Nature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.
|
|
- Kory Bates
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class I 3 rd instar. (c) Coverage index (sum of label length/arbor length) at 3 rd instar for Khc::nod::lacZ label foci (<3 m) (n (neurons) = 7, 7, 6; class IV WT vs class IV UAS-ab t = 3.55 P < 0.01) (d-g) Class IV 3rd instar (magnification of panels in Fig. 1); (h-k) class I st17 (magnification of panels in Fig. 1). Data drawn as scatter plots with the mean ± standard deviation (SD). Scale bars: (a-b, d-g) 50 m: (h-k) 5 m. Statistical test used: (c) one-way ANOVA followed by Bonferroni s Multiple Comparison Test.
2 Supplementary Figure 2 Neuron class-specific arrangements of Lis1 label in dendrites. Coverage index (sum of label length/arbor length) for Lis1 label with a length of >9 m (a) (n (neurons) = 6, 4, 5; class I WT vs class IV WT t = 6.07 P < 0.001, class IV WT vs class IV UAS-ab t = 5.34 P < 0.001) and <3 m (b) (n (neurons) = 6, 4, 5; class I WT vs class IV WT t = 3.27 P < 0.05) at 3 rd instar, and embryo st17 (c) (n (neurons) = 12, 11; t(21) = 3.53 P = ). (d-f) Class I (yellow arrrowheads) and class IV (green arrowheads) neurons labelled with mcd8::ko and EGFP::Lis1. Data are shown as percentages or as scatter plots with the mean ± SD. Statistical tests used: (a, b) one-way ANOVA followed by Bonferroni s Multiple Comparison Test, (c) 2-tail t-test.
3 Supplementary Figure 3 Gene expression in ab mutant da neurons. (a-c) Gene expression in WT and ab mutant neurons (stage16-17, Rluv3>mCD8::GFP, n = 5, 6). Expression levels of (a) cnn are significantly reduced in ab mutants (t(9) = 3.49 P = ). However, those of (b) elav and (c) plp remain unchanged between genotypes. Expression levels are shown relative to gapdh (and also validated relative to rp49). Data collected at st16-17, and shown as scatter plots with the mean ± SD. Statistical tests used: t-test.
4 Supplementary Figure 4 Analysis of branch order and arbor complexity in cnn mutant da neurons. (a) Cartoon illustrating how branch orders were defined for panels (b) and (c); the ordering is based on the Strahler method, and combines consecutive branch segments with the same order into a single definitive branch (as indicated with *). In this cartoon branch orders are show in different colors and numbers (1-black; 2-red; 3-blue). (b, c) The total branch number for each branch order at st17 for (b) class I (n (neurons) = 10, 16) and (c) class IV neurons (n (here we show tracing data for the single largest tree in the dorsal half of a ddac arbor; one tree per neuron) = 17, 18). Branch number increased at each consecutive branch order in cnn mutants. Upon testing (with Bonferroni s multiple test correction), in class I this difference reached statistical significance at the highest two branch orders (1 st order t = 8.18 P < , 2 nd order t = 3.21 P < 0.01); and in class IV at the first 1 st order (t = 5.05 P < ). (d, e) Sholl analysis reveals, for (d) class I (n (neurons) = 10, 20; F(1, 252) = P = ) and (e) class IV (n (neurons: dorsal half of the arbor only) = 17, 17; F(1, 323) = P = ), an increase in arbor complexity in medial and distal arbor regions in cnn mutants. Data collected at st17 shown as scatter and line plots with mean ± SD. Statistical tests used: (a, b) one-way ANOVA followed by Bonferroni s Multiple Comparison Test, (d, e) two-way ANOVA.
5 Supplementary Figure 5 Cnn controls VS1 dendrite branching. (a, b) Sequential z-images taken of (a) WT and (b) cnn VS1 neurons. Secondary branches (magenta asterisks) leave the primary branch (green asterisk). These form side trees that terminate in dendrite spine-like structures (orange arrowheads). In cnn mutants, the frequency of secondary branching is increased. Scale bar: 5 m, z step: 0.5 m. (c, d) In the complex VS1 interneuron, Cnn appears to repress branch formation in the early scaffolding phase, and later mechanisms limit the effect of this early over-branching on final spine-like structure distribution. The number of secondary trees was increased in the cnn mutant, yet the number of spine-like structures per secondary tree was concomitantly reduced. (c) Within the trees the density of spine-like structures in cnn mutants is indistinguishable from WT (n (neurons) = 14, 14, P = ). (d) However the side trees are smaller and the total number of spine-like structures per tree (counted in the largest tree in each neuron imaged) is reduced in the cnn mutants (n (neurons)=14, 14, t(27) = 5.77 P < ). Data collected in the adult. Data presented as scatter plots with the mean ± SD. Statistical test used: (c, d) 2-tail t-test.
6 Supplementary Figure 6 RhoA controls F-Actin distribution in dendrites. (a, b) The distribution of F-actin (measured by GMA fluorescence intensity (GMA: the 137 amino acid actin binding domain of Moesin tagged with GFP)) in developing class I dendrites, st17. Scale bar: 5 m. (c) WT neurons show a strong concentration of F-actin at dendrite tips. This concentration gradient is reduced upon expression of a dominant negative RhoN19 (n (branches)=153, 153). Data collected at st17, and represented as mean ± SEM.
7 Supplementary Figure 7 Additive Futsch- and Cnn-mediated branch repression. For dendrite tip number in class I neurons at 3rd instar, an additive effect between cnn and futsch was detected (a) F(1, 73) = 1.18 P = , (b) F (1, 58) = 0.50 P = therefore showing no interaction (n (neurons)= 20, 20, 17, 20, 19, 21, 11, 12). Data collected at 3 rd instar and drawn as scatter plots with the mean ± SD. Statistical test used: two-way ANOVA.
8 Supplementary Figure 8 Rescue of extra branching in cnn mutants by co-expression of GFP::Cnn. Dendrite tip number in class I neurons at st17 (n (neurons) = 11, 19, 21, 16; interaction F(1, 63) = P = ). Data collected at st17 and drawn as scatter plots with the mean ± SD. Statistical test used: two-way ANOVA.
9 Supplementary Figure 9 Distribution of GFP::Cnn foci on the Golgi surface. (a) A regular distribution of GFP::Cnn across the Golgi cis face. Scale bar: 1 m. (b,c,d) 1, 2, and 3 foci, respectively. Foci refers to a point where the uneven distribution of signal leads to an increased accumulation of the signal at one position relative to the surrounding region. Data collected at st17.
10 Supplementary Figure 10 No alteration in arbor-wide density of GFP::Cnn foci in plp mutants. The density of GFP::Cnn foci counted through the entire dendrite arbor (n (neurons) = 8, 7). Data collected at st17 and drawn as scatter plots with the mean ± SD.
11 Supplementary Figure 11 Differential relationship between Khc::nod::lacZ label and Golgi outposts in neurons with simple and complex arbors. (a) Khc::nod::lacZ signal is adjacent to Golgi outposts in class I neurons. Scale bar 10 m. (b) Khc::nod::lacZ signal does not show preferential localization to Golgi outposts along the dendrites of class IV neurons. (c) A bar chart comparing the relationship between Khc::nod::lacZ label and Golgi outposts in these two neuron classes (n= (outpost) 64, 63; Chi-square(2, N = 127) = P < ). i magnification of the signals, ii path of the arbor. Abbreviation: p - proximal. Data collected at 3 rd instar and represented as a percentage. Statistical test used: (c) Chi-square test.
12 Supplementary Figure 12 Class I Golgi outposts have a single-compartment structure. (a) A Sholl analysis showing the distribution of Golgi compartments in the dendrites of late stage 17 class I neurons,(n(neuron) ManII=8, GalT=6). Data collected at st17 represent mean ± SD. (F(1, 108) = P < ). (b) A comparison between the outpost compositions in complex (class III) neurons reported by Zhou and colleagues and the findings of this study in class I. Statistical test used: (a) two-way ANOVA.
13 Supplementary Figure 13 A role for Golgi outposts in regulating the polarity of microtubules in termini. (a) The relative contributions of Golgi and non-golgi derived polymerizing microtubules to the dendrite termini. In the class I arbor, microtubules derived from Golgi outposts favor polymerization in the retrograde direction (n (comets)= 50). (b) A cartoon to illustrate the consequence of linking microtubule nucleation events to a Golgi outpost in a nascent branch of a class I neuron. Arrows represent polymerizing microtubules, purple circles represent outposts. In mutants an outpost that is not supporting microtubule nucleation is shown as a pale circle. Data collected at st17.
14 Supplementary Figure 14 A model to address the outcome of changing branching frequency on class I dendrite arbor complexity. The simulation entails a straightforward model of branching in class I da neurons. (a) A soma gives rise to a number of initial segments; this distribution was estimated by counting primary dendrites in WT experimental data at stage 17. Further branching events were estimated from analysis of tracings of wildtype stage 17 neurons. In the model, subsequently, the end points are increased in three growth phases. In the first growth phase, each end point gives rise to an average of 4.2 new end points (normal distribution mu=4.2, sigma=2). This is the phase of rapid expansion. In the second and third growth phase, the end points can sprout once more with a probability of 1/4 and 1/10, respectively. In the non-wt case, the initial number of stems is 15% higher, and subsequently all branching probabilities are increased by 15% as well. (b) We ran this model 1000 times for both WT case and non-wt case. (c) The average number of end points was 20 and 28 in WT and non-wt case, respectively (D=0.426, P << 0.05, two-tailed Kolmogorov-Smirnov test).
15 Supplementary Figure 15 A comparison between Anti-Ab ChIP-seq and Ab-Dam ID at the cnn locus. Anti-Ab ChIP-Seq peaks were called peaks using MACS. Optimal peak calling (purple bar) called 2,397 peaks. Conservative peak calling (magenta bar) called 515 peaks. Binding at the cnn locus was comparable between Anti-Ab ChIP-Seq and a recently published DamID analysis of Ab (green bar).
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationSupplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a)
1 Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a) and CD45 (b) in fixed sections of binocular visual cortex
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV
More informationSupplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
More informationStructural basis for the role of inhibition in facilitating adult brain plasticity
Structural basis for the role of inhibition in facilitating adult brain plasticity Jerry L. Chen, Walter C. Lin, Jae Won Cha, Peter T. So, Yoshiyuki Kubota & Elly Nedivi SUPPLEMENTARY FIGURES 1-6 a b M
More informationSupplemental Data. Wu et al. (2010). Plant Cell /tpc
Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),
More informationSupplemental Information. Proprioceptive Opsin Functions. in Drosophila Larval Locomotion
Neuron, Volume 98 Supplemental Information Proprioceptive Opsin Functions in Drosophila Larval Locomotion Damiano Zanini, Diego Giraldo, Ben Warren, Radoslaw Katana, Marta Andrés, Suneel Reddy, Stephanie
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
More informationWenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu
Distinct contributions of Na v 1.6 and Na v 1.2 in action potential initiation and backpropagation Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Supplementary figure and legend Supplementary
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Brooks and Wallingford, http://www.jcb.org/cgi/content/full/jcb.201204072/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Quantification of ciliary compartments in control
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationSupplementary Information
Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior
Supplementary Figure 1 Trial structure for go/no-go behavior a, Overall timeline of experiments. Day 1: A1 mapping, injection of AAV1-SYN-GCAMP6s, cranial window and headpost implantation. Water restriction
More informationTransient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation Hang Yu, 1, 2, a) Wei Han, 1, 3, b) Wen Ma, 1, 2 1, 2, 3, c) and Klaus Schulten 1) Beckman
More informationSupplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed
Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed in the testes. The testes were immunostained with GFP
More informationSupplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationSupplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
More informationFile name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial
More informationdoi: /nature09554
SUPPLEMENTARY INFORMATION doi:10.1038/nature09554 Supplementary Figure 1: Optical Tracing with New Photoactivatable GFP Variants Reveals Enhanced Labeling of Neuronal Processes We qualitatively compare
More informationAuthors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C. N. Petrok, J.
SUPPLEMENTARY INFORMATION Title: PIP 3 controls synaptic function by maintaining AMPA receptor clustering at the postsynaptic membrane Authors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C.
More informationSupplementary figure 1: LII/III GIN-cells show morphological characteristics of MC
1 2 1 3 Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC 4 5 6 7 (a) Reconstructions of LII/III GIN-cells with somato-dendritic compartments in orange and axonal arborizations
More informationSUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationSUPPLEMENTARY INFORMATION
Figure S1. Loss of Ena/VASP proteins inhibits filopodia and neuritogenesis. (a) Bar graph of filopodia number per stage 1 control and mmvvee (Mena/ VASP/EVL-null) neurons at 40hrs in culture. Loss of all
More informationSUPPLEMENTARY INFORMATION. Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes
Di Salvio et al. 1 SUPPLEMENTARY INFORMATION Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes vulnerability to MPTP Michela Di Salvio, Luca Giovanni Di Giovannantonio, Dario
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
More informationSupplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression
More informationDep. Control Time (min)
aa Control Dep. RP 1s 1 mv 2s 1 mv b % potentiation of IPSP 2 15 1 5 Dep. * 1 2 3 4 Time (min) Supplementary Figure 1. Rebound potentiation of IPSPs in PCs. a, IPSPs recorded with a K + gluconate pipette
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationMeaning-based guidance of attention in scenes as revealed by meaning maps
SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41562-17-28- In the format provided by the authors and unedited. -based guidance of attention in scenes as revealed by meaning maps John M. Henderson 1,2 *
More informationSupplementary Figure 1. Gene schematics of hyls-1, gasr-8 and k10g6.4, and TEM analysis of TFs in WT and hyls-1 cilia. (a) Gene structure of hyls-1,
Supplementary Figure 1. Gene schematics of hyls-1, gasr-8 and k10g6.4, and TEM analysis of TFs in WT and hyls-1 cilia. (a) Gene structure of hyls-1, gasr-8 and k10g6.4 based on WormBase (http://wormbase.org),
More informationNature Neuroscience doi: /nn Supplementary Figure 1. Characterization of viral injections.
Supplementary Figure 1 Characterization of viral injections. (a) Dorsal view of a mouse brain (dashed white outline) after receiving a large, unilateral thalamic injection (~100 nl); demonstrating that
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 SNARE Probes for FRET/2pFLIM Analysis Used in the Present Study. mturquoise (mtq) and Venus (Ven) are in blue and yellow, respectively. The soluble N-ethylmaleimide-sensitive
More informationGenesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
More informationDisrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Lick response during the delayed Go versus No-Go task.
Supplementary Figure 1 Lick response during the delayed Go versus No-Go task. Trial-averaged lick rate was averaged across all mice used for pyramidal cell imaging (n = 9). Different colors denote different
More informationNature Methods: doi: /nmeth.4257
Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.
More informationglial cells missing and gcm2 Cell-autonomously Regulate Both Glial and Neuronal
glial cells missing and gcm2 Cell-autonomously Regulate Both Glial and Neuronal Development in the Visual System of Drosophila Carole Chotard, Wendy Leung and Iris Salecker Supplemental Data Supplemental
More informationSuppl. Information Supplementary Figure 1. Strategy/latency analysis of individual mice during maze learning. a,
Goal-oriented searching mediated by ventral hippocampus early in trial-and-error learning Ruediger, S, Spirig, D., Donato, F., Caroni, P. Suppl. Information Supplementary Figure 1. Strategy/latency analysis
More informationSupplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale
Supplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale (b) show stronger immunolabeling for CB 1 than those in
More informationHormonal gain control of a medial preoptic area social reward circuit
CORRECTION NOTICE Nat. Neurosci. 20, 449 458 (2017) Hormonal gain control of a medial preoptic area social reward circuit Jenna A McHenry, James M Otis, Mark A Rossi, J Elliott Robinson, Oksana Kosyk,
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
More informationFig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Luminal localization of CCM-3. (a) The CCM-3::GFP fusion protein localizes along the apical (luminal) surface of the pharynx (b) as well as the lumen of
More informationNature Medicine doi: /nm.2860
Supplemental Figure Legends Supplemental Figure 1: Hypomorphic expression of IFT88 results in olfactory signaling proteins no longer localizing to the ciliary layer. (a) ACIII localizes to the cilia and
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Design of isolated protein and RNC constructs, and homogeneity of purified RNCs. (a) Schematic depicting the design and nomenclature used for all the isolated proteins and RNCs used
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Behavioral training.
Supplementary Figure 1 Behavioral training. a, Mazes used for behavioral training. Asterisks indicate reward location. Only some example mazes are shown (for example, right choice and not left choice maze
More informationSupplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Confirmation that optogenetic inhibition of dopaminergic neurons affects choice
Supplementary Figure 1 Confirmation that optogenetic inhibition of dopaminergic neurons affects choice (a) Sample behavioral trace as in Figure 1d, but with NpHR stimulation trials depicted as green blocks
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.
Supplementary Figure 1 Splenic atrophy and leucopenia caused by T3 SCI. (a) Gross anatomy of representative spleens from control and T3 SCI mice at 28 days post-injury. (b and c) Hematoxylin and eosin
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3443 In the format provided by the authors and unedited. Supplementary Figure 1 TC and SC behaviour during ISV sprouting. (a) Predicted outcome of TC division and competitive Dll4-Notch-mediated
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSUPPLEMENTARY INFORMATION
DOI: 0.038/ncb33 a b c 0 min 6 min 7 min (fixed) DIC -GFP, CenpF 3 µm Nocodazole Single optical plane -GFP, CenpF Max. intensity projection d µm -GFP, CenpF, -GFP CenpF 3-D rendering e f 0 min 4 min 0
More informationSupplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Jesica Raingo, Mikhail Khvotchev, Pei Liu, Frederic Darios, Ying C. Li, Denise
More informationSUPPLEMENTARY INFORMATION In format provided by Javier DeFelipe et al. (MARCH 2013)
Supplementary Online Information S2 Analysis of raw data Forty-two out of the 48 experts finished the experiment, and only data from these 42 experts are considered in the remainder of the analysis. We
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Activity in turtle dorsal cortex is sparse.
Supplementary Figure 1 Activity in turtle dorsal cortex is sparse. a. Probability distribution of firing rates across the population (notice log scale) in our data. The range of firing rates is wide but
More informationSupplemental Information. Ciliary Beating Compartmentalizes. Cerebrospinal Fluid Flow in the Brain. and Regulates Ventricular Development
Current Biology, Volume Supplemental Information Ciliary Beating Compartmentalizes Cerebrospinal Fluid Flow in the Brain and Regulates Ventricular Development Emilie W. Olstad, Christa Ringers, Jan N.
More informationNature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
More informationa 0,8 Figure S1 8 h 12 h y = 0,036x + 0,2115 y = 0,0366x + 0,206 Labeling index Labeling index ctrl shrna Time (h) Time (h) ctrl shrna S G2 M G1
(GFP+ BrdU+)/GFP+ Labeling index Labeling index Figure S a, b, y =,x +, y =,x +,,,,,,,, Time (h) - - Time (h) c d S G M G h M G S G M G S G h Time of BrdU injection after electroporation (h) M G S G M
More informationSupplemental Figures Legends and Supplemental Figures. for. pirna-guided slicing of transposon transcripts enforces their transcriptional
Supplemental Figures Legends and Supplemental Figures for pirn-guided slicing of transposon transcripts enforces their transcriptional silencing via specifying the nuclear pirn repertoire Kirsten-ndré
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationSUPPLEMENTARY INFORMATION. Supplementary Figure 1
SUPPLEMENTARY INFORMATION Supplementary Figure 1 The supralinear events evoked in CA3 pyramidal cells fulfill the criteria for NMDA spikes, exhibiting a threshold, sensitivity to NMDAR blockade, and all-or-none
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Ras V12 expression in the entire eye-antennal disc does not cause invasive tumours. a, Eye-antennal discs expressing Ras V12 in all cells (marked with GFP, green) overgrow moderately
More informationDiabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
More informationFigure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
More informationNeuronal plasma membrane
ORGANELLES ORGANELLES Neuronal plasma membrane The neuronal plasma membrane contains several local domains with unique properties Presynaptic terminal Endoplasmic Reticulum In neurons the Nissl bodies
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationSupplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx
More informationSUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/3/eaaq0762/dc1 Supplementary Materials for Structures of monomeric and oligomeric forms of the Toxoplasma gondii perforin-like protein 1 Tao Ni, Sophie I. Williams,
More informationCapu and Spire Assemble a Cytoplasmic Actin Mesh
Developmental Cell 13 Supplemental Data Capu and Spire Assemble a Cytoplasmic Actin Mesh that Maintains Microtubule Organization in the Drosophila Oocyte Katja Dahlgaard, Alexandre A.S.F. Raposo, Teresa
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationChapter 7 Nerve tissue 1 Liu Jiamei
Chapter 7 Nerve tissue 1 Liu Jiamei General description: nerve tissue nerve cells (neurons): show numerous long processes receive the stimulation make contact with each other, conduct the nerve impulse
More informationSupplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.5 % SDS-PAGE gel under reducing and non-reducing conditions.
More informationSupplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 The UBL and RING1 interface remains associated in the complex structures of Parkin and pub. a) Asymmetric Unit of crystal structure of UBLR0RBR and pub complex showing UBL (green),
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. ACx plasticity is required for fear conditioning.
Supplementary Figure 1 ACx plasticity is required for fear conditioning. (a) Freezing time of conditioned and control mice before CS presentation and during CS presentation in a new context. Student s
More informationTitle: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationHDL surface lipids mediate CETP binding as revealed by electron microscopy and molecular dynamics simulation
HDL surface lipids mediate CETP binding as revealed by electron microscopy and molecular dynamics simulation Meng Zhang 1, River Charles 1, Huimin Tong 1, Lei Zhang 1, Mili Patel 2, Francis Wang 1, Matthew
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for LacZ activity, which reflects Egr1 expression. (A)
More informationSupplementary Figure 1 hlrrk2 promotes CAP dependent protein translation.
` Supplementary Figure 1 hlrrk2 promotes CAP dependent protein translation. (a) Overexpression of hlrrk2 in HeLa cells enhances total protein synthesis in [35S] methionine/cysteine incorporation assays.
More informationReward prediction based on stimulus categorization in. primate lateral prefrontal cortex
Reward prediction based on stimulus categorization in primate lateral prefrontal cortex Xiaochuan Pan, Kosuke Sawa, Ichiro Tsuda, Minoro Tsukada, Masamichi Sakagami Supplementary Information This PDF file
More information