TISSUE-SPECIFIC STEM CELLS

Transcription

1 TISSUE-SPECIFIC STEM CELLS A High Concentration of Epidermal Growth Factor Increases the Growth and Survival of Neurogenic Radial Glial Cells Within Human Neurosphere Cultures AARON D. NELSON, MASATOSHI SUZUKI, CLIVE N. SVENDSEN Department of Anatomy and Neurology, Neuroscience Training Program, and Waisman Center, University of Wisconsin-Madison, Madison, Wisconsin, USA Key Words. Epidermal growth factor Neurogenesis Cortical progenitor Stem cell Cerebral cortex Development ABSTRACT Human neural progenitor cells (hnpc) isolated from the fetal cortex can be expanded as aggregates of cells termed neurospheres. Traditional methods have used 20 ng/ml epidermal growth factor (EGF) to drive the proliferation of these cells. Here, we show that 100 ng/ml EGF can significantly increase growth rates of hnpc at later passages. This was through increased survival of dividing cells rather than increased proliferation and associated with prolonged activation of ErbB2 Disclosure of potential conflicts of interest is found at the end of this article. and phosphorylated Akt. High EGF also resulted in a larger proportion of elongated radial glial -like cells within the growing neurospheres and increased expression of the radial glial markers. The number of new neurons generated from cultures maintained in 100 ng/ml EGF was significantly higher than from 20 ng/ml EGF. Thus, high concentrations of EGF increase the survival of a highly neurogenic human radial glial cell. STEM CELLS 2008;26: INTRODUCTION Human neural progenitor cells (hnpc) can be isolated from the developing human and rodent brain and proliferate in vitro as spherical aggregates of undifferentiated cells termed neurospheres [1 4]. We have grown neurospheres from the human fetal cortex for extended periods of time using a defined medium containing growth factors [5]. During later passages, hnpc require epidermal growth factor (EGF) and leukemia inhibitory factor (LIF) to maintain proliferation and neuronal production in the absence of fibroblast growth factor 2 (FGF-2) [6]. More recently, we have found that as these cultures reach later passages ( 40), hnpc begin to show reduced growth rate and neurogenesis and finally senesce at approximately 70 passages [7]. We have also shown that glutamate and a neurosteroid, dehydroepiandrosterone (DHEA), can significantly increase the proliferation rates of hnpc, and they mainly increase the elongated cells possessing morphological characteristics like those of radial glial cells [8, 9]. Radial glial cells are classically defined as cells with a radial morphology and glial characteristics typical of astrocytes, such as glial fibrillary acidic protein (GFAP) expression in primate [10]. In the developing brain, radial glial cells have long been known to produce cortical astrocytes, but recent data indicate that radial glial cells also possess neurogenic potential and divide asymmetrically to produce cortical neurons that migrate along their own processes to the appropriate cortical layers [11 13]. Similar radial glial cells have also been found in the human fetal cortex, although no real-time examination of their division and migration has been possible [14 16]. In some cases, these neurogenic radial glial cells isolated from rodents may also be stimulated to divide in vitro within cultures derived from the developing cortex [17]. However, the exact composition of neurospheres grown in culture from the developing human cortex is currently only poorly understood. Furthermore, there have been few systematic studies to determine how different concentrations of EGF may affect the growth and differentiation of hnpc in vitro. Interestingly, human embryonic stem cells exposed to higher concentrations of FGF-2 showed increased proliferation and maintenance of pluripotency [18]. In this study, we established that high EGF concentrations, raised from 20 to 100 ng/ml in the culture medium, increased overall growth rates of hnpc. This was associated with decreased cell death, possibly because of activation of ErbB2 activity. We also found that increasing the concentration of EGF in hnpc neurosphere cultures led to increased numbers of cells with a radial glial -like morphology within neurospheres and a subsequent increase in the rate of neurogenesis. MATERIALS AND METHODS HNPC Cultures hnpc were prepared as described previously [5, 19]. Human fetal tissue (between 10 and 16 weeks after conception) was obtained from the Birth Defects Laboratory at the University of Washington, Seattle, WA. The method of tissue collection followed the guidelines set forth by the National Institutes of Health, the University of Wisconsin-Madison, and the University of Washington. Institutional review board approval was obtained for all of these studies. Correspondence: Clive N. Svendsen, Ph.D., Waisman Center, University of Wisconsin-Madison, 1500 Highland Avenue, Madison, Wisconsin , USA. Telephone: ; Fax: ; svendsen@waisman.wisc.edu Received April 23, 2007; accepted for publication November 13, 2007; first published online in STEM CELLS EXPRESS November 21, AlphaMed Press /2008/$30.00/0 doi: /stemcells STEM CELLS 2008;26:

2 Nelson, Suzuki, Svendsen 349 Human cortical progenitors were prepared from fetal brains and induced to proliferate as neurospheres using established passaging methods to achieve optimal cellular expansion as previously described in detail [5]. Briefly, freshly dissected fetal tissue was dissociated in trypsin and seeded into flasks (75 cm 2 ) at a density of 200,000 cells per milliliter of maintenance medium (Dulbecco s modified Eagle s medium/ham s F-12 medium [7:3] containing penicillin/streptomycin/amphotericin B [1% vol/vol]) supplemented with B27 (2% vol/vol; Invitrogen, Carlsbad, CA, invitrogen.com), EGF (20 ng/ml; Sigma-Aldrich, St. Louis, and FGF-2 (20 ng/ml; R&D Systems Inc., Minneapolis, with heparin (5 g/ml; Sigma-Aldrich). Neurospheres were passaged using a chopping method using a McIlwain tissue chopper (Campden Instruments Ltd., Loughborough, U.K., [5]. Neurospheres were not allowed to grow any larger than 500 m in diameter and were sectioned into 200- m-diameter spheres. All cultures were maintained in a humidified incubator (37 C, 5% CO 2 in air), and half the growth medium was replenished every 3 4 days. At 2 weeks after the first passage, cells were switched to maintenance medium containing N2 supplement (1%; Invitrogen) and 20 ng/ml EGF. After 10 weeks of growth, 10 ng/ml LIF (Chemicon, Temecula, CA, was added to the cultures and maintained for a minimum of 4 weeks. Three independent lines of hnpc derived from three cortex samples (M031, M046, and M067) were used for this study. hnpc were maintained in the presence of either 20 or 100 ng/ml EGF and 10 ng/ml LIF (Chemicon) for a minimum of 14 days prior to experimentation. The concentrations of EGF protein in the conditioned medium were measured by enzyme immunoassays (human EGF Quantikine immunoassay kit; R&D Systems). Growth and Proliferation Measurements Single neurospheres from either 100 or 20 ng/ml EGF cultures were placed in a 96-well plate and were measured via Integrated Morphometry Analysis using Metamorph software (Molecular Devices, Dowington, PA, Sphere volume was calculated on day 0 and every third day up to 15 days after plating. Half of the medium was exchanged every third day. Results are plotted as the log of the sphere volume, and 95% confidence intervals were calculated and are shown around the linear regression line (Fig. 1A). Proliferation assays were carried out by culturing whole neurospheres in the presence of 0.1 M 5-bromo-2 -deoxyuridine (BrdU; Sigma-Aldrich) for either 3 or 14 hours. Neurospheres were subsequently dissociated with Accutase (Innovative Cell Technologies Inc., San Diego, and plated onto poly-l-lysine/laminin-coated coverslips for 2 hours in the absence of exogenous growth factors. Cells were then fixed in cold methanol and processed for immunocytochemistry. Differentiation of hnpc Cultures To determine the phenotypes of cells within neurospheres as well as measure the progenitors innate ability to produce neurons and astrocytes, whole neurospheres from both high- and low-egf cultures were dissociated and plated onto laminin-coated substrates in the absence of exogenous growth factors. Cells were allowed to plate for 2 hours (acute) or 7 days (differentiation) and were fixed using 4% paraformaldehyde (PFA). Cells were then processed for immunocytochemistry for -tubulin-iii (TuJ1; neurons) or GFAP (astrocytes). Immunocytochemistry Cells were processed for immunocytochemistry by fixing in either ice-cold methanol (for BrdU) or 4% PFA (for TuJ1, GFAP, or Nestin) and staining as described previously [8, 9]. Cells were permeabilized in a 5% normal goat/5% normal donkey serum with phosphate-buffered saline (PBS) and 0.2% Triton X-100 for 35 minutes at room temperature. After rinsing with PBS, the cells were then incubated with primary antibodies against human GFAP (1: 1,000, mouse monoclonal IgG1; Chemicon), human Nestin (1: 3,000, mouse monoclonal IgG1; Chemicon), TuJ1 (1:3,000, mouse monoclonal IgG2b; Sigma-Aldrich), and brain lipid-binding protein (BLBP; 1:2,000, rabbit polyclonal; kindly donated by Dr. Nathaniel Heintz, The Rockefeller University). After incubation with primary antibodies, the cells were incubated with secondary antibody conjugated to Alexa Fluor 488, Alexa Fluor 546, or Cy3 (anti-igg, 1:1,000; Invitrogen). Cells were incubated with Hoechst (0.5 g/ml in phosphate-buffered saline; Sigma-Aldrich) to stain nuclei. Cell counts were performed using a Nikon fluorescence microscope ( 20 or 40 objective; Nikon, Tokyo, and Metamorph imaging software. Quantification of cells was based on counting the number of Hoechst-stained nuclei and the specific immunostained cells in independent fields from a minimum of three coverslips. Cell Survival and Apoptotic Assays A lactate dehydrogenase (LDH) Assay Kit was purchased from Promega (Madison, WI, Cells were plated as a monolayer into a 24-well plate using the dissociation and plating methods listed above. Cells were plated in the presence of high or low EGF overnight, and then all medium was exchanged. Cells were maintained in the presence of high or low EGF for an additional 3 days prior to collection of media and lysing of the plated cells for maximal LDH release. Media and lysates were added to a 96-well microplate and were subjected to the manufacturer s protocol for assaying for LDH release. Optimal density of each sample was measured using a Molecular Devices SpectraMax 340pc system at 490 nm. The equation for calculating percentage of cytotoxicity is experimental LDH release divided by maximum LDH release. Verification of cell viability in both high- and low- EGF cultures was established by a trypan blue exclusion assay. Cells were plated using a method similar to those used for the LDH assay, only the cells were dissociated from the monolayer and subjected to trypan blue (0.4%; Sigma-Aldrich) staining. The numbers of positive and negative cells were established via counting using a light microscope. For apoptosis assay using neurosphere sections, neurospheres were allowed to settle in 15-ml Falcon tubes for 5 minutes before the culture medium was removed and replaced with 4% PFA for 20 minutes at room temperature. The fixed spheres were cryoprotected with 30% sucrose for 4 hours at 4 C. Finally, the spheres were embedded in Histoprep Frozen Tissue Embedding Media (Fisher Scientific, Fair Lawn, NJ, compound, sectioned at 10 m on a cryostat, and processed for cell death analysis using the DeadEnd Fluorometric terminal deoxynucleotidyl transferase dutp nick-end labeling (TUNEL) system (Promega). Western Blotting and Phosphorylation Assays Preparation of cell lysates and Western blotting were performed on neurospheres as described [6, 8]. Whole neurospheres were incubated in lysis buffer for 15 minutes on ice. For phosphorylation assays, neurospheres were dissociated and plated as a monolayer; they were subsequently subjected to growth factor treatment for 0, 5, 30, or 90 minutes or 24 hours and then lysed. Total protein concentrations were determined by using a range of bovine serum albumin standards in conjunction with a Bio-Rad protein analysis kit (Bio-Rad, Hercules, CA, Samples were read using a Molecular Devices SpectraMax 340pc system. Approximately 10 g of protein was loaded into each well of a 10% gel for SDS-polyacrylamide gel electrophoresis. The gel was then transferred for 1 hour at 100 V to a polyvinylidene difluoride membrane (Bio-Rad). The membrane was then blocked with a 5% blotting solution and exposed to primary antibodies overnight at 4 C or 1 hour at room temperature. Secondary antibodies were applied for 1 hour at room temperature, and blots were exposed to enhanced chemiluminescent protocols (Amersham ECL Plus Western Blotting System, GE Healthcare, Buckinghamshire, UK, Primary antibodies were as follows: BLBP, phosphorylated Akt (pakt) (rabbit polyclonal; Upstate, Charlottesville, VA, epidermal growth factor receptor (EGFR; ErbB1), phosphorylated ErbB2 (perbb2; rabbit polyclonal; Cell Signaling Technology, Danvers, MA, Actin (mouse monoclonal IgG2a; Sigma- Aldrich), S100 (rabbit polyclonal; Abcam, Cambridge, MA,

3 350 EGF Increases Neurogenesis in hnpc Table 1. Sequences of primers used for reverse transcription-polymerase chain reaction Protein Primer Oligonucleotide sequence (5 3 ) Size (base pairs) GenBank accession no. Neuregulin-1 Forward ATACTTCCACAGCCCATCACTCCA 204 NM Reverse GCATGCCTGAGGAAGCTGTTACAT Notch-1 Forward AGATCAACCTGGATGACTGTGCCA 252 NM Reverse TGCTGTTGCACTCATTGACCTCAG Epidermal growth factor receptor Forward ACTGAAGGAGCTGCCCATGAGAAA 237 NM Reverse AGTTTCTGGCAGTTCTCCTCTCCT ErbB2 Forward TCCACTTCAACCACAGTGGCATCT 234 NM Reverse ACTTCTCACACCGCTGTGTTCCAT ErbB3 Forward TGGACACAATTGACTGGAGGGACA 220 BC Reverse CACTCATCATGGCAGCACTGGTT ErbB4 Forward ACCTGCCTCTGGAGAATTTACGCA 230 NM Reverse AGGCCATGGGTTCCGAACAATATC Fibroblast growth factor 2 Forward AAGAGCGACCCTCACATCAAGCTA 236 NM Reverse TACTGCCCAGTTCGTTTCAGTGC Glypican-1 Forward TATTGCCGAAATGTGCTCAAGGGC 404 BC Reverse ATCTTCTCACTGCACAGTGTCCCT Glypican-4 Forward GTGTACCCATGCCCTGTTGAAGAT 219 BC Reverse TCGATGGGATCCATGACCGATTCA Pleiotrophin Forward GCAGCTGCCTTCTTGGCATTCATT 207 BC Reverse TGGTCTTCATGGTTTGCTTGCAC Fibroblast growth factor receptor 1 Forward AACACCAAACCAAACCGTATGCCC 290 BC Reverse ATGCTGCCGTACTCATTCTCCACA Glyceraldehyde-3-phosphate dehydrogenase Forward ACCACAGTCCATGCCATCAC 449 XR Reverse TCCACCACCCTGTTGCTGTA Vimentin (mouse monoclonal IgM; Developmental Studies Hybridoma Bank, Iowa City, IA, dshbwww), and GFAP (mouse monoclonal IgG1; Invitrogen, South San Francisco, CA). Blots were quantitated using the Scion Image software (Scion Corporation, Frederick, MD, scioncorp.com). Reverse Transcription-Polymerase Chain Reaction Total RNA was extracted from whole neurospheres grown in either high or low EGF using RNeasy purification systems (Qiagen, Valencia, CA, Reverse transcription-polymerase chain reaction (RT-PCR) was run for a maximum of 30 cycles on an MJ Research PT-200 thermal cycler (Bio-Rad). Primers were obtained from Integrated DNA Technologies (Coralville, IA, and were combined with PCR Master Mix (2 ; Promega). All primers were prepared from cdna sequences for EGFR (ErbB1), ErbB2, ErbB3, ErbB4, Neuregulin-1 (NRG-1), Notch1, FGF-2, Glypican-1, Glypican-4, Pleiotrophin, fibroblast growth factor receptor 1 (FGFR1), and glyceraldehyde-3-phosphate dehydrogenase (as an internal control), which were obtained from the GenBank database (Table 1). The sequences were designed to cross an intron-exon boundary to prevent a false-positive signal due to genomic DNA. Statistical Analysis All data for cell counting and sphere size were expressed as means SEM across three separate cell lines derived from the cortex and compared using Prizm software (GraphPad Software, Inc., San Diego, All cell-counting data were analyzed by one-way functional analysis of variance (ANOVA) using the Newman-Keuls post hoc test. For the sphere size data, the volume of each sphere was calculated as an index of cell number as previously described in detail [5], and data were analyzed using two-way ANOVA with the Bonferroni post hoc test. Differences were considered significant when p.05. RESULTS Increasing EGF Concentrations Reduces Cell Death and Increases Growth Rates of hnpc Human neural progenitor cells were isolated from fetal brain tissue and maintained for 4 weeks in both EGF (20 ng/ml) and FGF-2 (20 ng/ml) and then switched to EGF alone. At 10 weeks of growth, LIF (10 ng/ml) was added to the EGF, and the cultures were grown for an additional 5 weeks. At this stage, the cultures have reached a stable phase of growth where they produce a mixture of neurons and astrocytes upon differentiation [7]. Three independent lines of hnpc derived from three cortex samples were used throughout this study. Although all data for cell counting and sphere size were expressed as means SEM across three lines, we confirmed that the effect that each of these lines produced was the same in every assay, including RT-PCR and Western blotting analyses. To establish whether we were using optimal concentrations of EGF, we applied either 20 or 100 ng/ml to sister cultures at this stage. Volumetric measurements of single spheres over the course of 2 weeks revealed that those cultured in high EGF had a significantly greater volumetric increase than did neurospheres cultured in low EGF (Fig. 1A). Although 100 ng/ml EGF could increase the expansion rate of the cells, we still found that they entered a senescence phase between 50 and 70 weeks in vitro (data not shown), as described previously for these cells grown in 20 ng/ml EGF [7]. Given that high EGF promoted significant volumetric increases of hnpc-derived neurospheres, we next evaluated whether high EGF did this through increased proliferation or survival. Intact neurospheres were pulsed with BrdU for 14 hours while growing in the presence of EGF. These same neurospheres were subsequently dissociated and acutely plated for 2 hours in the absence of exogenous growth factors on laminin-coated coverslips. Immunostaining revealed no signif-

4 Nelson, Suzuki, Svendsen 351 Figure 1. High EGF promotes increased growth and survival of human neural progenitor cell (hnpc)-derived neurospheres. (A): Volumetric growth measurements of single neurospheres grown in the presence of either high (100 ng/ml) or low (20 ng/ml) EGF over the course of 15 days. The dashed lines indicate the 95% confidence interval around the linear regression line. Values are plotted as the log of the volumetric measurement. Ninety-five percent confidence intervals around the linear regression line were generated and show that growth of high-egf spheres was significantly greater than spheres treated with low EGF (p.05; 95% CI). (B): 5-Bromo-2 -deoxyuridine staining of acutely plated hnpc from high- and low-egf cultures showed no significant difference in cell proliferation. (C): Lactate dehydrogenase assay confirmed that high EGF reduces cell death, thereby protecting hnpc. (D): Trypan blue exclusion assay showed that cell death is significantly decreased in the high-egf-treated cultures in comparison with those treated with low EGF. (E): Terminal deoxynucleotidyl transferase dutp nick-end labeling assay using cryosections obtained from intact neurospheres also revealed a significant reduction of apoptotic cells in the high-egf-treated cultures. (F): Reverse transcription-polymerase chain reaction of ErbB family members expressed in high- and low-egf hnpc cultures. (G): Time course Western analysis of pakt, EGFR, or perbb2. The time course examined was from 0 to 90 min and 24 hr of exposure to the specified EGF concentration after growth factor starvation for 24 hr. High EGF elicited its protective feature via prolonged Akt phosphorylation after the culturing for 24 hr. At this time point, EGFR expression levels were decreased in high EGF. ErbB2 was phosphorylated on a different time course following high EGF stimulation of hnpc and prolonged until 24 hr., p.05;, p.01;, p.001, versus 20 ng/ml EGF. Abbreviations: 20E, 20 ng/ml EGF; 100E, 100 ng/ml EGF; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hr, hours; min, minutes; NRG, Neuregulin; pakt, phosphorylated Akt; perbb2, phosphorylated ErbB2. icant difference in BrdU incorporation between either treatment groups (Fig. 1B). Shorter, 3-hour pulses of BrdU (11.9% 1.4% of total cells in low EGF and 11.6% 1.3% in high EGF) or the use of other cell proliferation markers, such as Ki67 (data not shown), yielded similar results. Thus, high EGF did not promote increased neurosphere growth by increasing division rates. We therefore hypothesized that high the EGF was protecting progenitor cells after division. We next asked whether high EGF was promoting increased survival of hnpc compared with cells treated with low EGF using an LDH assay. LDH is released from dying cells or cells with a compromised cell membrane and is commonly used as a

5 352 EGF Increases Neurogenesis in hnpc marker of cell death. Because neurospheres are tightly interconnected three-dimensional structures that may not permit the release of LDH into the medium without other cells taking in the biochemical, we grew hnpc as a monolayer for 4 days in the presence of either high or low EGF. The culture medium was changed 1 day after dissociation/plating to allow the cells to recover from the acute neurosphere dissociation. We found a reduction of approximately 50% in the LDH released into the medium from cells treated with high EGF compared with the level in low EGF (Fig. 1C). Because LDH could have been released from cells with a compromised cell membrane but not necessarily from dying cells, we verified by a trypan blue exclusion assay that cells in the low-egf treatment group had increased cell death rates. Overall, roughly 50% fewer cells from the high-egf treatment group stained positive for trypan blue (Fig. 1D). Although the LDH and trypan blue exclusion assay were demonstrated with monolayered culture, we detected apoptotic cells in intact neurospheres to further assess the effects of high EGF. Apoptotic cells were detected by TUNEL assay using cryosections obtained from neurospheres grown for 14 days in either 20 or 100 ng EGF. High EGF treatment significantly reduced the number of TUNEL-positive cells, from 8.3% to 3.7% (P 0.01; Fig. 1E). Taken together, these results supported our hypothesis that high EGF protects cells from imminent cell death following cell division. We next aimed to establish a mechanism for increased hnpc survival in the presence of high EGF. EGF signals through the ErbB family of receptors. Autophosphorylation or upregulation of ErbB2 receptor activity has been associated with increased cell survival through phosphorylation of downstream elements such as Akt [20]. Our previous gene array studies suggested that ErbB1-ErbB3 receptors were expressed in hnpc, but ErbB4 was not [6]. It seemed reasonable to hypothesize that stimulation of hnpc with high EGF would increase expression of certain members of the ErbB family of receptors. Semiquantitative RT-PCR revealed that EGFR (ErB1) and ErB2 mrna were expressed in all cultures and not differentially expressed in the two treatment groups (Fig. 1F). In addition, we confirmed that NRG-1 and Notch1 mrna were expressed by hnpc (Fig. 1F) but not changed by high levels of EGF. Only two members of the ErbB family are capable of binding EGF with any affinity: EGFR (ErbB1) and ErbB2 [21]. Interestingly, ErbB2 is not capable of binding EGF as a homodimer, so it must form heterodimers with EGFR. This alteration in ligand binding with two different ErbB subunits leads to differences in the intensity as well as the type of downstream signal elicited. Because ErbB2 is a potent signaler of the PI- 3Kinase/Akt survival pathway, it seemed reasonable to hypothesize that high concentrations of EGF may stimulate a larger number of ErbB1/2 heterodimers, leading to a potent survival signal via Akt phosphorylation. Initially, evaluation of protein expression of pakt and perbb2 after a 5-minute pulse with EGF showed no significant difference between treatment groups (data not shown). This result was not surprising, as activation of downstream signals via the ErbB family requires times greater than 5 minutes [22]. Therefore, examination of a time course for EGF pulsing (0, 5, 30, and 90 minutes and 24 hours) was appropriate. A concentration of 100 ng/ml EGF, but not 20 ng/ml, elicited a prolonged, sustained pakt signal, suggesting that stimulation via high EGF influences cell survival through this mechanism (Fig. 1G). This prolongation of Akt phosphorylation was accompanied by decreases in EGFR protein levels and increases in ErbB2 phosphorylation (Fig. 1G), supporting the idea that high EGF activates a different EGF signaling pathway. It was possible that this lack of sustained Akt phosphorylation at 20 ng/ml was simply due to the uptake of EGF by the dividing cells, thus exhausting the amounts available to the receptor. To answer this possibility, we cultured neurospheres in the medium with 20 ng/ml for 3 days (the same length of time at which we normally replenished the fresh medium) and then determined EGF levels in the culture medium by enzyme-linked immunosorbent assay. Compared with the EGF levels in preculture medium ( ng/ml), the EGF concentration after 3 days of culturing was ng/ml, suggesting that the concentration was still maintained at between 10 and 20 ng/ml. Increased Elongated Cell Types Present in High-EGF hnpc Cultures A small number of TuJ1-positive neuroblasts are observed within hnpc neurospheres, although the majority of cells express both nestin and GFAP [6]. By growing cells in a higher concentration of EGF, it seemed reasonable to hypothesize that more cells within the core of the neurosphere would be stimulated to divide as nestin/gfap-positive progenitors and not divide to form neuroblasts [23, 24]. To investigate this possibility, hnpc were cultured in the medium with 20 or 100 ng/ml EGF for 14 days. The neurospheres were then dissociated to a single-cell suspension and plated for 1 hour before fixation and staining for the neuronal marker TuJ1, the astrocyte/progenitor cell marker GFAP, and the progenitor cell marker nestin. In keeping with our previous results [6, 8, 25], in 20 ng/ml EGF, the number of TuJ1-positive cells was less than 3% of the population, whereas GFAP- or Nestin-positive cells represented more than 75% of the population (Fig. 2A 2C). This was not changed by increasing the EGF concentration to 100 ng/ml (Fig. 2A 2C), showing that high EGF does not eliminate the small number of spontaneously differentiating neurons within the neurosphere. We have recently shown that both glutamate and a neurosteroid, DHEA, have powerful effects on the proliferation of hnpc and increased the elongated cells in neurospheres, which have morphological characteristics similar to radial glial cells [9]. We hypothesized that high EGF treatment may also mainly affect the hnpc with a radial glial phenotype. To test this possibility, we compared the different types of cells in proliferating hnpc using double labeling with GFAP and nestin following acute plating for 2 hours. In the present study, we classified GFAP/nestin-positive progenitor cells into three groups based on morphological differences: (a) small and flat, (b) elongated and radial, or (c) large and flat morphology (Fig. 2F). hnpc treated with high concentrations of EGF revealed a significant increase in the elongated, unipolar/bipolar morphology of cells with a subsequent reduction in the large, flat astrocyte-like cell type compared with low-egf cultures (Fig. 2G). Like our previous observations [8, 9], the present results suggest that high EGF increased the number of radial cells growing within neurospheres and that this elongated cell morphology may represent neurogenic radial glial cells. To establish whether high EGF altered the presence of an intermediate neuronal progenitor cell population, we determined absolute protein levels of radial glial cell markers in response to EGF by using Western blot. Neurospheres were grown in the presence of high or low EGF for 14 days, followed by protein isolation. Western blot analysis revealed that high EGF increased the protein expression of gliogenic markers, such as radial glial markers BLBP and Vimentin and astroglial/radial glial marker S100 (Fig. 2H). Using the densitometric analysis of each band, we found that high EGF could increase BLBP, Vimentin, and S100 protein by 60%, 122%, and 23%, respectively, compared with low EGF. In contrast, the level of GFAP expression was not significantly different between high- and low-egf cultures.

6 Nelson, Suzuki, Svendsen 353 Figure 2. Enhancement of an elongated cell population in human neural progenitor cell (hnpc) cultures in response to high EGF. (A C): Examination of -tubulin-iii (A), GFAP (B), and Nestin (C) expression in acutely plated hnpc cultures. No significant difference was found in the expression of these markers. (D, E): Photomicrographs of nestin-stained low-egf (D) and high-egf (E) cultures. (F): Morphological analysis of GFAP /Nestin cells from low- and high-egf cultures. Examples of the different cell types (i.e., large/flat, short/flat, and elongated) are shown stained with GFAP /Nestin. The values listed are the ranges of nuclear areas of cells that fall within these categories. (G): A significant increase in elongated cell morphologies in the high-egf-treated cultures with a reduction in the large, flat astrocytic cell morphologies was observed. (H): Western analysis revealed an increase expression of radial glia markers., p.05 versus 20 ng/ml EGF. Abbreviations: 20E, 20 ng/ml EGF; 100E, 100 ng/ml EGF; BLBP, brain lipid-binding protein; EGF, epidermal growth factor; GFAP, glial fibrillary acidic protein. Growth of Neurospheres in High EGF Leads to Increased Neurogenesis Following Differentiation Because radial glial cells are the primary neuron-producing cells in the developing cortex, we next established whether the observed increase in the radial glial-like morphology in the high- EGF culture led to an increase in neurogenesis upon differentiation. Cultures grown in 20 or 100 ng/ml EGF were dissociated, plated as a monolayer at high density (1,000 cells per microliter), and allowed to differentiate over 7 days as described in detail previously [6, 8, 25]. Cells derived from 100 ng/ml EGF cultures displayed increased neurogenesis compared with cells from 20 ng/ml EGF, whereas the number of GFAP-positive cells remained stable (Fig. 3A 3D). It remained possible that high EGF was not only stimulating hnpc to be maintained as radial glial cells but that it also converted some cells to intermediate neuronal progenitor cells. FGF-2 release from high-egf cultures may also be influencing neurogenesis patterns. Previous results suggest that low concentrations of FGF-2 can influence hnpc to undergo increased neurogenesis, whereas high concentrations of FGF-2 are inhibitory to neurogenesis [24]. It was therefore possible that FGF-2 released from the differentiating progenitors contributed to the increased neurogenesis. We therefore examined FGF-2 expression within hnpc treated with 20 or 100 ng/ml EGF and found that FGF-2 mrna was the same under both conditions (Fig. 3E). Alterations of other proteoglycans, such as Glypicans-1 and -4, Pleiotrophin, and FGFR1, which are capable of modulating FGF-2 binding to its receptor, were also similar in both 10 and 100 ng/ml treated cultures (Fig. 3E). Thus, FGF-2 signaling was not responsible for the increased neurogenesis from cultures grown in 100 ng/ml EGF. DISCUSSION The influence that growth factors and other extrinsic molecules have on the proliferation and differentiation of human stem cells is poorly understood. Clearly, adjustments to current culture methods will need to be performed to optimize the culture system. The self-renewal of human embryonic stem cells in the absence of a mouse feeder layer required the administration of high doses of FGF-2 (100 ng/ml) [26]. Our initial idea was to

7 354 EGF Increases Neurogenesis in hnpc Figure 3. Increased neurogenesis from differentiated high-egf human neural progenitor cell cultures. (A, B): Photomicrographs of differentiated TuJ1 positive neurons from either low-egf-treated (A) or high-egf-treated (B) cultures. Scale bar 20 m. (C): High-EGF cultures produced significantly more neurons over a 7-day period of differentiation than did low-egf cultures. (D): The percentage of astrocytes was significantly decreased in high-egf-supplemented cultures as assayed by GFAP immunostaining. (E): Reverse transcription-polymerase chain reaction analysis of high- and low-egf cultures shows no significant change in proteoglycans or FGF-2/FGFR1 expression., p.05;, p.01, versus 20 ng/ml EGF. Abbreviations: 20E, 20 ng/ml EGF; 100E, 100 ng/ml EGF; EGF, epidermal growth factor; FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; TuJ1, -tubulin-iii. increase the concentration of EGF in an attempt to remove the small number of spontaneously differentiating neuroblasts within growing neurospheres through driving all of the nestin/ GFAP-positive progenitors. To our surprise, although a reduction in spontaneous neurogenesis did not occur with high EGF supplementation, the cultures did grow significantly faster and gave rise to more neurons upon differentiation. The relevance of these data to in vivo regulation of stem and progenitor cell proliferation and differentiation is difficult to assess given the artificial nature of this culture system. In addition, we used the neurospheres derived from the cerebral cortex in the present study. Therefore, the results we report here may not be generalized to hnpc originated from other regions of the central nervous system [27]. However, this information is important for understanding how human neural progenitor cells divide and differentiate in vitro, thus aiding both cell therapy and drug screening applications currently being established for these cells. EGF signals through the ErbB family of receptors. Furthermore, ErbB1 and ErbB3 receptors have previously been shown to be responsible for activating radial glia and thus making them capable of producing neurons and allowing neuronal migration into the cortex along their long processes [28, 29]. Thus, it is possible that adding a high concentration of EGF to hnpc stimulated NRG-1 release and subsequent binding to ErbB2/ ErbB3 heterodimers. However, because similar levels of ErbB3 and NRG-1 mrna were observed in both high and low EGF, it is unlikely that NRG-1 binding to ErbB2/ErbB3 heterodimers was responsible for any of the observed effects in these cultures. The potential for ErbB2 activation, however, was also possible through ErbB1/ErbB2 heterodimerization. Sustained ErbB2 activation was found in hnpc treated with high EGF but not 20 ng/ml EGF. This survival signal was likely protecting new radial glial-like cells in the high-egf-treated hnpc cultures, as we saw a reduction in cell death with an increase in the number of elongated cell types. This survival signal was likely a phosphorylated form of Akt, the antiapoptotic protein. Although radial glial cells have long been known to produce cortical astrocytes in the developing brain, recent data indicate that radial glial cells might also possess neurogenic potential and divide asymmetrically to produce cortical neurons [11, 14]. In the presence of high levels of EGF, our cultures maintained a larger number of cells with a radial glial morphology. Although it has been difficult to find immunocytochemical markers that specifically identify these cells under the microscope, our Western analysis suggested that at least three markers of radial glia (BLBP, Vimentin, and S100) are increased in high EGF. When removed from the mitogen EGF, these radial gliallike cells undergo further division that produces neurons in this culture system [23, 24], thus leading to a higher proportion of neurons. Therefore, high EGF concentrations both increase the rate of division, allowing large numbers of cells to be generated, and enhance neuronal output from these cultures. CONCLUSION We have shown here that hnpc cultures treated with 100 ng/ml EGF show significantly increased growth rates compared with traditional levels used by most investigators of 20 ng/ml. Interestingly, this was through increased survival of dividing cells rather than increased proliferation and associated with prolonged activation of ErbB2 and phosphorylated Akt. We have also demonstrated that high EGF selectively protects a high proportion of elongated radial glial-like cells within the growing neurospheres, which maintain the capacity to generate neurons

8 Nelson, Suzuki, Svendsen 355 upon differentiation. Thus, the exact concentrations of growth factors added to growing stem and progenitor cell culture systems should be carefully evaluated to maintain specific populations of dividing cells. ACKNOWLEDGMENTS This work was supported by National Research Service Award Grant T32 GM07507 and by a Children s Neurobiological Solutions grant. A.D.N. and M.S. contributed equally to this work. DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST The authors indicate no potential conflicts of interest. REFERENCES 1 Reynolds BA, Weiss S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 1992;255: Svendsen CN, Clarke DJ, Rosser AE et al. Survival and differentiation of rat and human epidermal growth factor-responsive precursor cells following grafting into the lesioned adult central nervous system. Exp Neurol 1996;137: Vescovi AL, Parati EA, Gritti A et al. Isolation and cloning of multipotential stem cells from the embryonic human CNS and establishment of transplantable human neural stem cell lines by epigenetic stimulation. Exp Neurol 1999;156: Carpenter MK, Cui X, Hu ZY et al. In vitro expansion of a multipotent population of human neural progenitor cells. Exp Neurol 1999; 158: Svendsen CN, ter Borg MG, Armstrong RJ et al. A new method for the rapid and long term growth of human neural precursor cells. J Neurosci Methods 1998;85: Wright LS, Li J, Caldwell MA et al. Gene expression in human neural stem cells: Effects of leukemia inhibitory factor. J Neurochem 2003;86: Wright LS, Prowse KR, Wallace K et al. Human progenitor cells isolated from the developing cortex undergo decreased neurogenesis and eventual senescence following expansion in vitro. Exp Cell Res 2006;312: Suzuki M, Wright LS, Marwah P et al. Mitotic and neurogenic effects of dehydroepiandrosterone (DHEA) on human neural stem cell cultures derived from the fetal cortex. Proc Natl Acad Sci U S A 2004;101: Suzuki M, Nelson AD, Eickstaedt JB et al. Glutamate enhances proliferation and neurogenesis in human neural progenitor cell cultures derived from the fetal cortex. Eur J Neurosci 2006;24: Levitt P, Rakic P. Immunoperoxidase localization of glial fibrillary acidic protein in radial glial cells and astrocytes of the developing rhesus monkey brain. J Comp Neurol 1980;193: Noctor SC, Flint AC, Weissman TA et al. Neurons derived from radial glial cells establish radial units in neocortex. Nature 2001;409: Noctor SC, Flint AC, Weissman TA et al. Dividing precursor cells of the embryonic cortical ventricular zone have morphological and molecular characteristics of radial glia. J Neurosci 2002;22: Malatesta P, Hartfuss E, Gotz M. Isolation of radial glial cells by fluorescent-activated cell sorting reveals a neuronal lineage. Development 2000;127: Rakic P. Developmental and evolutionary adaptations of cortical radial glia. Cereb Cortex 2003;13: Zecevic N. Specific characteristic of radial glia in the human fetal telencephalon. Glia 2004;48: Howard B, Chen Y, Zecevic N. Cortical progenitor cells in the developing human telencephalon. Glia 2006;53: Gregg C, Weiss S. Generation of functional radial glial cells by embryonic and adult forebrain neural stem cells. J Neurosci 2003;23: Xu RH, Peck RM, Li DS et al. Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells. Nat Methods 2005;2: Svendsen CN, Caldwell MA, Ostenfeld T. Human neural stem cells: Isolation, expansion and transplantation. Brain Pathol 1999;9: Bacus SS, Altomare DA, Lyass L et al. AKT2 is frequently upregulated in HER-2/neu-positive breast cancers and may contribute to tumor aggressiveness by enhancing cell survival. Oncogene 2002;21: Oda K, Matsuoka Y, Funahashi A et al. A comprehensive pathway map of epidermal growth factor receptor signaling. Mol Syst Biol 2005;1: Nagashima T, Shimodaira H, Ide K et al. Quantitative transcriptional control of ErbB receptor signaling undergoes graded to biphasic response for cell differentiation. J Biol Chem 2007;282: Ostenfeld T, Svendsen CN. Requirement for neurogenesis to proceed through the division of neuronal progenitors following differentiation of epidermal growth factor and fibroblast growth factor-2-responsive human neural stem cells. STEM CELLS 2004;22: Nelson AD, Svendsen CN. Low concentrations of extracellular FGF-2 are sufficient but not essential for neurogenesis from human neural progenitor cells. Mol Cell Neurosci 2006;33: Caldwell MA, He X, Wilkie N et al. Growth factors regulate the survival and fate of cells derived from human neurospheres. Nat Biotechnol 2001;19: Li XJ, Du ZW, Zarnowska ED et al. Specification of motoneurons from human embryonic stem cells. Nat Biotechnol 2005;23: Ostenfeld T, Joly E, Tai YT et al. Regional specification of rodent and human neurospheres. Brain Res Dev Brain Res 2002;134: Anton ES, Marchionni MA, Lee KF et al. Role of GGF/neuregulin signaling in interactions between migrating neurons and radial glia in the developing cerebral cortex. Development 1997;124: Patten BA, Peyrin JM, Weinmaster G et al. Sequential signaling through Notch1 and erbb receptors mediates radial glia differentiation. J Neurosci 2003;23: