SUPPLEMENTARY INFORMATION. Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes
|
|
|
- Darcy Moses Hawkins
- 5 years ago
- Views:
Transcription
1 Di Salvio et al. 1 SUPPLEMENTARY INFORMATION Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes vulnerability to MPTP Michela Di Salvio, Luca Giovanni Di Giovannantonio, Dario Acampora, Raffaele Prosperi, Daniela Omodei, Nilima Prakash, Wolfgang Wurst and Antonio Simeone
2 Di Salvio et al. 2 Supplementary Fig. 1. Generation of the R26 Otx2/+ mutant and Otx2 over-expression in ES cells. (a) Schematic representation of the R26 locus (upper line) where the Neo-Otx2 Ires GFP cassette is inserted (second line). (b) Genomic analysis with probe A confirming the correct insertion of the Neo-Otx2 cassette. (c) R26 Otx2/CreER and totx2 ov/+ ;R26 CreER/+ ES cell lines are compared before and after Tamoxifen administration to monitor the removal of the Neo-triple polya cassette, the relative level of the over-expressed Otx2 and GFP activation. The horizontal arrow in (a) indicates the transcription start site; the horizontal arrowheads the position of primers for genotyping. The probe A used for Southern blot analysis was also indicated.
3 Di Salvio et al. 3 Supplementary Fig. 2. The expression of Pitx3, Foxa2 and Nurr1 is apparently not affected by lack or activation of Otx2. (a r) Immunohistochemistry experiments on week old Dat ICre/+ ;Otx2 GFP/+ (a c) Dat ICre/+ ;Otx2 GFP/flox (d f), Dat ICre/+ (g i, m o) and Dat ICre/+ ;R26 Otx2/Otx2 ;totx2 ov/ov (j l, p r) mice with Pitx3-GFP (a,d), Foxa2-GFP (b,e), Nurr1- GFP (c,f), Pitx3-TH (g,j,m,p), Foxa2-TH (h,k,n,q) and Nurr1-TH (i,l,o,r) show no evident abnormalities in mutant brains. Scale bar in (a,g) corresponds to 100µm (a) and 200µm (g). Scale bar in (a) refers to sections in (a f, m r); scale bar in (g) to sections in (g l).
4 Di Salvio et al. 4 Supplementary Fig. 3. Activation of Otx2 extra-copies does not affect the survival of mdda neurons. Graphic representation showing that, compared to week old Dat ICre/+ control mice (n = 10), the percentage of SNpc and VTA TH + neurons is not significantly affected by activation of Otx2 extra-copies in any of the analyzed mouse mutants (n = 10/genotype) (P between Dat ICre/+ and each mutant is 0.22 for both SNpc and VTA; Student t test).
5 Di Salvio et al. 5 Supplementary Fig. 4. Activation of high dosages of Otx2 does not affect the identity of SNpc neuronal subsets. (a) Graphic representation showing that, compared to week old Dat ICre/+ (n = 7) control mice, the percentage of SNpc TH + neurons co-expressing Calb, Ahd2 and Girk2 is not significantly affected in Dat ICre/+ ;R26 Otx2/Otx2 (n = 7) and Dat ICre/+ ;R26 Otx2/Otx2 ;totx2 ov/ov (n = 7) mutants of the same age ( P 0.1 for Calb; P 0.18 for Ahd2; P 0.12 for Girk2; Student t test). (b j) Representative SNpc sections of Dat ICre/+ (b,e,h), Dat ICre/+ ;R26 Otx2/Otx2 (c,f,i) and Dat ICre/+ ;R26 Otx2/Otx2 ;totx2 ov/ov (d,g,j) mice immunostained with TH-Calb (b d), TH-Ahd2 (e g) and TH-Girk2 (h j) reveal no evident abnormalities in mutants. Scale bar (b) corresponds to 200µm and refers to all sections.
6 Di Salvio et al. 6 Supplementary Fig. 5. A second glyco-dat antibody confirms altered number of neurons with high level of glyco-dat in Otx2 mutants. (a d) Immunohistochemistry assays with a second glyco-dat antibody show that compared to Dat ICre/+ ;Otx2 GFP/+ mice (a,b), Dat ICre/+ ;Otx2 GFP/flox mutants (c,d) exhibit an increased number of glyco-dat + -GFP + neurons in the central VTA. (e) Graphic representation showing that, compared to Dat ICre/+ ;Otx2 GFP/+ control mice, in Dat ICre/+ ;Otx2 GFP/flox mutants a significant increase in the number of neurons co-expressing high level of glyco-dat and GFP was detected (26% vs 13.5% of control mice, * P <<0.001; Student t test). (f m) Immunohistochemistry assays on Dat ICre/+ (f i) and Dat ICre/+ ;R26 Otx2/Otx2 ;totx2 ov/ov (j m) mice show that in the SNpc (f,g,j,k) and VTA (h,i,l,m) the number of TH + neurons expressing high level of glyco-dat is remarkably diminished in mutants (j m). (n) Graphic representation showing that the percentage of TH + neurons expressing high level of glyco-dat is significantly decreased in both SNpc (18% vs 51.7% of control mice, * P <<0.001; Student t test) and VTA (10.5% vs 23.7% of control mice, ** P <<0.001; Student t test) of mutant mice. (o) Western blot assay performed on striatal extracts shows an evident reduction of glyco-dat in Dat ICre/+ ;R26 Otx2/Otx2 ;totx2 ov/ov mutants. (b,d,g,k,i,m) are magnifications of the area boxed in (a,c,f,j,h,l). (D,C,V) stand for dorsal, central and ventral VTA. Scale bar in (a,b,f,g) corresponds to 100µm (a,b) and 200µm (f,g). Scale bar in (a) refers to sections in (a,c,h,l); scale bar in (b) refers to sections in (b,d,i,m); scale bar in (f) to (f,j); and scale bar in (g) to (g,k).
7 Di Salvio et al. 7 Supplementary Fig. 6. Schematic summary of the phenotypic impairments detected in the VTA of mouse mutants lacking or ubiquitously expressing extra-copies of Otx2. (a) Otx2 is normally expressed in a relevant fraction of VTA neurons prevalently confined to the central and medial-ventral region of the VTA, even though few Otx2 + neurons may be detected also in dorsal-lateral neurons which in large majority are Girk2 + and glyco-dat +. (b) In the absence of Otx2, a relevant increase in the number of GFP + neurons expressing Girk2 and glyco-dat was detected in the central region of the VTA. This increase is reminiscent of a medial-ventral expansion of the dorsal-lateral identity. (c) Conversely, Dat ICre/+ ;R26 Otx2/Otx2 or Dat ICre/+ ;R26 Otx2/Otx2 ;totx2 ov/ov mutants exhibit a repression of the dorsal-lateral identity. Together these abnormalities lead us to hypothesize a presumptive boundary running between the two subpopulations of VTA neurons expressing or not Otx2 (black line). Neurons are represented as filled circles and the number of those expressing the different combinations of markers (filled circles in red, yellow, green, and pale blue) approximately reflects to the experimental percentages. (D, C, V) stand for dorsal, central and ventral VTA and correspond to areas with low, intermediate and high density of Otx2 + -TH + neurons.
8 Di Salvio et al. 8 Supplementary Fig. 7. Full length Western blots and RT-PCRs gel showing the results reported in Figs. 4j and 5a,b. The lanes selected are demarcated by a box and the antibody used is shown below each square. For the RT-PCR experiments the lanes corresponding to Dat, TH and Nurr1 mrnas are also boxed.
9 Di Salvio et al. 9 Supplementary Fig. 8. Anatomical levels along the SNpc and VTA analyzed in all cellcounting experiments. (a l) Sequential sections along the SNpc and VTA are selected from level 2 to 5 (b e, h k) for all the cell-counting experiments. Sections at level 1 and 6 (a,g,f,l) are always excluded. The demarcated area defines the SNpc and VTA territory analyzed. Since no abnormalities are detected in the general morphology of the SNpc and VTA in the mutants analyzed, the criteria employed for selection of control sections are applied also to the mutants. Scale bar in (a,g) corresponds to 200µm (a) and 100µm (g). Scale bar in (a) refers to sections in (a f); scale bar in (g) to sections in (g l).
10 Di Salvio et al. 10 Table S1 Cell counting experiments in mice lacking or expressing extra-copies of Otx2 Number of mdda neurons (mean ± s.d.) Genotype Mice (n) GFP + TH + GFP + -TH + GFP -TH + GFP + -TH Dat ICre/+ ;Otx2 GFP/ ± ± ± ± ± 40 Dat ICre/+ ;Otx2 GFP/flox ± ± ± ± ± 31 GFP + Calb + -GFP + Ahd2 + -GFP + Girk2 + -GFP + Dat ICre/+ ;Otx2 GFP/ ± ± ± ± 17 Dat ICre/+ ;Otx2 GFP/flox ± ± ± ± 22 GFP + glyco-dat + -GFP + Dat ICre/+ ;Otx2 GFP/ ± ± 31 Dat ICre/+ ;Otx2 GFP/flox ± ± 25 TH in SNpc TH in VTA Dat ICre/ ± ± 112 Dat ICre/+ ;R26 Otx2/ ± ± 104 Dat ICre/+ ;totx2 ov/ov ± ± 99 Dat ICre/+ ;R26 Otx2/Otx ± ± 103 Dat ICre/+ ;R26 Otx2/Otx2 ; ± ± 87 totx2 ov/ov SNpc TH + Calb + -TH + Ahd2 + -TH + Girk2 + -TH + Dat ICre/ ± ± ± ± 37 Dat ICre/+ ;R26 Otx2/Otx ± ± ± ± 35 Dat ICre/+ ;R26 Otx2/Otx2 ; ± ± ± ± 38 totx2 ov/ov TH + Calb + -TH + Ahd2 + -TH + Girk2 + -TH + Dat ICre/ ± ± ± ± 36 Dat ICre/+ ;R26 Otx2/Otx ± ± ± ± 51 Dat ICre/+ ;R26 Otx2/Otx2 ; ± ± ± ± 54 totx2 ov/ov SNpc TH + glyco-dat + -TH + TH + glyco-dat + -TH + Dat ICre/ ± ± ± ± 61 Dat ICre/+ ;R26 Otx2/Otx2 ; ± ± ± ± 35 totx2 ov/ov VTA VTA
11 Di Salvio et al. 11 Table S2 Cell counting experiments in mice lacking or expressing extra-copies of Otx2 Number of mdda neurons (mean ± s.d.) VTA Genotype Mice (n) GFP + glyco-dat + -GFP + Dat ICre/+ ;Otx2 GFP/ ± ± 25 Dat ICre/+ ;Otx2 GFP/flox ± ± 41 SNpc VTA TH + glyco-dat + -TH + TH + glyco-dat + -TH + Dat ICre/ ± ± ± ± 33 Dat ICre/+ ;R26 Otx2/Otx2 ; ± ± ± ± 30 totx2 ov/ov
12 Di Salvio et al. 12 Table S3 Cell counting experiments in MPTP-treated and untreated mice Number of VTA TH + neuronal subsets (mean ± s.d.) MPTP-treated (100mg/Kg) MPTP-untreated* Genotype Mice (n) TH + GFP + -TH + GFP -TH + TH + GFP + -TH + GFP -TH + Dat ICre/+ ;Otx2 GFP/ ± ± ± ± ± ± 47 Dat ICre/+ ;Otx2 GFP/flox ± ± ± ± ± ± 49 MPTP-treated (125mg/Kg) Dat ICre/+ ;Otx2 GFP/ ± ± ± 44 Dat ICre/+ ;Otx2 GFP/flox ± ± ± 36 Number of TH + neurons (mean ± s.d.) MPTP-treated (125mg/Kg) SNpc MPTP-untreated* SNpc Dat ICre/+ ;Otx2 GFP/ ± ± 56 MPTP-treated (100mg/Kg) MPTP-untreated* SNpc VTA SNpc VTA Dat ICre/ ± ± ± ± 112 Dat ICre/+ ;R26 Otx2/Otx ± ± ± ± 103 Dat ICre/+ ;R26 Otx2/Otx2 ; ± ± ± ± 87 totx2 ov/ov * Neuronal numbers for MPTP-untreated mice correspond to those of Supplementary Table 1
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
Nature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.
Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo
Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression
Supplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
Supplementary Figure 1
Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,
Specification of dopaminergic subsets involves interplay of En1 and Pitx3
4116 CORRIGENDUM Development 140, 4116 (2013) doi:10.1242/dev.102731 2013. Published by The Company of Biologists Ltd Specification of dopaminergic subsets involves interplay of En1 and Pitx3 Jesse V.
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
Supplementary Information
Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
Etv4 BU EMM Etv5 BC MMM UI-M-BH3- Elk1 BC MMM
Supplementary Tables In situ hybridization probes Genbank Gene Accession Number Clone ID Cat. No Etv1 BC005645 PCR Etv4 BU053662 5062538 EMM1002-5544031 Etv5 BC034680 4036564 MMM1013-7511524 Fev AI876263
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Myod +/ or Myod / females and Myod +/ ;Igf2 +/ males and
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Supplementary Figure 1
Supplementary Figure 1 Genetic labeling of microglia Male and female 2-3 month-old CreERT2;R26-tdTomato mice or CreERT2;R26-tdTomato;Iba1-eGFP transgenic mice were treated with 1x, 2x (48 h apart), or
Dopamine in Ube3a m-/p+ mice. Online Supplemental Material
Online Supplemental Material S1 Supplemental Figure 1. Schematic of rate-dependent intracranial self-stimulation (ICSS) (A) Mice implanted with monopolar stimulating electrodes to the medial forebrain
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2697 Figure S1 Cytokeratin 5 is a specific marker for basal and intermediate cells in all mouse prostate lobes. (a) Immunofluorescence staining showing co-localization of YFP with p63 in
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants
SUPPLEMENTAL FIGURE LEGENDS: Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants (Sgpl1 -/- and Plekha1 -/- ). Using an antibody against CYP11a1 to label Leydig
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Nature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.
Supplementary Figure 1 Splenic atrophy and leucopenia caused by T3 SCI. (a) Gross anatomy of representative spleens from control and T3 SCI mice at 28 days post-injury. (b and c) Hematoxylin and eosin
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice
Supplementary information The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice Kanako Tatsumi 1, 2, Harumi Yamamoto-Mukai 2, Ritsuko Shimizu 3, Satoshi Waguri 4, Yu-Shin
Supplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
stability and tumor suppression
Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Supplementary Figure 1
Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific
Fig. S1. Schematic representation of the two RBC membrane:cytoskeleton anchorage
Supplemental data Fig. S1. Schematic representation of the two RBC membrane:cytoskeleton anchorage complexes. Left, 4.1R complex; right, ankyrin-based complex. Adapted from (1) where abbreviations are
SUPPLEMENTARY INFORMATION
Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
doi: /nature09554
SUPPLEMENTARY INFORMATION doi:10.1038/nature09554 Supplementary Figure 1: Optical Tracing with New Photoactivatable GFP Variants Reveals Enhanced Labeling of Neuronal Processes We qualitatively compare
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
Supplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed
Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed in the testes. The testes were immunostained with GFP
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression.
Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. (a) Characterization of c-independent SP8 cells. Stainings for maturation markers (top)
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Accepted Manuscript. Review. Establishing Diversity in the Dopaminergic System. Gabriela O. Bodea, Sandra Blaess
Accepted Manuscript Review Establishing Diversity in the Dopaminergic System Gabriela O. Bodea, Sandra Blaess PII: S0014-5793(15)00840-6 DOI: http://dx.doi.org/10.1016/j.febslet.2015.09.016 Reference: