Supplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule
|
|
|
- Job Lindsey
- 5 years ago
- Views:
Transcription
1 Cell Reports, Volume 18 Supplemental Information rown dipogenic Reprogramming Induced by a Small Molecule aoming Nie, Tao Nie, Xiaoyan Hui, Ping Gu, Liufeng Mao, Kuai Li, Ran Yuan, Jiashun Zheng, Haixia Wang, Ke Li, Shibing Tang, Yu Zhang, Tao Xu, imin Xu, Donghai Wu, and Sheng Ding
2 Figure S1 CC1 Ctrl +Rosig Rosig 3T3-L1 T Ctrl HX31 T1/ Ctrl Ctrl HX31 HX31 HX31+ Figure S1, related to Figure 1. Selectively Induces rowning dipogenesis. () Oil Red O staining in CC1 cells shows adipogenesis induced by, rosiglitazone (Rosig) and + rosiglitazone. () Oil Red O staining shows the opposite adipogenic effects of the RXR agonist and the RXR antagonist HX31 in the differentiation of 3T3-L1, C3H1T1/ (T1/), and pre-t cells.
3 Relative mrn levels Relative mrn levels(log) Figure S shrxr in CC1 shnt RXR RXR RXR shrxr shrxr shrxr 1 1 RXR OE in CC1 RXR RXR RXR - pmx RXR OE RXR OE RXR OE D RXR + RXR + RXR + pmx C 3 1 M y f M y o D E Ctrl M y o G 1... M H C pmx F R e R e P s a t1 Retn Retnla Psat RXRα G Ctrl.. C trl.. C trl 1... right DPI UCP1 Merge RXRβ RXRγ H U c p 1 P m 1 P p a r P g c 1 C o x 7 a 1 C o x 8 b P p a r Ucp1 Prdm1 Pparα Pgc1α Cox7a1 Cox8b Pparγ Figure S, related to Figure. RXR Mediates -Induced rown dipogenesis. () Real-time PCR showing the knock-down efficiency of RXR shrn in CC1 cells. () Real-time PCR showing the RXR overexpression (OE) in CC1 cells. OE, overexpression. (C) Real-time PCR results showing /RXR inhibiting effect on myogenesis genes. (D) right-field microscopy of /RXR-induced adipogenesis in primary myoblasts. (E) right-field microscopy of /RXR-induced adipogenesis in C3H1T1/ cells. dipocyte with smaller lipid droplets. (F) Real-time PCR showing WT-specific genes in adipocytes induced from C3H1T1/ cells by /RXR. (G) UCP1 immunostaining in -treated C3H1T1/ cells. (H) Real-time PCR showing T-specific genes in adipocytes induced from C3H1T1/ cells by /RXR. Values are normalized to control values and expressed as mean ± SEM (n=3). p<., p<.1, p<.1.
4 R e la tiv e m R N le v e l Figure S T shn T s h P R D M P r d m 1 Figure S3, related to Figure 3. Role of Prdm1 in rown dipogenesis. () Pre-T cells were infected with Prdm1 shrn retrovirus and cultured in basal adipogenic medium for days to induce adipogensis. RN was extracted, and the Prdm1 level was determined by real-time PCR. Values are normalized to shnt and expressed as mean ± SEM (n=3). () CRISPR/Cas9 knockout of Prdm1 in C3H1T1/ cells. T cloning and sequencing showed that grn induces a frame-shift mutation starting at amino acid 7.
5 Figure S GO Term(iological Process) Count % PValue enjamini angiogenesis E-.38 response to hypoxia.71.7e-.389 response to oxygen levels E-.8 regulation of transcription from RN polymerase II promoter blood vessel development blood vessel morphogenesis response to wounding vasculature development regeneration positive regulation of transcription from RN polymerase II promoter Figure S. related to Figure. No Significantly Enriched GO Terms in Genes Downregulated by in Microarray ssay. The downregulated genes in Fig. were analyzed in the DVID GO database. The top 1 enriched GO terms are shown. enjamini value >..
6 Tissue weight(g) R e la tiv e U c p 1 m R N le v e l VO (ml/hr/kg) 7:: 1:: 13:: 1:: 19:: :: 1:: :: 7:: Food intake(g/hr) ctivity(xm counts) VO (ml/hr/kg) Figure S F D. vechicle light Saline a dark dark light +CL E Saline a T subwt ewt rwt C CL31,3 8 a d ip g e n e s is g e n e -S K M m y o g e n e s is g e n e -S K M 1 8 G p d ip o n e c tin P g c 1 C o x 7 a 1 C o x 8 b U c p 1 liver(hfd) 1 8 P r d m 1 liv e r(h F D ) H M y f M y o D 3 M y o G T n n i M h c b C k m P a x 7 m a tu r e a d ip o c y t e p d ip Q F g f 1 1 i T s u b W T e p iw T Figure S, related to Figure. Effect of on mouse adipose morphology, gene expression and function. () Food intake in -treated mice and vehicle-treated controls. () Physical activity of vehicle- and -treated mice for 1 h light and 1 h dark period (n=9 per group). (C-D) O consumption in control and -treated mice upon β3-agonist CL31,3 administration. n=-. p<..(e) HE staining in fat tissues from -treated mice and vehicletreated controls. (F) HE staining and gene expression in vehicle- and -treated skeletal muscle. (G) HE staining and gene expression in liver in vehicle- and -treated mice fed with a high-fat diet for weeks. (H) Ucp1 expression in mature primary brown and white adipocytes treated by vehicle and for h. p<., p<.1.
7 Table S1. Primer Sets Used in This Study, related to Figure 1-. Gene name Forward primer ('-3') Reverse primer ( -3 ) Pgc1α CCCTGCCTTGTTGCC TGCTGCTGTTCCTGTTTTC Prdm1 CGCCGGTGGCCTTC GCGTGCTCCGCTTGTG Ucp1 TCTCTGCCGGCGTCCC GGCCCCCCTTTG diponectin GCCTGGCGTTCTCTGC GTGGTGGGCGGCCTTGT Cox7a1 CGCGTCTGGTCGTCTGT GCCGTGTGGCGG Cox8b GCCTGGCCCGCT GCGGTTCCGTGGTTCC Pparγ GTGCCGTTTCGTCCGTG GGCCGCTCGTGTGTG Pparδ CTCGGGCTCCTGCTCC GGTCTGCTCTGCCCCT Pparα GTTCGGGCGCGTTG CGTGGGGGGGGCG Rxrα GGGCTGGTTGTCGCG GTTGGGGTTGGGGCG Rxrβ CTGGCTGGGGGG GTCCCGGCTCTCCTCG Rxrγ GCGCCCTGTTGG CGGCTCTGGGGCTC Cd3 GCGCTGTTTGGCC CCTGCTGTCGGG Fgf1 CCTGGGTGTCGCCTCT CTCCGCGCGTTCTCTG Gs CGGCGCCTGCCTTCT CTTTCCTCTGGCTCTGGG Pex11a CCGGGCCGCTTTTCG TCTCCGCCTCTTGGCTTC Ero1l CTTGCTCGTTGGCTCCTG CCGGTCGTCGTCCGGT ap TGTGTGTGCCTTTGTGG CCTTTCCTTGTGGCGC csl1 CGCTCCCCCTTCTGGTT CCTCGTGGTCCCGCT Tbx1 CCTCGGGCCGCGC GGTGGCCCTCGGGTC Ptgs(Cox-) CGCGTCTGCGGG GGCGCGTTTTGTTGTCTGT mp TGGCTGTTTTTGCCTTGTTT CTCCTGCGGCTTGGCT Krox(Egr) TTGCCGTGCGGGTG CGGTGGGGCGGCT MyoD CGCCCTCCGGGCTG GGTCGTCTGCTGTCTCGG Myf CGCCCCCCTCCCTG GGGCCGCGGGCTGTT MyoG GCGCGGCTCGGTGTG CTGTGGCGCTCTGTCTGGT Myh3(Mhcb) GGCCTCCTGCGC CGCTCTCTGTCCGTGTCTC Retn (resistin) TGGCCTCGCGG CTTCCCTCTGGGGGCTG Retnla CCCTTCTCTCTGCTCTCC CTGGTTGGCGGTTCC Psat1 CTCGTGCGGCTGGG TTGTCCTTCCGGCCT Tnni GTCTCGGTGGGGTGG TCTTTCTCCGCTCTGTGGC Ckm CCTCCCGCCGCG CGCTTGCTTGTTGTGGG Pax7 GCGGGGCCCC GTCGGGTTCTGTTCCCT Gapdh CGTCCCGTGCTGGT TTGTGGCCTCTCCC
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
SUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
Supplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
Supplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for LacZ activity, which reflects Egr1 expression. (A)
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
Supplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
Regulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
Mesenchymal progenitor cells in intramuscular connective tissue development
Mesenchymal progenitor cells in intramuscular connective tissue development Min Du, Ph.D. Professor and Endowed Chair Department of Animal Sciences Washington State University Pullman, WA Beef Quality:
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
5/16/2014. Why is the fetal stage so important for beef cattle? Can Cow Nutrition Affect Performance, Quality and Palatability of Its Calf?
Why is the fetal stage so important for beef cattle? Can Cow Nutrition Affect Performance, Quality and Palatability of Its Calf? Min Du Professor Department of Animal Sciences Washington State University
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol
ell Metabolism, Volume 7 Supplemental Information The Hormone Stimulates Water Drinking in Response to Ketogenic Diet and lcohol Parkyong Song, hristoph Zechner, Genaro Hernandez, José ánovas, Yang Xie,
1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
Supplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons
Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,
p53 Plays a Role in Mesenchymal Differentiation Programs, in a Cell Fate Dependent Manner
p53 Plays a Role in Mesenchymal Differentiation Programs, in a Cell Fate Dependent Manner Alina Molchadsky 1., Igor Shats 1., Naomi Goldfinger 1, Meirav Pevsner-Fischer 1, Melissa Olson 2, Ariel Rinon
Baf60c drives glycolytic muscle formation and improves glucose homeostasis through Deptor-mediated Akt activation
Baf6c drives glycolytic muscle formation and improves glucose homeostasis through Deptor-mediated Akt activation Zhuo-Xian Meng,2, Siming Li,2, Lin Wang,2, Hwi Jin Ko 3, Yongjin Lee 3, Dae Young Jung 3,
MBB317. Dr D MANGNALL OBESITY. Lecture 2
MBB317 Dr D MANGNALL OBESITY Lecture 2 When the structure of the insulin receptor was first discovered it was assumed that the active beta subunit tyrosine kinase would phosphorylate some intracellular
FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
Correspondence: Ande Satyanarayana, 1410 Laney Walker Blvd., Rm-CN3150, Augusta, GA
Original Article Heart Metab. (2016) 69:4-8 Brown adipose tissue and the genetics of obesity Ande Satyanarayana, PhD Department of Biochemistry and Molecular Biology, Molecular Oncology & Biomarkers Program,
Fetal Programming in Meat Production
Fetal Programming in Meat Production Min Du Department of Animal Sciences Washington State University Why is the fetal stage so important for beef cattle? Beef cattle pregnancy lasts for about 9 and half
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Metabolic Solutions Development Company, Kalamazoo, USA.
New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.
Supplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
Project Summary. Principal Investigator: C. Krehbiel Oklahoma State University
Project Summary Skeletal muscle differentially influences marbling development through IGF-I and myostatin pathways in growing versus finishing beef cattle Principal Investigator: C. Krehbiel Oklahoma
Beneficial effects of naringenin and indomethacin on white and brown adipocytes
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Masters Theses Graduate School 12-2016 Beneficial effects of naringenin and indomethacin on white and brown adipocytes
Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
Journal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
In search for obesogens. Ewa Szalowska BDS Amsterdam 2012
In search for obesogens Ewa Szalowska BDS Amsterdam 212 Obesogens-an environmental link to Obesogens (B. Blumberg 26)- a subset of endocrine disrupting chemicals (EDCs) that activate PPARγ obesity PPARγ
Endocrine Disrupters as Obesogens
Endocrine Disrupters as Obesogens Is the environment making us fat? Bruce Blumberg, Ph.D. Department of Developmental and Cell Biology Department of Pharmaceutical Sciences Developmental Biology Center
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Acquisition of brown fat characteristics by white adipose
ENERGY BALANCE-OBESITY A Role for Phosphodiesterase 3B in Acquisition of Brown Fat Characteristics by White Adipose Tissue in Male Mice Emilia Guirguis, Steven Hockman, Youn Wook Chung, Faiyaz Ahmad, Oksana
TGR5 activation induces intestinal growth and improves intestinal mucositis in mice. Hannelouise Kissow
TGR5 activation induces intestinal growth and improves intestinal mucositis in mice Hannelouise Kissow Department of Biomedical Sciences Faculty of Health and Medical Sciences Faculty Disclosure x No,
ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
Diseases of the skeleton
Diseases of the skeleton Flexibility Protection of vital organs Strength Skeletal defects impact human health Developmental diseases Degenerative diseases Fins regenerate and grow rapidly following amputation
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
Figure S1, Beyer et al.
Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r
Mamofillin New aesthetic perspective
New aesthetic perspective info@ White adipose tissue (WAT) White adipose tissue (WAT) is the prevalent type in human adults functioning as the major storage site for the lipids absorbed from daily intake
FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
PAX8-PPARγ Fusion Protein in thyroid carcinoma
Sidney H. Ingbar Lecture, ATA 10/17/2013: PAX8-PPARγ Fusion Protein in thyroid carcinoma Ronald J. Koenig, MD, PhD Division of Metabolism, Endocrinology & Diabetes University of Michigan Learning Objectives
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
Adipose tissue deletion of Gpr116 impairs insulin sensitivity through modulation of adipose function
FEBS Letters 586 (2012) 3618 3625 journal homepage: www.febsletters.org Adipose tissue deletion of Gpr116 impairs insulin sensitivity through modulation of adipose function Tao Nie a, Xiaoyan Hui c, Xuefei
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
PROGRESS TOWARDS OBJECTIVES, SIGNIFICANT RESULTS, DEVIATIONS, REASONS FOR FAILING, CORRECTIVE ACTIONS
FINAL REPORT Grant Agreement PIEF-GA-2011-303197 Obesity and Light PROGRESS TOWARDS OBJECTIVES, SIGNIFICANT RESULTS, DEVIATIONS, REASONS FOR FAILING, CORRECTIVE ACTIONS For the total period (2 years) three
Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
An HMGA2-IGF2BP2 Axis Regulates Myoblast Proliferation and Myogenesis
Please cite this article in press as: Li et al., An HMGA2-IGF2BP2 Axis Regulates Myoblast Proliferation and Myogenesis, Developmental Cell (2012), http://dx.doi.org/10.1016/j.devcel.2012.10.019 Developmental
Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue
Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
SUPPLEMENTAL DATA. Lumen area ( m 2 )
Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental
Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
fasting blood glucose [mg/dl]
![fasting blood glucose [mg/dl]](/thumbs/80/82129652.jpg "fasting blood glucose [mg/dl]")
SUPPLEMENTL MTERIL Supplemental Figure I body weight [g] 5 5 5 fasting blood glucose [mg/dl] 5 5 5 C total cholesterol [mg/dl] 8 6 4 WT Has -/- Supplemental Figure I: Has-deficient mice exhibited no apparent