doi: /nature10632
|
|
|
- Joan Singleton
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION doi: /nature10632 Supplementary Figure 1 Lyn mediates neutrophil wound responses as a redox sensor. a, A schematic model. Wounded epithelial cells release H 2 O 2 by an oxidative burst 1. Wound-derived H 2 O 2 directly activates Lyn in neutrophils through oxidation of cysteine 466, leading to neutrophil recruitment to wounds. b, A proposed model of H 2 O 2 -mediated regulation of Lyn s dual positive and negative pathways. In this model, we propose that H 2 O 2 directly activates Lyn while inhibiting the redox-sensitive phosphatases (such as SHIP and SHP-1) comprising Lyn s inhibitory pathway
2 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 2 SFKs mediate neutrophil wound responses. a, Immuno uorescence of psfk (phosphorylation of SFK activation loop tyrosine) by mab (D49G8) in Tg(mpx:mCherry) at 30 min after tail transection. mcherry labels neutrophils. b, Quanti cation of uorescence intensity of psfk in neutrophils (wound: 55 cells (7 larvae), no wound: 32 cells (8 larvae)). c, 2
3 SUPPLEMENTARY INFORMATION RESEARCH Immuno uorescence of psfk in Tg(mpx:mCherry) with/without DPI at 30 min after tail transection. d, Quanti cation of uorescence intensity of psfk in neutrophils (DMSO: 41 cells (10 larvae), DPI: 41 cells (6 larvae)). e, Neutrophil recruitment to wounds and ns at 1h and 2h post wounding with/without PP2 (1h/ctrl: 25 larvae, 1h/PP2: 17 larvae, 2h/ctrl: 21 larvae, 2h/PP2: 19 larvae). f, Neutrophil recruitment to wounds and ns at 1 hpw with/without PP1 or PP2 (ctrl: 44 larvae, PP1: 24 larvae, PP2: 23 larvae). g, Tracking of spontaneous random motility of neutrophils in the cephalic mesenchyme with/without PP2. h, Quanti cation of 3D velocity of neutrophils during random motility (DMSO: 14 cells, PP2: 11 cells). *P<0.05, two-tailed unpaired t-test (b,d,e,h) and one-way ANOVA with Dunnett post test (f). Scale bars: 50 μm. 3
4 RESEARCH SUPPLEMENTARY INFORMATION 4
5 SUPPLEMENTARY INFORMATION RESEARCH Supplementary Figure 3 SFKs mediate early neutrophil wound responses. a, Time-course analysis of neutrophil accumulation around wounds generated with a needle. 3 dpf larvae were treated with DMSO, DPI or PP2, wounded and xed at each time point, and neutrophils were stained with Sudan Black (1h/DMSO: 20 larvae, 2h/DMSO: 21 larvae, 4h/DMSO: 21 larvae, 1h/DPI: 20 larvae, 2h/DPI: 20 larvae, 4h/DPI: 18 larvae, 1h/PP2: 21 larvae, 2h/PP2: 20 larvae, 4h/PP2: 22 larvae). b, Time-course analysis of neutrophil accumulation around wounds generated by tail transection with a razor blade. 3 dpf larvae were treated with DMSO, DPI or PP2, wounded and xed at each time point, and neutrophils were stained with Sudan Black (1h/DMSO: 20 larvae, 2h/DMSO: 20 larvae, 4h/DMSO: 21 larvae, 1h/DPI: 20 larvae, 2h/DPI: 21 larvae, 4h/DPI: 9 larvae, 1h/PP2: 20 larvae, 2h/PP2: 20 larvae, 4h/PP2: 20 larvae). c, 3 dpf larvae were wounded with a needle, treated with DMSO or PP2 at 1 hpw, and xed at 6 hpw. Neutrophils were stained with Sudan Black (DMSO: 23 larvae, PP2: 23 larvae). PP2 did not affect resolution of in ammation when added at 1 hpw. d, Time-lapse tracking of neutrophils photolabeled at wounds. 3 dpf Tg(mpx:Dendra2) 3 larvae were wounded with a razor blade. At 1 hpw, larvae were treated with DMSO or PP2 and neutrophils at wounds were photolabeled by photoconverting the uorescence of Dendra2 from green (488 nm) to red (543 nm) (white lines: photoconverted areas, green arrows: neutrophils which were not photolabeled, purple arrows: auto uorescence of pigment). Photolabeled neutrophils were tracked up to 9.5 hpw (DMSO: 10 larvae, PP2: 10 larvae, pooled analysis of two separate experiments). PP2 did not affect resolution of in ammation mediated by neutrophil reverse migration. Error bars indicate s.e.m. Scale bar: 50 μm. 5
6 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 4 Neutrophil responses to exogenous stimulants. a, Diagram of H 2 O 2 injection into the otic cavity of 3 dpf zebra sh. Neutrophils were stained 20 minutes after injection of 10 μm H 2 O 2. b, Representative pictures of Sudan Black staining with/without PP2. Generation of endogenous H 2 O 2 was prevented by DPI treatment. Blue circles outline the otic cavity. c, Neutrophil recruitment to the H 2 O 2 -injected otic cavity was inhibited by PP2 (DPI/Ctrl: 21 larvae, DPI/H 2 O 2 : 17 larvae, DPI+PP2/Ctrl: 17 larvae, DPI+PP2/H 2 O 2 : 18 larvae). 6
7 SUPPLEMENTARY INFORMATION RESEARCH d, Diagram of bath application of 100 μm H 2 O 2 in combination with wounding in 3 dpf zebra sh. Neutrophils were stained 30 minutes post wounding. e, Representative pictures of Sudan Black staining with/without PP2. Generation of endogenous H 2 O 2 was prevented by DPI treatment. f, Neutrophil accumulation around wounds was inhibited by PP2 (DPI/Ctrl: 24 larvae, DPI/H 2 O 2 : 24 larvae, DPI+PP2/Ctrl: 24 larvae, DPI+PP2/H 2 O 2 : 24 larvae). g, Under-agarose assay using human neutrophils and 100 nm fmlp (n=3). Error bars indicate s.e.m. *P<0.05, one-way ANOVA with Bonferroni post-test (c,f) and two-tailed unpaired t-test (g). 7
8 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 5 Zebra sh Lyn. a, Tg(mpx:Dendra2) larvae at 3 dpf were used for ow cytometry. Dendra2-low (macrophages) and Dendra2-high (neutrophils) fractions are boxed (blue). Cells from wild-type larvae (red) were used to set the lowest level of expression. b, Alignment of amino acid sequences of human LYN and zebra sh Lyn. C224 and C466 were indicated with arrows. c, Neutrophil number in the CHT of 2.5 dpf larvae with/without lyn morpholinos (ctrl: 25 larvae, lyn MO1: 23 larvae, lyn MO2: 25 larvae). d, Representative pictures of Sudan Black staining of neutrophils in the CHT. *P<0.05, one-way ANOVA with Dunnett post test (c). 8
9 SUPPLEMENTARY INFORMATION RESEARCH Supplementary Figure 6 Zebra sh macrophages. a, 2.5 dpf Tg(mpx:Dendra2) larvae injected with lyn MO or buffer were treated 9
10 RESEARCH SUPPLEMENTARY INFORMATION with DMSO, 20 μm PP2 or 100 μm DPI, wounded and xed 30 minutes post wounding. The xed larvae were immunostained with L-Plastin antibody, which detects leukocytes. The numbers of neutrophils (Dendra2 positive and L-Plastin positive cells) and macrophages (Dendra2 negative and L-Plastin positive cells) at wounds were quanti ed. b, Representative immuno uorescence pictures. *P<0.05, one-way ANOVA with Dunnett post test. Scale bar: 50 μm. 10
11 SUPPLEMENTARY INFORMATION RESEARCH 11
12 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 7 Lyn knockdown inhibits neutrophil responses to H 2 O 2 but not to LTB 4. a, 2.5 dpf larvae injected with lyn MO or buffer were bathed in 100 μm H 2 O 2 following wounding. Generation of endogenous H 2 O 2 was prevented by DPI. The larvae were xed 30 minutes post wounding and stained with Sudan Black. Lyn knockdown inhibits neutrophil responses to exogenous H 2 O 2 (Ctrl/Ctrl: 19 larvae, Ctrl/H 2 O 2 : 20 larvae, lyn MO/ctrl: 20 larvae, lyn MO/H 2 O 2 : 19 larvae). b, Representative pictures of Sudan Black staining of 2.5 dpf larvae. c, 2.5 dpf larvae were bathed in 30 μm LTB 4 for 30 minutes, xed and stained with Sudan Black (DMSO: 21 larvae, DPI: 20 larvae). d, Representative pictures of Sudan Black staining of 2.5 dpf larvae bathed in 30 μm LTB 4. Neutrophils in the outlined ventral n were counted for quanti cation. e, 2.5 dpf larvae injected with lyn MO or buffer were bathed in 30 μm LTB 4 for 30 minutes, xed and stained with Sudan Black (ctrl: 66 larvae, lyn MO: 61 larvae). Lyn knockdown increased the number of neutrophils localized in the n upon LTB 4 stimulation. This increase correlates with the increase in the total number of neutrophils in the CHT of lyn morphants (Supplementary Fig.5c, d). f, Representative pictures of Sudan Black staining. *P<0.05, one-way ANOVA with Bonferroni post-test (a) and two-tailed unpaired t-test (c,e). 12
13 SUPPLEMENTARY INFORMATION RESEARCH Supplementary Figure 8 Cysteine 466 in zebra sh Lyn. a, C466 is located at the C-terminus of the kinase domain and is phylogenetically conserved. b, BIAM-labeled Lyn WT and C466A detected by streptavidin-conjugated dye. c, Quanti cation of b (n=3). d, Western blot of MAPKs in HEK293 cells expressing Lyn ectopically. e, Western blot of ERK phosphorylation in HEK293 cells expressing Lyn WT and C466A. f, Quanti cation of e (n=4). Error bars indicate s.e.m. *P<0.05, paired t-test. 13
14 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 9 Cysteine 468 in human LYN. a, Western blot of human LYN and ERK in HEK293 cells expressing human LYN ectopically. b, Western blot of autophosphorylation of LYN and phosphorylation of ERK in HEK293 cells expressing human LYN WT and C468A. c, Quanti cation of b (n=3). d, BIAM-labeled human LYN WT and C468A detected by streptavidin-conjugated dye. e, Quanti cation of d (n=3). Error bars indicate s.e.m. *P<0.05, paired t-test. 14
15 SUPPLEMENTARY INFORMATION RESEARCH Supplementary Figure 10 Tg(mpx:lyn WT-GFP) and Tg(mpx:lyn C466A-GFP). a, Neutrophils in the CHT of Tg(mpx:lyn WT-GFP). b, Neutrophils in the CHT of Tg(mpx:lyn C466A-GFP). c, Punctate localization of Lyn(WT)-GFP in a neutrophil. d, Punctate localization of Lyn(C466A)-GFP in a neutrophil. Scale bars: 50 μm (a), 10 μm (c). 15
16 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 11 Lyn regulates Erk activity in neutrophils in vivo. a, Immuno uorescence of perk in Tg(mpx:mCherry) at 30 minutes post wounding. b, Immuno uorescence of perk in Tg(mpx:mCherry) with/without lyn morpholino at 30 minutes post wounding. c, Quanti cation of uorescence intensity of perk in neutrophils (ctrl: 45 cells (4 larvae), lyn MO: 21 cells (4 larvae)). d, Immuno uorescence of perk and Mpx in Tg(mpx:lyn WT-GFP) with/without lyn MO at 30 minutes post wounding. e, Immuno uorescence of 16
17 SUPPLEMENTARY INFORMATION RESEARCH perk and Mpx in Tg(mpx:lyn C466A-GFP) with/without lyn MO at 30 minutes post wounding. f, Quanti cation of uorescence intensity of perk in neutrophils in Tg(mpx:lyn WT-GFP) (Lyn-GFP(+)/Ctrl: 95 cells (11 larvae), Lyn-GFP(+)/lyn MO: 99 cells (11 larvae)). g, Quanti cation of uorescence intensity of perk in neutrophils in Tg(mpx:lyn C466A-GFP) (C466A-GFP(+)/Ctrl: 128 cells (25 larvae), C466A-GFP(+)/lyn MO: 64 cells (23 larvae)). *P<0.05, two-tailed unpaired t-test (c,f).scale bars: 10 μm. 17
18 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 12 Erk inhibitors impair neutrophil accumulation at wounds. a, 3 dpf larvae were treated with DMSO, 100 μm PD98059 or 20 μm U0126, wounded, xed 30 minutes post wounding and stained with Sudan Black. Erk inhibitors impair neutrophil accumulation at wounds (DMSO: 23 larvae, PD98059: 22 larvae, U0126: 23 larvae). b, Representative pictures of Sudan Black staining. *P<0.05, one-way ANOVA with Dunnett post-test 18
19 SUPPLEMENTARY INFORMATION RESEARCH Supplementary Figure 13 DNA sequences of codon-optimized zebra sh lyn and human LYN. a, DNA sequence of codon-optimized zebra sh lyn. b, DNA sequence of 19
20 RESEARCH SUPPLEMENTARY INFORMATION codon-optimized human LYN. Codon optimization was performed by GenScript (Piscataway, NY). 20
21 SUPPLEMENTARY INFORMATION RESEARCH Supplementary movie 1 Movie shows time-lapse imaging of H 2 O 2 immediately after tail transection in 2.5 dpf larvae expressing HyPer probe. The larvae were treated with DMSO (left) or 20 μm PP2 (right) for 1h before imaging and images were taken with the drug in E3. Supplementary movie 2 Movie shows time-lapse imaging of neutrophil random migration in the cephalic mesenchyme of 3 dpf Tg(mpx:Dendra2). The larvae were treated with DMSO (left) or 20 μm PP2 (right) for 1h before imaging and images were taken with the drug in E3. Supplementary movie 3 Movie shows four examples of representative time-lapse imaging of 2.5 dpf Tg(mpx:Dendra2) injected with lyn MO or buffer. Note increased total numbers of neutrophils in the lyn morphants. Neutrophils migrate to wounds immediately after wounding in control but not in lyn morphants. Supplementary movie 4 Movie shows LTB 4 -mediated neutrophil dissemination into the ns of zebra sh larvae. In the rst movie, 3 dpf larvae were pretreated with DMSO or DPI, and bathed in E3 containing 30 μm LTB 4. In the second movie, 2.5 dpf larvae injected with lyn MO or buffer were bathed in E3 containing 30 μm LTB Niethammer, P., Grabher, C., Look, A.T. & Mitchison, T.J. A tissue-scale gradient of hydrogen peroxide mediates rapid wound detection in zebra sh. Nature 459, (2009). 2. Scapini, P., Pereira, S., Zhang, H. & Lowell, C.A. Multiple roles of Lyn kinase in myeloid cell signaling and function. Immunol Rev 228, (2009). 21
22 RESEARCH SUPPLEMENTARY INFORMATION 3. Yoo, S.K. & Huttenlocher, A. Spatiotemporal photolabeling of neutrophil traf cking during in ammation in live zebra sh. J Leukoc Biol 89,
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)
Supplementary information
Supplementary information 1 Supplementary Figure 1. CALM regulates autophagy. (a). Quantification of LC3 levels in the experiment described in Figure 1A. Data are mean +/- SD (n > 3 experiments for each
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Nature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3443 In the format provided by the authors and unedited. Supplementary Figure 1 TC and SC behaviour during ISV sprouting. (a) Predicted outcome of TC division and competitive Dll4-Notch-mediated
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
doi: /nature14508 Rappsilber et al.
SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Supplementary Figures
Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in
Nature Biotechnology: doi: /nbt.3828
Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
SUPPLEMENTARY INFORMATION
Supplementary Information included with Nature MS 2008-02-01484B by Colantonio et al., entitled The dynein regulatory complex is required for ciliary motility and otolith biogenesis in the inner ear. This
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed
Supplementary figures
Supplementary figures Supplementary Figure 1. B cells stimulated with pokeweed mitogen display normal mitotic figures but not cells infected with B95-8. The figures show cells stimulated with pokeweed
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
F-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
Dual Targeting Nanoparticle Stimulates the Immune
Dual Targeting Nanoparticle Stimulates the Immune System to Inhibit Tumor Growth Alyssa K. Kosmides, John-William Sidhom, Andrew Fraser, Catherine A. Bessell, Jonathan P. Schneck * Supplemental Figure
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
genome edited transient transfection, CMV promoter
Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp
Fig. S1. High K+ increases intracellular calcium level.
Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence
Supplementary Figure S1 (a) (b)
Supplementary Figure S1: IC87114 does not affect basal Ca 2+ level nor nicotineinduced Ca 2+ influx. (a) Bovine chromaffin cells were loaded with Fluo-4AM (1 μm) in buffer A containing 0.02% of pluronic
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)
A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Prolonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Nature Methods: doi: /nmeth.4257
Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
SUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
Supplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
Nature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
human epithelial cells were pretreated with control sirna (50 nm) or GSK-3β sirna (50 nm)
GSK3β facilitates IFNγ signaling Supplementary Figure Legends Figure S1. The effects of inhibiting GSK3β on IFNγinduced TNFα expression. A, A549 human epithelial cells were pretreated with control sirna
Supplementary Figure Legends Supplementary Figure S1. Aurora-A is essential for SAC establishment in early mitosis. (a-c) RPE cells were treated with DMSO (a), MLN8237 (b) or BI2536 (c) for Two hours.
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
Supplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Supplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
Supplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary
Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
SUPPLEMENTARY INFORMATION
Supplementary igure 1. The expression level of PP4 (At4g16860) is diminished in the rpp4 mutant (SK017569). The mna was extracted to analyze the expression level of PP4 using quantitative PC (qpc). Gene
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression