Supplementary Information. Conformational states of Lck regulate clustering in early T cell signaling

Size: px
Start display at page:

Download "Supplementary Information. Conformational states of Lck regulate clustering in early T cell signaling"

Transcription

1 Supplementary Information Conformational states of Lck regulate clustering in early T cell signaling Jérémie Rossy, Dylan M. Owen, David J. Williamson, Zhengmin Yang and Katharina Gaus Centre for Vascular Research and Australian Centre for Nanomedicine, University of New South Wales, Sydney, Australia Correspondence should be addressed to KG (k.gaus@unsw.edu.au)

2 Supplementary Fig. 1. Quantitative cluster analysis of PALM and dstorm data. (a-b) TIRF (a) and corresponding PALM (b) images of Lck-PS-CFP2 expressed in a JCaM1 cell on activating anti-cd3+anti-cd28 antibody-coated glass coverslips for 10 min. Bar = 5 µm. (c) Histogram of the localisation precision for the image shown in b, with a mean 21 nm. Dotted line indicates threshold for precision (<50 nm). (d-e) Analysis of repeated excitation from the same molecule. Number of molecular localizations (symbols) of Lck-PS-CFP2 expressed in JCaM1 cells (d) and wild-type Lck expressed in JCaM1 cells and stained with primary antibodies and secondary DyLight 649 F(ab')2 fragments (e) plotted against the off-gap. Data was fitted to Equation 1 (solid lines). PS-CFP2 exhibited 0.1 blinks per molecule for 0.5 frames (20 ms) and 1.2 blinks per molecule for 13.7 frames (548 ms). DyLight649 blinked an average of 0.7 times for an average dark-time of 0.5 frames (15 ms) and 1.4 blinks per molecule for 5 frames (150 ms). Based on this analysis, we applied an off-gap of 10 frames for PS-CFP2 and 30 frames for DyLight649, which accounted for over 97% of the molecular over-estimation caused by multiple blinking, to all our data. Hence, clustering is not caused by repeated excitation of the same molecule. Data are from cells obtained from three independent experiments.

3 Supplementary Fig. 2. Comparison of TIRF and PALM images (a-c), activation of JCaM1 cells (d) and clusters of phosphorylated Lck (e-f). (a-c) Lck microclusters (red squares) are visible in the TIRF image (a), that are composed of a higher density of Lck molecules (PALM image, b) that are detected as several discreet nanoclusters based on Getis and Franklin s local point pattern analysis (color-coded cluster map, c). Scale bar = 2 µm. (d) Maxima of Ripley s K-function curves of Lck clustering in JCaM1 cells on glass coverslips coated with anti-cd3 alone or anti-cd3+anti-cd28 antibodies. Points represent one image region. NS; not significant (Student s t-test). Data are from 8-12 cells from four independent experiments. (e) Anti-p-Y394 Lck antibodies recognize Lck in the open and closed conformation. dstorm image of ptyr394-src family kinases (middle) and color-coded cluster maps (right) of highlighted region in JCaM1 cells expressing wild-type Lck on anti-cd3+anticd28-coated glass coverslips. (e-f) Bar = 5 µm (middle); bar = 500 nm (right). (f) Anti-p-Y505 Lck antibodies recognize Lck in the open and closed conformation. dstorm image of ptyr505-lck (middle) and cluster map (right) of indicated region in a JCaM1 cell expressing wild-type Lck on anti-cd3+anti-cd28 antibody-coated glass coverslips. Secondary stain of antibodies was DyLight 649 F(ab')2 fragments.

4 Supplementary Fig. 3. Distribution analysis of clusters. (a-f) Ripley s K-function analysis of the center-of-mass coordinates of wild-type Lck clusters in resting JCaM1 cells (a), wild-type Lck clusters in the periphery (b) and center of the activation zone in activated JCaM1 cells (c), phosphorylated TCRζ (p-tcrζ) in the periphery (d) and center (e) of the activation zone, and CD45 clusters in activated cells (f) obtained from the thresholded cluster maps. If clusters themselves are randomly distributed, the L(r)-r curves (red lines) fall within the 99% confidence intervals (black lines) that were calculated from 100 spatially random simulated distributions. Only Lck clusters in the center of the activation zone on large radial scales and clusters of phosphorylated TCR in the center of the activation zone were clustered themselves.

5 Supplementary Fig. 4. Lck10 clustering in resting and activated Jurkat E6.1 cells. (a) Ripley s K-functions of Lck10 expressed in Jurkat cells on PLL-coated glass coverslips (Rest) or on activating anti-cd3+anti-cd28 antibody-coated glass coverslips (Act) plotted against radius, r, of concentric circles centered on each molecule. 99% CI represents 99% confidence intervals based on simulated data. (b) Maxima of Ripley s K-function curves, as plotted in a. (c) Cluster radius in nm, obtained from thresholded cluster maps. (d) Circularity of clusters obtained from thresholded cluster maps. Circularity of clusters was calculated as 4π(area/perimeter 2 ). Lck10 displayed a different clustering behavior in WT Jurkat E6.1 cells compared to JCaM1 cells that lacked endogenous expression of Lck. In JCaM1 cells, TCR activation reorganized Lck from a near random distribution to a low level of clustering, whereas in Jurkat E6.1 cells, Lck10 distribution remained near random. We propose that in Jurkat E6.1 cells, endogenous Lck competes with Lck10 for microdomains residency, preventing Lck10 to be re-organized upon TCR activation. In b-d, points represent one image region, horizontal bars and error bars show mean and SEM, respectively. * P < (Student s t-test). Data are from cells from three independent experiments.

6 Supplementary Fig 5. Inhibition of membrane condensation by incorporation of the oxysterol 7-ketocholesterol (7KC) does not affect Lck clustering. To inhibit the membrane condensation upon TCR activation, JCaM1 cells were activated on anti- CD3+anti-CD28 antibody-coated glass coverslips for 10 min and treated with 5 µm 7KC for the last 1.5 min of the activation period before fixation. (a) Ripley s K-function curves of control (Ctrl) and 7KC-treated cells calculated for individual image regions and plotted against radius, r, of concentric circles centered on each molecule. 99% CI represents 99% confidence intervals based on simulated data. (b) Maxima of Ripley s K-function curves, as plotted in a. (c-d) Percentages of Lck molecules in clusters (c), ratio of the molecular densities inside clusters to molecular densities outside clusters (d), clusters radii in nm (e), and cluster numbers per µm 2 (f) obtained from thresholded cluster maps. Points represent one image region, horizontal bars and error bars show mean and SEM, respectively. All data are not statistically significant (P > 0.05, Student s t-test). Data are from 13 cells from three independent experiments.

7 Supplementary Fig. 6. Kinase activity does not influence Lck clustering. (a) Ripley s K-functions of wild-type Lck and the kinase dead Lck mutant, R273A Lck, expressed in JCaM1 cells on anti-cd3+anti-cd28 antibody-coated glass coverslips plotted against radius, r, of concentric circles centered on each molecule. 99% CI represents 99% confidence intervals based on simulated data. (b) Maxima of Ripley s K-function curves, as plotted in a. (c-d) Percentages of Lck molecules in clusters (c), ratio of the molecular densities inside clusters to molecular densities outside clusters (d), clusters radii in nm (e), and cluster numbers per µm 2 (f) obtained from thresholded cluster maps. Points represent one image region, horizontal bars and error bars show mean and SEM, respectively. Wild-type Lck data are identical to Fig. 1. No significant differences were found (P > 0.05, one-way ANOVA test). Data are from 14 cells from three independent experiments.

8 Supplementary Fig. 7. TCR activation has no impact on CD45 clustering. (a-c) JCaM1 cells expressing wild-type Lck on non-activating PLL surfaces (Rest) or on anti- CD3+anti-CD28 antibody-coated glass coverslips (Act) were stained with anti-cd45 antibodies. CD45 localizations were imaged with dstorm and analyzed as described in Online Methods. Percentage of CD45 molecules in clusters (a), ratios of the molecular densities inside clusters to molecular densities outside clusters (b), and clusters radii in nm (c) obtained from thresholded cluster maps. Points represent one image region; horizontal bars and error bars show mean and SEM, respectively. No significant differences were found (P > 0.05; Student s t-test). Data are from 10 cells from two independent experiments.

9 Supplementary Fig. 8. An Lck-centric model of early T cell signaling links intra-molecular rearrangements to surface patterning of signaling molecules. (a) In resting T cells, Lck is present in the active, open and inactive, closed conformations and selfassociates to form nano-scaled clusters containing 26 ± 7% of Lck molecules. The conformational flexibility of Lck continuously redistributes the kinase in and out of clusters and some Lck cluster co-localize with clusters of the phosphatase CD45. (b) After TCR triggering, segregation of CD45 clusters from Lck clusters increases the proportion of Lck in open conformation in and around the pre-existing Lck nano-clusters. This local increase in open conformation leads to the expansion and densification of Lck clusters to a radius of 51 ± 5 nm incorporating 43 ± 8% of Lck molecules (c) From the nano-scaled re-arrangement upon TCR triggering, a micro-scaled organization emerges in activated T cells, where the phosphorylated receptor and Lck co-localize in common domains to promote phosphorylation of the ITAM domains in the TCRζ chains. The reduced clustering dynamics of Lck in the open conformation may further stabilize TCR microclusters for sustained signaling.

10 Supplementary Movie 1. High clustering dynamics of wild-type Lck during TCR activation. Live cell cluster maps of 1,500-frame windows (equivalent to 45 s) shifted by 250 frames (7.5 s) of a JCaM1 cell expressing wild-type Lck-mEos2 on an anti-cd3+anti-cd28 antibody-coated glass coverslip imaged for 15 min at 37 C. Color-coded cluster maps were generated from local point pattern analysis and color-coded as indicated in Fig. 5. Image size is 4 µm x 4 µm. Supplementary Movie 2. Reorganization of a wild-type Lck cluster during TCR activation. Live cell cluster map movie (Supplementary Movie 1) of a JCaM1 cell expressing wild-type LckmEos2 on an anti-cd3+anti-cd28 antibody-coated glass coverslip was thresholded and cropped to generate a time series of a hot spot in which an Lck cluster formed, moved laterally, fragmented and reformed. Points are individual wild-type Lck molecules associated with this cluster. Each frame in the movie corresponds to 45s with 7.5s time intervals between frames. Image size is 750 nm x 750 nm. Supplementary Movie 3. Clustering dynamics of Y505F Lck during TCR activation. Live cell cluster maps of 1,500-frame windows (equivalent to 45 s) shifted by 250 frames (7.5 s) of a JCaM1 cell expressing Y505F Lck-mEos2 on an anti-cd3+anti-cd28 antibody-coated glass coverslip imaged for 15 min at 37 C. Color-coded cluster maps were generated from local point pattern analysis and color-coded as indicated in Fig. 5. Image size is 4 µm x 4 µm. Supplementary Movie 4. Stability of a cluster of Y505F Lck during TCR activation. Live cell cluster map movie (Supplementary Movie 3) of a JCaM1 cell expressing Y505F LckmEos2 on an anti-cd3+anti-cd28 antibody-coated glass coverslip was thresholded and cropped to generate a time series of a single Lck cluster those morphology changed over time but the cluster itself was stable. Points are individual Y505F Lck molecules associated with this cluster. Each frame in the movie corresponds to 45s with 7.5s time intervals between frames. Image size is 750 nm x 750 nm.

Nature Immunology: doi: /ni.3631

Nature Immunology: doi: /ni.3631 Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above

More information

Supplementary material. VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular

Supplementary material. VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular Supplementary material VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular Lat to the TCR activation sites. Paola Larghi, David J Williamson, Jean-Marie Carpier,

More information

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys

More information

Nature Biotechnology: doi: /nbt.3828

Nature Biotechnology: doi: /nbt.3828 Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus

More information

Probing protein heterogeneity in the plasma membrane using PALM and pair correlation analysis

Probing protein heterogeneity in the plasma membrane using PALM and pair correlation analysis Nature Methods Probing protein heterogeneity in the plasma membrane using PALM and pair correlation analysis Prabuddha Sengupta, Tijana Jovanovic-Talisman, Dunja Skoko 1, Malte Renz, Sarah L Veatch & Jennifer

More information

HDL surface lipids mediate CETP binding as revealed by electron microscopy and molecular dynamics simulation

HDL surface lipids mediate CETP binding as revealed by electron microscopy and molecular dynamics simulation HDL surface lipids mediate CETP binding as revealed by electron microscopy and molecular dynamics simulation Meng Zhang 1, River Charles 1, Huimin Tong 1, Lei Zhang 1, Mili Patel 2, Francis Wang 1, Matthew

More information

a Anti-Dab2 RGD Merge

a Anti-Dab2 RGD Merge a Anti-Da Merge *** ** Percentage of cells adhered 8 6 4 RGE RAD RGE RAD Supplementary Figure Da are localized at clusters. (a) Endogenous Da is localized at clusters. (), ut not RGE nor RAD peptides can

More information

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547 Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

More information

CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and

CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and SUPPLEMENTAL FIGURES FIGURE S1. Detection of MCs. A, Schematic representation of T cells stimulated on anti- CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and microclusters.

More information

The coreceptor CD4 is expressed in distinct nanoclusters and does not colocalize with T-cell receptor and active protein tyrosine kinase p56lck

The coreceptor CD4 is expressed in distinct nanoclusters and does not colocalize with T-cell receptor and active protein tyrosine kinase p56lck The coreceptor CD4 is expressed in distinct nanoclusters and does not colocalize with T-cell receptor and active protein tyrosine kinase p56lck Kyung-Ho Roh a,b,1, Björn F. Lillemeier b,c, Feng Wang a,b,

More information

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:

More information

Supporting Information Identification of Amino Acids with Sensitive Nanoporous MoS 2 : Towards Machine Learning-Based Prediction

Supporting Information Identification of Amino Acids with Sensitive Nanoporous MoS 2 : Towards Machine Learning-Based Prediction Supporting Information Identification of Amino Acids with Sensitive Nanoporous MoS 2 : Towards Machine Learning-Based Prediction Amir Barati Farimani, Mohammad Heiranian, Narayana R. Aluru 1 Department

More information

Supporting Information for

Supporting Information for Supporting Information for Rupture of Lipid Membranes Induced by Amphiphilic Janus Nanoparticles Kwahun Lee, Liuyang Zhang, Yi Yi, Xianqiao Wang, Yan Yu* Department of Chemistry, Indiana University, Bloomington,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION In the format provided by the authors and unedited. 2 3 4 DOI: 10.1038/NMAT4893 EGFR and HER2 activate rigidity sensing only on rigid matrices Mayur Saxena 1,*, Shuaimin Liu 2,*, Bo Yang 3, Cynthia Hajal

More information

Table S1: Kinetic parameters of drug and substrate binding to wild type and HIV-1 protease variants. Data adapted from Ref. 6 in main text.

Table S1: Kinetic parameters of drug and substrate binding to wild type and HIV-1 protease variants. Data adapted from Ref. 6 in main text. Dynamical Network of HIV-1 Protease Mutants Reveals the Mechanism of Drug Resistance and Unhindered Activity Rajeswari Appadurai and Sanjib Senapati* BJM School of Biosciences and Department of Biotechnology,

More information

Supplementary Information A Hydrophobic Barrier Deep Within the Inner Pore of the TWIK-1 K2P Potassium Channel Aryal et al.

Supplementary Information A Hydrophobic Barrier Deep Within the Inner Pore of the TWIK-1 K2P Potassium Channel Aryal et al. Supplementary Information A Hydrophobic Barrier Deep Within the Inner Pore of the TWIK-1 K2P Potassium Channel Aryal et al. Supplementary Figure 1 TWIK-1 stability during MD simulations in a phospholipid

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chen et al., http://www.jcb.org/cgi/content/full/jcb.201210119/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Lack of fast reversibility of UVR8 dissociation. (A) HEK293T

More information

Functional role of T-cell receptor nanoclusters in signal initiation and antigen discrimination

Functional role of T-cell receptor nanoclusters in signal initiation and antigen discrimination Functional role of T-cell receptor nanoclusters in signal initiation and antigen discrimination Sophie V. Pageon a,b,1, Thibault Tabarin a,b,1, Yui Yamamoto a,b,1, Yuanqing Ma a,b, John S. Bridgeman c,d,

More information

SDS-Assisted Protein Transport Through Solid-State Nanopores

SDS-Assisted Protein Transport Through Solid-State Nanopores Supplementary Information for: SDS-Assisted Protein Transport Through Solid-State Nanopores Laura Restrepo-Pérez 1, Shalini John 2, Aleksei Aksimentiev 2 *, Chirlmin Joo 1 *, Cees Dekker 1 * 1 Department

More information

El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 SNARE Probes for FRET/2pFLIM Analysis Used in the Present Study. mturquoise (mtq) and Venus (Ven) are in blue and yellow, respectively. The soluble N-ethylmaleimide-sensitive

More information

Supplementary Material

Supplementary Material Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2018 Supplementary Material 1 Supplemental Figures Supplemental Figure S1. Mechanical properties

More information

Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular

Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular weight markers (M). Supplementary Figure-2. Overlay of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted

More information

syx M18 M13 M18 M13 E *** M18 M13

syx M18 M13 M18 M13 E *** M18 M13 syx D syx M13 F % with cluster 8 6 4 G 3 rnd Syx rnd M13 ** rnd M13 H E % with anule 8 6 4 bg syx rnd F cell S a c Supplementary Fig 1. Quantification of membrane protein clusters beneath anules. TIRF-M

More information

d e f Spatiotemporal quantification of subcellular ATP levels in a single HeLa cell during changes in morphology Supplementary Information

d e f Spatiotemporal quantification of subcellular ATP levels in a single HeLa cell during changes in morphology Supplementary Information Ca 2+ level (a. u.) Area (a. u.) Normalized distance Normalized distance Center Edge Center Edge Relative ATP level Relative ATP level Supplementary Information Spatiotemporal quantification of subcellular

More information

A genetically targeted optical sensor to monitor calcium signals in astrocyte processes

A genetically targeted optical sensor to monitor calcium signals in astrocyte processes A genetically targeted optical sensor to monitor calcium signals in astrocyte processes 1 Eiji Shigetomi, 1 Sebastian Kracun, 2 Michael V. Sofroniew & 1,2 *Baljit S. Khakh Ψ 1 Departments of Physiology

More information

Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking

Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking Additional data for Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking Fabien Pinaud 1,3, Xavier Michalet 1,3, Gopal Iyer 1, Emmanuel

More information

Supplementary Information

Supplementary Information Supplementary Information Intrinsic Photosensitivity Enhances Motility of T Lymphocytes by Phan X. Thieu, Barbara Jaruga, Sandeep C. Pingle, Bidhan C. Bandyopadhyay, & Gerard P. Ahern Supplementary Figure

More information

Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.

Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values

More information

Meaning-based guidance of attention in scenes as revealed by meaning maps

Meaning-based guidance of attention in scenes as revealed by meaning maps SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41562-17-28- In the format provided by the authors and unedited. -based guidance of attention in scenes as revealed by meaning maps John M. Henderson 1,2 *

More information

Specimen. Humeral Head. Femoral Head. Objective. Femoral Condyle (medial) Supplementary Figure 1

Specimen. Humeral Head. Femoral Head. Objective. Femoral Condyle (medial) Supplementary Figure 1 A B Specimen Humeral Head 2 1 µm 76 µm Femoral Head Objective Femoral Condyle (medial) Supplementary Figure 1 A Femoral Head Global Cell Density Superficial Cell Density Cell Number at 1 µm Nuclei /.1

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific

More information

Sum of Neurally Distinct Stimulus- and Task-Related Components.

Sum of Neurally Distinct Stimulus- and Task-Related Components. SUPPLEMENTARY MATERIAL for Cardoso et al. 22 The Neuroimaging Signal is a Linear Sum of Neurally Distinct Stimulus- and Task-Related Components. : Appendix: Homogeneous Linear ( Null ) and Modified Linear

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Microtubule Teardrop Patterns

Microtubule Teardrop Patterns Supporting Information Microtubule Teardrop Patterns Kosuke Okeyoshi 1, Ryuzo Kawamura 1, Ryo Yoshida 2, and Yoshihito Osada 1 * 1 RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198,

More information

Theta sequences are essential for internally generated hippocampal firing fields.

Theta sequences are essential for internally generated hippocampal firing fields. Theta sequences are essential for internally generated hippocampal firing fields. Yingxue Wang, Sandro Romani, Brian Lustig, Anthony Leonardo, Eva Pastalkova Supplementary Materials Supplementary Modeling

More information

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,

More information

Shape Transformations of Lipid Bilayers Following Rapid Cholesterol

Shape Transformations of Lipid Bilayers Following Rapid Cholesterol Biophysical Journal, Volume 111 Supplemental Information Shape Transformations of Lipid Bilayers Following Rapid Cholesterol Uptake Mohammad Rahimi, David Regan, Marino Arroyo, Anand Bala Subramaniam,

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Supplements. Figure S1. B Phalloidin Alexa488

Supplements. Figure S1. B Phalloidin Alexa488 Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with

More information

Supplemental Data Figure S1 Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells.

Supplemental Data Figure S1 Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells. Supplemental Data Figure S1. Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells. (A) Specific lysis of IFN-γ-treated SKBR-3 cells in the absence

More information

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the

More information

Unveiling transient protein-protein interactions that modulate inhibition of alpha-synuclein aggregation

Unveiling transient protein-protein interactions that modulate inhibition of alpha-synuclein aggregation Supplementary information Unveiling transient protein-protein interactions that modulate inhibition of alpha-synuclein aggregation by beta-synuclein, a pre-synaptic protein that co-localizes with alpha-synuclein.

More information

Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation

Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation Hang Yu, 1, 2, a) Wei Han, 1, 3, b) Wen Ma, 1, 2 1, 2, 3, c) and Klaus Schulten 1) Beckman

More information

LFA-1 activates focal adhesion kinases FAK1/PYK2 to generate LAT-GRB2-SKAP1 complexes that terminate T-cell conjugate formation

LFA-1 activates focal adhesion kinases FAK1/PYK2 to generate LAT-GRB2-SKAP1 complexes that terminate T-cell conjugate formation Received 27 Sep 216 Accepted 23 May 217 Published 12 Jul 217 DOI: 1.138/ncomms161 OPEN LFA-1 activates focal adhesion kinases /PYK2 to generate -GRB2- complexes that terminate T-cell conjugate formation

More information

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80 a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

More information

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Amin Feizpour Reinhard Lab Department of Chemistry and the Photonics Center, Boston University, Boston, MA May 2014

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition

More information

a 0,8 Figure S1 8 h 12 h y = 0,036x + 0,2115 y = 0,0366x + 0,206 Labeling index Labeling index ctrl shrna Time (h) Time (h) ctrl shrna S G2 M G1

a 0,8 Figure S1 8 h 12 h y = 0,036x + 0,2115 y = 0,0366x + 0,206 Labeling index Labeling index ctrl shrna Time (h) Time (h) ctrl shrna S G2 M G1 (GFP+ BrdU+)/GFP+ Labeling index Labeling index Figure S a, b, y =,x +, y =,x +,,,,,,,, Time (h) - - Time (h) c d S G M G h M G S G M G S G h Time of BrdU injection after electroporation (h) M G S G M

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide

More information

Supplementary Figure Legends Supplementary Figure S1. Aurora-A is essential for SAC establishment in early mitosis. (a-c) RPE cells were treated with DMSO (a), MLN8237 (b) or BI2536 (c) for Two hours.

More information

Supplementary Figure S1 Black silicon and dragonfly wing nanotopography.

Supplementary Figure S1 Black silicon and dragonfly wing nanotopography. Supplementary Figure S1 Black silicon and dragonfly wing nanotopography. Representative low-magnification scanning electron micrographs of a) Black silicon (bsi) and b) Diplacodes bipunctata dragonfly

More information

Dep. Control Time (min)

Dep. Control Time (min) aa Control Dep. RP 1s 1 mv 2s 1 mv b % potentiation of IPSP 2 15 1 5 Dep. * 1 2 3 4 Time (min) Supplementary Figure 1. Rebound potentiation of IPSPs in PCs. a, IPSPs recorded with a K + gluconate pipette

More information

The pi-value distribution of single-pass membrane proteins at the plasma membrane in immune cells and in total cells.

The pi-value distribution of single-pass membrane proteins at the plasma membrane in immune cells and in total cells. Supplementary Figure 1 The pi-value distribution of single-pass membrane proteins at the plasma membrane in immune cells and in total cells. The PI values were measured for the first 10 amino acids in

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class

More information

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Distinct contributions of Na v 1.6 and Na v 1.2 in action potential initiation and backpropagation Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Supplementary figure and legend Supplementary

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/3/eaaq0762/dc1 Supplementary Materials for Structures of monomeric and oligomeric forms of the Toxoplasma gondii perforin-like protein 1 Tao Ni, Sophie I. Williams,

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

doi: /nature10632

doi: /nature10632 SUPPLEMENTARY INFORMATION doi:10.1038/nature10632 Supplementary Figure 1 Lyn mediates neutrophil wound responses as a redox sensor. a, A schematic model. Wounded epithelial cells release H 2 O 2 by an

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure

More information

Supplementary Figure 1. Overview of steps in the construction of photosynthetic protocellular systems

Supplementary Figure 1. Overview of steps in the construction of photosynthetic protocellular systems Supplementary Figure 1 Overview of steps in the construction of photosynthetic protocellular systems (a) The small unilamellar vesicles were made with phospholipids. (b) Three types of small proteoliposomes

More information

Supporting Information. Evolution of atomically precise silver clusters to superlattices

Supporting Information. Evolution of atomically precise silver clusters to superlattices Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2012. Supporting Information for Part. Part. Sys. Charact., DOI: 10.1002/ppsc.((please add manuscript number)) Evolution of atomically

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Surface thiol groups and reduction of activated T cells. (a) Activated CD8 + T-cells have high expression levels of free thiol groups on cell surface proteins.

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,

More information

CRY2 binding to CIB1N w/ MTHF

CRY2 binding to CIB1N w/ MTHF Supplemental Figures: CRY2 binding to CIB1N w/ MTHF.36 Polarization.34.32.3.28 Blue.26 5 1 15 [Cry2] in nm Figure S1: Addition of MTHF does not significantly change CRY2- CIB1N binding. Direct fluorescence

More information

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

Birds' Judgments of Number and Quantity

Birds' Judgments of Number and Quantity Entire Set of Printable Figures For Birds' Judgments of Number and Quantity Emmerton Figure 1. Figure 2. Examples of novel transfer stimuli in an experiment reported in Emmerton & Delius (1993). Paired

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 0.038/ncb33 a b c 0 min 6 min 7 min (fixed) DIC -GFP, CenpF 3 µm Nocodazole Single optical plane -GFP, CenpF Max. intensity projection d µm -GFP, CenpF, -GFP CenpF 3-D rendering e f 0 min 4 min 0

More information

Supplementary information

Supplementary information Supplementary information Lipid peroxidation causes endosomal antigen release for cross-presentation Ilse Dingjan 1, Daniëlle RJ Verboogen 1, Laurent M Paardekooper 1, Natalia H Revelo 1, Simone P Sittig

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Current density profiles for backside-plating configuration cells and the cycle stability curve with and without carbon coating. Current density profiles of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary

More information

Supplementary Figure 1. Localization of face patches (a) Sagittal slice showing the location of fmri-identified face patches in one monkey targeted

Supplementary Figure 1. Localization of face patches (a) Sagittal slice showing the location of fmri-identified face patches in one monkey targeted Supplementary Figure 1. Localization of face patches (a) Sagittal slice showing the location of fmri-identified face patches in one monkey targeted for recording; dark black line indicates electrode. Stereotactic

More information

HEDIS Influenza Compliance Trend. Information Delivery Provider Measurement Analytics June 2017

HEDIS Influenza Compliance Trend. Information Delivery Provider Measurement Analytics June 2017 HEDIS Influenza Compliance Trend Information Delivery Provider Measurement Analytics June 2017 Contents CIS Influenza Information Influenza Vaccination Information Commercial Influenza Compliance Trend

More information

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Ivan Zanoni*, Renato Ostuni*, Simona Barresi, Marco Di Gioia, Achille Broggi, Barbara Costa, Roberta

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Lu et al., http://www.jcb.org/cgi/content/full/jcb.201012063/dc1 Figure S1. Kinetics of nuclear envelope assembly, recruitment of Nup133

More information

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)

More information

QUANTIFYING THE EFFECT OF SETTING QUALITY CONTROL STANDARD DEVIATIONS GREATER THAN ACTUAL STANDARD DEVIATIONS ON WESTGARD RULES

QUANTIFYING THE EFFECT OF SETTING QUALITY CONTROL STANDARD DEVIATIONS GREATER THAN ACTUAL STANDARD DEVIATIONS ON WESTGARD RULES AACC24 QUANTIFYING THE EFFECT OF SETTING QUALITY CONTROL STANDARD DEVIATIONS GREATER THAN ACTUAL STANDARD DEVIATIONS ON WESTGARD RULES Graham Jones Department of Chemical Pathology, St Vincent s Hospital,

More information

Mnemonic representations of transient stimuli and temporal sequences in the rodent hippocampus in vitro

Mnemonic representations of transient stimuli and temporal sequences in the rodent hippocampus in vitro Supplementary Material Mnemonic representations of transient stimuli and temporal sequences in the rodent hippocampus in vitro Robert. Hyde and en W. Strowbridge Mossy ell 1 Mossy ell Mossy ell 3 Stimulus

More information

Lecture 7: Signaling Through Lymphocyte Receptors

Lecture 7: Signaling Through Lymphocyte Receptors Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Behavioral training.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Behavioral training. Supplementary Figure 1 Behavioral training. a, Mazes used for behavioral training. Asterisks indicate reward location. Only some example mazes are shown (for example, right choice and not left choice maze

More information

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse

More information

High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart.

High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. Daniel Aston, Rebecca A. Capel, Kerrie L. Ford, Helen C. Christian,

More information

Supplemental Information for: Localization of anionic phospholipids in Escherichia coli cells

Supplemental Information for: Localization of anionic phospholipids in Escherichia coli cells Supplemental Information for: Localization of anionic phospholipids in Escherichia coli cells Piercen M. Oliver, a John A. Crooks, a Mathias Leidl, b Earl J. Yoon, a Alan Saghatelian, b and Douglas B.

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information