumor angiogenesis and destabilizes tumor vessels in mice
Research article Sox17 promotes tumor angiogenesis and destabilizes tumor vessels in mice Hanseul Yang, 1 Sungsu Lee, 1 Seungjoo Lee, 1 Kangsan Kim, 1 Yeseul Yang, 1 Jeong Hoon Kim, 2 Ralf H. Adams, 3,4
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/3/e1400244/dc1 Supplementary Materials for PlGF-induced VEGFR1-dependent vascular remodeling determines opposing antitumor effects and drug resistance to
Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2610 Figure S1 FSMCs derived from MSLN CLN transgenic mice express smooth muscle-specific proteins. Beta-galactosidase is ubiquitously expressed within cultured FSMCs derived from MSLN
VEGF-C shown to have major role in Age-Related Macular Degeneration (AMD)
ASX and Media release 9 May 2013 VEGF-C shown to have major role in Age-Related Macular Degeneration (AMD) Data presented at the Association for Research in Vision and Ophthalmology (ARVO) 2013 conference
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Intravital imaging of intestinal lacteals unveils lipid drainage through contractility
Intravital imaging of intestinal lacteals unveils lipid drainage through contractility Kibaek Choe,, Gou Young Koh, Pilhan Kim J Clin Invest. 2015;125(11):4042-4052. https://doi.org/10.1172/jci76509. Research
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance
Cancer Cell, Volume 25 Supplemental Information Angiocrine Factors Deployed by Tumor Vascular Niche Induce B Cell Lymphoma Invasiveness and Chemoresistance Zhongwei Cao, Bi-Sen Ding, Peipei Guo, Sharrell
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Double Antiangiogenic Protein, DAAP, Targeting VEGF-A and Angiopoietins in Tumor Angiogenesis, Metastasis, and Vascular Leakage
Article, DAAP, Targeting VEGF-A and Angiopoietins in Tumor Angiogenesis, Metastasis, and Vascular Leakage Young Jun Koh, 1,2,9 Hak-Zoo Kim, 1,2,9 Seong-Ik Hwang, 1,3 Jeung Eun Lee, 1,3 Nuri Oh, 1,3 Keehoon
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
Heterotypy and Angiogenesis
Heterotypy and Angiogenesis Tumors are perpetual wounds 1. Normally stroma and epithelia converse at a distance. 2. Juxtaposition of stroma and epithelia is indicative of tissue damage. 4. Activate strategies
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for LacZ activity, which reflects Egr1 expression. (A)
MicroRNA 132 mediated loss of p120rasgap activates endothelium to facilitate pathological angiogenesis
MicroRNA 132 mediated loss of p12rasgap activates endothelium to facilitate pathological angiogenesis Sudarshan Anand, Bharat K. Majeti, Lisette M. Acevedo, Eric A. Murphy, Rajesh Mukthavaram, Lea Scheppke,
PROSTATE MRI. Dr. Margaret Gallegos Radiologist Santa Fe Imaging
PROSTATE MRI Dr. Margaret Gallegos Radiologist Santa Fe Imaging Topics of today s talk How does prostate MRI work? Definition of multiparametric (mp) MRI Anatomy of prostate gland and MRI imaging Role
Supplemental Material
Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial
A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
SUPPLEMENTAL DATA. Lumen area ( m 2 )
Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Supplemental Data Tamoxifen administration to Vil-Scap- mice.
Supplemental Data FIGURE S1. Tamoxifen administration to Vil-Scap - mice. In the experiments shown in Fig. 1 to Fig. 5, tamoxifen (2 mg per dose) was dissolved in corn oil and administered by orogastric
Supporting Information
Supporting Information Huang et al. 10.1073/pnas.1215397109 SI Materials and Methods Animals and Tumor Models. FVB, Tie2 p -GFP/FVB, and C3H mice were bred and maintained in our gnotobiotic animal facility.
Tumor associated macrophages in endocrine-related cancers. Sun Wook Cho, M.D, Ph.D Seoul National University Hospital
Tumor associated macrophages in endocrine-related cancers Sun Wook Cho, M.D, Ph.D Seoul National University Hospital Tumor Microenvironment Fibroblasts Immune cells Angiogenesis Tumor microenvironment=cancer
SUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
Supplementary Figure 1
Supplementary Figure 1 Genetic labeling of microglia Male and female 2-3 month-old CreERT2;R26-tdTomato mice or CreERT2;R26-tdTomato;Iba1-eGFP transgenic mice were treated with 1x, 2x (48 h apart), or
Award Number: W81XWH TITLE: PRINCIPAL INVESTIGATOR: Michael Dellinger
AD Award Number: W81XWH-10-1-0052 TITLE: PRINCIPAL INVESTIGATOR: Michael Dellinger CONTRACTING ORGANIZATION: UT Southwestern Medical Center Dallas, TX 75390 REPORT DATE: February 2013 TYPE OF REPORT: Annual
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
label the basement membrane). Different fixation methods of EB-perfused P8 mice to optimize the combination
Supplementary Figure 1 Optimization of the tissue fixation protocol to combine EB perfusion and IB4 endothelial tip cell staining in the postnatal mouse brain. a-l Labeling of EB-perfused P8 mice with
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Bone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control
Bone Marrow Pop. (% Total) Mature Pool (Asolute %) Immature Pool (Asolute %) A10 EC A10 EC A10 EC Myeloid 50.7 57.5 37.5 46.2 13.2 11.3 Erythroid 38.3 23.2 33.3 16.8 9.3 6.3 Lymphocytes 13.8 19.0 - - -
Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
Angiogenesis as a therapeutic target
Angiogenesis as a therapeutic target Lecture Experimentelle Krebsforschung SS 07 Prof. Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences University of
Structural basis for the role of inhibition in facilitating adult brain plasticity
Structural basis for the role of inhibition in facilitating adult brain plasticity Jerry L. Chen, Walter C. Lin, Jae Won Cha, Peter T. So, Yoshiyuki Kubota & Elly Nedivi SUPPLEMENTARY FIGURES 1-6 a b M
Supplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
PAX8-PPARγ Fusion Protein in thyroid carcinoma
Sidney H. Ingbar Lecture, ATA 10/17/2013: PAX8-PPARγ Fusion Protein in thyroid carcinoma Ronald J. Koenig, MD, PhD Division of Metabolism, Endocrinology & Diabetes University of Michigan Learning Objectives
The Process of Angiogenesis & Inhibition of Angiogenesis and/or Lymphangiogenesis
The Process of Angiogenesis & Inhibition of Angiogenesis and/or Lymphangiogenesis Nam Deuk Kim, Ph.D. Pusan National University Contents Part 1. The process of angiogenesis Part 2. The role of angiopoietins
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
Supplementary Figure 1
Supplementary Figure 1 ZV 50 nm Relative to Protein Levels () C Relative to Protein Levels () 6 4 2 0 10 8 6 4 2 0 Treatment Time (6 h) ZV Concentration (25 µm) ZV Concentration (25 µm) Supplementary Figure
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted
Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted Ctns -/- mice. Cells immunolabeled for the proliferation marker (Ki-67) were counted in sections (n=3 WT, n=4
RIP-Tag2 mouse model as a Paradigm for Target. Search in NETs
RIP-Tag2 mouse model as a Paradigm for Target Search in NETs Oriol Casanovas, Ph.D. Tumor Angiogenesis Group INSTITUT CATALÀ d ONCOLOGIA IDIBELL Barcelona (SPAIN) Therapeutic Targeting of the Tumor Stroma
EPO, VEGF, chronic hypoxia adaptations and metabolism in the heart
EPO, VEGF, chronic hypoxia adaptations and metabolism in the heart BSc Catherine Privat M. Laboratorio de Transporte de Oxígeno Instituto de Investigaciones de Altura Dpto de Ciencias Biológicas y Fisiológicas
Supporting Information
Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected
CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells
CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
Short title: Endothelial mtorc2 controls aberrant angiogenesis
Endothelial Rictor is crucial for midgestational development and sustained and extensive FGF2 induced neovascularization in the adult Fabio Aimi 1+, Stavroula Georgiopoulou 1+, Ina Kalus 1, Fabienne Lehner
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
Supplementary Figure 1. Satellite cell contribution to myofibers in whole. gastrocnemius/plantaris/soleus, diaphragm, and EOM of 12 or 20 month
Keefe et al. p. 1 Supplementary Figure 1. Satellite cell contribution to myofibers in whole muscles. (a-l) Representative cross-sections through whole TA/EDL, gastrocnemius/plantaris/soleus, diaphragm,
SUPPLEMENTARY INFORMATION. Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes
Di Salvio et al. 1 SUPPLEMENTARY INFORMATION Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes vulnerability to MPTP Michela Di Salvio, Luca Giovanni Di Giovannantonio, Dario
Dipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin. Phosphorylation
Dipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin Phosphorylation Choon-Soo Lee, PhD, 1,2,4 * Yun Gi Kim, MD, 3 * Hyun-Jai Cho, MD, 1,2,3 Jonghanne Park, MD, 1,2,3
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K.
Changes in the seroprevalence of IgG anti-hepatitis A virus between 2001 and 2013: experience at a single center in Korea
pissn 2287-2728 eissn 2287-285X Original Article Clinical and Molecular Hepatology 214;2:162-167 Changes in the seroprevalence of IgG anti-hepatitis A virus between 21 and 213: experience at a single center
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
Curriculum Vitae. Dissertation Title M.S. Thesis: Regulation of Notch1 signaling by Runx2 during osteoblast differentiation.
Curriculum Vitae Name: Eun-Jung Ann Education Mar.2009 : Ph.D. in Graduate School of Biological Sciences and Technology, Chonnam National University Mar.2007 Feb. 2009: M.S. in Graduate School of Biological
Modeling lymphangiogenesis in a three-dimensional culture system
Modeling lymphangiogenesis in a three-dimensional culture system Françoise Bruyère, Laurence Melen-Lamalle, Silvia Blacher, Guy Roland, Marc Thiry, Lieve Moons, Francis Frankenne, Peter Carmeliet, Kari
Real-time imaging reveals the single steps of brain metastasis fo mation r
Real-time imaging reveals the single steps of brain metastasis fo mation r Yvonne Kienast, Louisa von Baumgarten, Martin Fuhrmann, Wolfgang E.F. Klinkert, Roland Goldbrunner, Jochen Herms and Frank Winkler
Supplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,
Jun-Won Lee, Sang Wook Park, Jung-Woo Son, Young Jin Youn, Min-Soo Ahn, Sung Gyun Ahn, Jang-Young Kim, Byung-Soo Yoo, Junghan Yoon, Seung-Hwan Lee
The procedural success and complication rate of the left distal radial approach for coronary angiography and percutaneous coronary intervention. Prospective observational study (LeDRA) Jun-Won Lee, Sang
Angiopoietin-1 (Ang1) is known to be a ligand to Tie2
Long-Term and Sustained COMP-Ang1 Induces Long-Lasting Vascular Enlargement and Enhanced Blood Flow Chung-Hyun Cho, Kyung Eun Kim, Jonghoe Byun, Hyung-Suk Jang, Duk-Kyung Kim, Peter Baluk, Fabienne Baffert,
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.