Inhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties

Size: px
Start display at page:

Download "Inhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties"

Transcription

1 SUPPLEMENTAL INFORMATION Inhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties Anurag N Paranjape 1, *, Rama Soundararajan 1, *, Steven J Werden 1, Robiya Joseph 1, Joseph H Taube 1, Hui Liu 1, Jaime Rodriguez-Canales 1, Nathalie Sphyris 1, Ignacio Wistuba 1, Jasreman Dhillon 4, Nupam Mahajan 4, Kiran Mahajan 4, Jeffrey T Chang 5, Michael Ittmann 6, Sankar N Maity 7, Christopher Logothetis 7, Naoyuki Miura 8, Dean G Tang 9, Sendurai A Mani 1,2,3, 1 Department of Translational Molecular Pathology, 2 Metastasis Research Center, 3 Center for Stem Cells and Developmental Biology, UT MD Anderson Cancer Center, Houston, TX Department of Oncological Sciences, Moffitt Cancer Center, University of South Florida, Tampa, FL Department of Integrative Biology and Pharmacology, School of Medicine; School of Biomedical Informatics; UT Health Sciences Center at Houston, Houston, TX Department of Pathology and Immunology, Baylor College of Medicine, One Baylor Plaza, Houston, TX Department of Genitourinary Medical Oncology, UT MD Anderson Cancer Center, Houston TX Department of Biochemistry, Hamamatsu University School of Medicine, Hamamatsu , Japan. 9 Department of Molecular Carcinogenesis, Science Park, UT MD Anderson Cancer Center, Smithville, TX *ANP and RS share co-first-authorship Correspondence: Sendurai Mani, 2130 West Holcombe Blvd, LSP9.2001, Department of Translational Molecular Pathology, UTMDACC, Houston, Texas Tel: Fax: mani@mdanderson.org Running title: FOXC2 determines EMT and stem-cell features in PCa

2 2 SUPPLEMENTAL FIGURE LEGENDS Figure S1: Immunohistochemical analysis of FOXC2 expression in primary human prostate tissue samples representing BPH (Benign prostatic hyperplasia), PIN (Prostatic intraepithelial neoplasia), and Gleason Grade 7. Shown are 3 distinct samples representing each condition. BC: Human Breast Cancer tissue sample, positive control (scale bar=100μm). Figure S2: Immunohistochemical analyses demonstrating that primary human prostate smallcell carcinoma tissue characterized by lack of AR expression, exhibits high level of FOXC2 expression (scale bar=50μm). Inset in the right panel shows a higher magnification of the FOXC2-stained tissue. Figure S3: Immunoblot analyses demonstrating reciprocal relationship between expression of FOXC2 and AR in lysates of various human patient-derived tumor xenograft (PDX) sublines that model lethal variant small cell prostate carcinoma with AR-negative neuroendocrine features (1, 2) [ and 177-0: AR-negative sublines; and : AR-positive controls]. Figure S4: qrt-pcr analyses for prostate differentiation markers - AR and PSA - in DU145 cells, performed progressively from days 0-7 after SB treatment. Y-axis represents fold change in HPRT-normalized mrna expression in SB treated samples compared to that in control cells (n=3; error bars indicate SEM). Figure S5: RFP-luciferase-labeled DU145 prostate tumor cells were subcutaneously injected into NOD/SCID mice and tumor progression monitored by bioluminescent imaging. After formation of palpable tumors (approximately 2 weeks), mice were randomly divided into 4 groups, and treated as indicated. Panel shows mice and luminescence of luciferase activity discernable at the end of the treatment schedule (n=8 data points).

3 3 Supplemental - References: 1. Tzelepi V, Zhang J, Lu JF, Kleb B, Wu G, Wan X, et al. Modeling a lethal prostate cancer variant with small-cell carcinoma features. Clin Cancer Res. 2012;18: Aparicio A, Tzelepi V, Araujo JC, Guo CC, Liang S, Troncoso P, et al. Neuroendocrine prostate cancer xenografts with large-cell and small-cell features derived from a single patient's tumor: morphological, immunohistochemical, and gene expression profiles. Prostate. 2011;71:

4 Supplementary Figure S1 FOXC2 BPH PIN Gleason 7 Case #: 1, 2, 3 4, 5, 6 7, 8, 9 Positive control (Human BC specimen) Negative control (No primary antibody)

5 Supplementary Figure S2 H&E AR FOXC2

6 Supplementary Figure S (AR+) (AR-) (AR+) (AR-) AR FOXC2 Actin

7 Supplementary Figure S4 Relative mrna expression AR PSA Days (with SB203580)

8 Supplementary Figure S5 Vehicle SB Enzalutamide Week 1 Week 2 Week 3 Week 4

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

esmo.org September 2014, Madrid, Spain

esmo.org September 2014, Madrid, Spain Selinexor (KPT- 330), an Oral, SelecCve Inhibitor of Nuclear Export (SINE) Shows AnC- Prostate Cancer (PrCa) AcCvity Preclinically & Disease Control in PaCents (pts) with Chemotherapy Refractory, Castrate-

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

3/28/2017. Disclosure of Relevant Financial Relationships. GU Evening Subspecialty Case Conference. Differential Diagnosis:

3/28/2017. Disclosure of Relevant Financial Relationships. GU Evening Subspecialty Case Conference. Differential Diagnosis: GU Evening Subspecialty Case Conference Rajal B. Shah, M.D. VP, Medical Director, Urologic Pathology Miraca Life Sciences, Irving, Texas Clinical Associate Professor of Pathology Baylor College of Medicine,

More information

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TMA-VARESE COHORT-1 TMA-BERN COHORT-2 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

TITLE: Humanin: A Novel Therapeutic Target in Prostate Cancer. CONTRACTING ORGANIZATION: Regents of the University of California Los Angeles CA 90024

TITLE: Humanin: A Novel Therapeutic Target in Prostate Cancer. CONTRACTING ORGANIZATION: Regents of the University of California Los Angeles CA 90024 AD Award Number: W81XWH-06-1-0211 TITLE: Humanin: A Novel Therapeutic Target in Prostate Cancer PRINCIPAL INVESTIGATOR: Pinchas Cohen, M.D. CONTRACTING ORGANIZATION: Regents of the University of California

More information

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-14-1-0505 TITLE: Targeting the Neural Microenvironment in Prostate Cancer PRINCIPAL INVESTIGATOR: Michael Ittmann MD PhD CONTRACTING ORGANIZATION: BAYLOR COLLEGE OF MEDICINE HOUSTON,

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer

TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer AD Award Number: TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, Ph.D. CONTRACTING ORGANIZATION: The

More information

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-12-1-0337 TITLE: Molecular Innovations Toward Theranostics of Aggressive Prostate Cancer PRINCIPAL INVESTIGATOR: Hsieh, Jer-Tsong CONTRACTING ORGANIZATION: University of Texas Southwestern

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-1-1-176 TITLE: Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer PRINCIPAL INVESTIGATOR: Hsieh, Jer-Tsong CONTRACTING ORGANIZATION: University of Texas Southwestern

More information

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

Advances in Breast Cancer Research: Genetics, Biology, and Clinical Applications

Advances in Breast Cancer Research: Genetics, Biology, and Clinical Applications An AACR Special Conference on October 12-15, 2011 The Fairmont San Francisco San Francisco, CA Wednesday, October 12 7:00 p.m.-8:00 p.m. Opening Keynote Address Chairperson: Jeffrey M. Rosen, Baylor College

More information

Gleason Scoring System 2017 JASREMAN DHILLON, MD ASSOCIATE PROFESSOR, DEPARTMENT OF ANATOMIC PATHOLOGY, MOFFITT CANCER CENTER, TAMPA, FLORIDA

Gleason Scoring System 2017 JASREMAN DHILLON, MD ASSOCIATE PROFESSOR, DEPARTMENT OF ANATOMIC PATHOLOGY, MOFFITT CANCER CENTER, TAMPA, FLORIDA Gleason Scoring System 2017 JASREMAN DHILLON, MD ASSOCIATE PROFESSOR, DEPARTMENT OF ANATOMIC PATHOLOGY, MOFFITT CANCER CENTER, TAMPA, FLORIDA Learners Objectives u Latest changes per ISUP 2014 that impact

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or

More information

TITLE: The Isolation and Characterization of Human Prostate Cancer Stem Cells

TITLE: The Isolation and Characterization of Human Prostate Cancer Stem Cells AD Award Number: W81XWH-08-1-0508 TITLE: The Isolation and Characterization of Human Prostate Cancer Stem Cells PRINCIPAL INVESTIGATOR: Dr. Ganesh Palapattu, MD CONTRACTING ORGANIZATION: The Methodist

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2697 Figure S1 Cytokeratin 5 is a specific marker for basal and intermediate cells in all mouse prostate lobes. (a) Immunofluorescence staining showing co-localization of YFP with p63 in

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80% Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are

More information

Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.

Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer. Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Supplementary data and figures Thyroid hormone inhibits murine lung fibrosis through improved epithelial mitochondrial function

Supplementary data and figures Thyroid hormone inhibits murine lung fibrosis through improved epithelial mitochondrial function Supplementary data and figures Thyroid hormone inhibits murine lung fibrosis through improved epithelial mitochondrial function Guoying Yu 1*, Argyris Tzouvelekis 1,2*, Rong Wang 1,3, Jose D. Herazo-Maya

More information

Inflammation and Lung Cancer

Inflammation and Lung Cancer Inflammation and Lung Cancer Steven M. Dubinett Editor Inflammation and Lung Cancer 1 3 Editor Steven M. Dubinett David Geffen School of Medicine at UCLA Los Angeles California USA ISBN 978-1-4939-2723-4

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

TITLE: Modulation of PPAR-Gamma Signaling in Prostatic Carcinogenesis

TITLE: Modulation of PPAR-Gamma Signaling in Prostatic Carcinogenesis AD Award Number: W81XWH-07-1-0479 TITLE: Modulation of PPAR-Gamma Signaling in Prostatic Carcinogenesis PRINCIPAL INVESTIGATOR: Simon W. Hayward PhD CONTRACTING ORGANIZATION: Vanderbilt University Medical

More information

SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer

SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer Supplementary Material Supplementary Methods Supplementary References Supplementary Figure

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

A novel Monoclonal Antibody against Notch1 Targets Leukemiaassociated Mutant Notch1 and Depletes Therapy Resistant Cancer Stem Cells in Solid Tumors

A novel Monoclonal Antibody against Notch1 Targets Leukemiaassociated Mutant Notch1 and Depletes Therapy Resistant Cancer Stem Cells in Solid Tumors Supplementary Information:- A novel Monoclonal Antibody against Notch1 Targets Leukemiaassociated Mutant Notch1 and Depletes Therapy Resistant Cancer Stem Cells in Solid Tumors Ankur Sharma 1, Rupali A

More information

Supplementary Figures for

Supplementary Figures for Supplementary Figures for SOX2 suppresses CDKN1A to sustain growth of lung squamous cell carcinoma Takuya Fukazawa 1, Minzhe Guo 4, 5, Naomasa Ishida 1, Tomoki Yamatsuji 1, Munenori Takaoka 1, Etsuko Yokota

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

Supplementary Figure 1

Supplementary Figure 1 Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor

More information

PSA and the Future. Axel Heidenreich, Department of Urology

PSA and the Future. Axel Heidenreich, Department of Urology PSA and the Future Axel Heidenreich, Department of Urology PSA and Prostate Cancer EAU Guideline 2011 PSA is a continuous variable PSA value (ng/ml) risk of PCa, % 0 0.5 6.6 0.6 1 10.1 1.1 2 17.0 2.1 3

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis

Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis Cell Reports, Volume 21 Supplemental Information Differential Effects of EGFL6 on Tumor versus Wound Angiogenesis Kyunghee Noh, Lingegowda S. Mangala, Hee-Dong Han, Ningyan Zhang, Sunila Pradeep, Sherry

More information

TITLE: Unique Genomic Alterations in Prostate Cancers in African American Men

TITLE: Unique Genomic Alterations in Prostate Cancers in African American Men AD Award Number: W81XWH-12-1-0046 TITLE: Unique Genomic Alterations in Prostate Cancers in African American Men PRINCIPAL INVESTIGATOR: Michael Ittmann, M.D., Ph.D. CONTRACTING ORGANIZATION: Baylor College

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility. in mice

Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility. in mice Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility in mice Xiaopeng Hu 1 *, Zhenzhou Tang 1,2 *, Yang Li 2 *, Wensheng Liu 2, Shuang Zhang 3, Bingyan Wang 3, Yingpu Tian 2, Yinan

More information

PepT1 Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential. Expression of mirnas along the Crypt-Villus Axis

PepT1 Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential. Expression of mirnas along the Crypt-Villus Axis PepT Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential Expression of mirnas along the Crypt-Villus Axis Yuchen Zhang,*, Emilie Viennois, Mingzhen Zhang, Bo Xiao, 3, Moon Kwon

More information

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence. Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression

More information

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines In Vitro Studies of the Aurora-Kinase Inhibitor MLN837 in Prostate Cancer Cell Lines Nicole V. Julian Mentor: Ana Aparicio, M.D. Special Thanks to Brittany Kleb Department of Genitourinary Medical Oncology

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Pathology of the Prostate. PathoBasic Tatjana Vlajnic

Pathology of the Prostate. PathoBasic Tatjana Vlajnic Pathology of the Prostate PathoBasic 24.01.17 Tatjana Vlajnic Overview Adenocarcinoma of the prostate Grading Special variants Mimickers of prostate adenocarcinoma Atrophy Inflammatory conditions Granulomatous

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics

Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics Introduction: Prostate-specific antigen (PSA) is a serine protease produced in the prostate and secreted into ejaculate and blood.

More information

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the

More information

CONTRACTING ORGANIZATION: Vanderbilt University Medical Center Nashville, TN

CONTRACTING ORGANIZATION: Vanderbilt University Medical Center Nashville, TN AD Award Number: W81XWH-04-1-0867 TITLE: A Myc-Driven in Vivo Model of Human Prostate Cancer PRINCIPAL INVESTIGATOR: Simon W. Hayward, Ph.D. CONTRACTING ORGANIZATION: Vanderbilt University Medical Center

More information

Procedures Needle Biopsy Transurethral Prostatic Resection Suprapubic or Retropubic Enucleation (Subtotal Prostatectomy) Radical Prostatectomy

Procedures Needle Biopsy Transurethral Prostatic Resection Suprapubic or Retropubic Enucleation (Subtotal Prostatectomy) Radical Prostatectomy Prostate Gland Protocol applies to invasive carcinomas of the prostate gland. Protocol web posting date: July 2006 Protocol effective date: April 2007 Based on AJCC/UICC TNM, 6 th edition Procedures Needle

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines

More information

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

TITLE: A Novel Immune-Intact Mouse Model of Prostate Cancer Bone Metastasis: Mechanisms of Chemotaxis and Bone Colonization

TITLE: A Novel Immune-Intact Mouse Model of Prostate Cancer Bone Metastasis: Mechanisms of Chemotaxis and Bone Colonization AWARD NUMBER: W81XWH-16-1-0174 TITLE: A Novel Immune-Intact Mouse Model of Prostate Cancer Bone Metastasis: Mechanisms of Chemotaxis and Bone Colonization PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING

More information

TITLE: Prostate Expression Databases: Gene Expression Resources for Comparative Studies of Prostate Carcinogenesis

TITLE: Prostate Expression Databases: Gene Expression Resources for Comparative Studies of Prostate Carcinogenesis AD Award Number: W81XWH-05-1-0110 TITLE: Prostate Expression Databases: Gene Expression Resources for Comparative Studies of Prostate Carcinogenesis PRINCIPAL INVESTIGATOR: Peter S. Nelson, Ph.D. CONTRACTING

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Merritt WM, Lin YG, Han LY, et al. Dicer, Drosha, and outcomes

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Salvage prostatectomy for post-radiation adenocarcinoma with treatment effect: Pathological and oncological outcomes

Salvage prostatectomy for post-radiation adenocarcinoma with treatment effect: Pathological and oncological outcomes ORIGINAL RESEARCH Salvage prostatectomy for post-radiation adenocarcinoma with treatment effect: Pathological and oncological outcomes Michael J. Metcalfe, MD ; Patricia Troncoso, MD 2 ; Charles C. Guo,

More information

Diagnosis, pathology and prognosis including variant pathology

Diagnosis, pathology and prognosis including variant pathology PROSTATE CANCER Diagnosis, pathology and prognosis including variant pathology No Conflict of Interest Universitat Autónoma de Barcelona F.Algaba Section of Pathology PROSTATE CANCER Diagnosis, pathology

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AWARD NUMBER: W81XWH-16-1-0532 TITLE: Epigenetic Machinery Regulates Alternative Splicing of Androgen Receptor (AR) Gene in Castration-Resistant Prostate Cancer (CRPC) PRINCIPAL INVESTIGATOR: Hsieh, Jer-Tsong

More information

Prostate Overview Quiz

Prostate Overview Quiz Prostate Overview Quiz 1. The path report reads: Gleason 3 + 4 = 7. The Gleason s score is a. 3 b. 4 c. 7 d. None of the above 2. The path report reads: Moderately differentiated adenocarcinoma of the

More information

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes

More information

Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis

Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,

More information

Androgen receptor negative human prostate cancer cells induce osteogenesis in mice through FGF9-mediated mechanisms

Androgen receptor negative human prostate cancer cells induce osteogenesis in mice through FGF9-mediated mechanisms Research article Androgen receptor negative human prostate cancer cells induce osteogenesis in mice through FGF9-mediated mechanisms Zhi Gang Li, 1 Paul Mathew, 1 Jun Yang, 1 Michael W. Starbuck, 1 Amado

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary. presence of the. (c) mrna expression. Error. in naive or Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

More information

performed to help sway the clinician in what the appropriate diagnosis is, which can substantially alter the treatment of management.

performed to help sway the clinician in what the appropriate diagnosis is, which can substantially alter the treatment of management. Hello, I am Maura Polansky at the University of Texas MD Anderson Cancer Center. I am a Physician Assistant in the Department of Gastrointestinal Medical Oncology and the Program Director for Physician

More information

Cancer Prevention and Research Institute of Texas. November 2017

Cancer Prevention and Research Institute of Texas. November 2017 Cancer Prevention and Research Institute of Texas November 2017 Best In Class Significant Upside Strong Non-Dilutive Funding Focused on Epigenetics The way cancer cells regulate gene expression Lead drug,

More information

Molecular and genetic analysis of stromal fibroblasts in prostate cancer

Molecular and genetic analysis of stromal fibroblasts in prostate cancer Final report ESMO Translational Research Fellowship 2010-2011 Molecular and genetic analysis of stromal fibroblasts in prostate cancer Michalis Karamouzis Host Institute Department of Biological Chemistry,

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

STUDY OF PROSTATIC LESION FOR A PERIOD OF FIVE YEARS

STUDY OF PROSTATIC LESION FOR A PERIOD OF FIVE YEARS Page222 IJPBS Volume 4 Issue 2 APR-JUN 2014 222-226 Research Article Biological Sciences STUDY OF PROSTATIC LESION FOR A PERIOD OF FIVE YEARS B. Rajashekar Reddy 1, Rameswarapu Suman Babu 1 and Sujatha.P*

More information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer

TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer AD Award Number: W81XWH-07-1-0155 TITLE: Investigating the Role of TBX2 in the Inhibition of Senescence in Prostate Cancer PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING ORGANIZATION: Vanderbilt

More information

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation. SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic

More information

Joint Department of Biomedical Engineering

Joint Department of Biomedical Engineering Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for

More information

Medical AHIMA-CCS. Medical Coding Specialist.

Medical AHIMA-CCS. Medical Coding Specialist. Medical AHIMA-CCS Medical Coding Specialist http://killexams.com/exam-detail/ahima-ccs Question: 63 HCPCS Level II codes are updated every quarter by: A. CMS B. Medicaid C. Tricare D. Commercial payers

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

2011 International Conference of Inflammation, Cancer and Metabolic Disorders Program

2011 International Conference of Inflammation, Cancer and Metabolic Disorders Program Friday, November 4 th, 2011 09:00-09:30 Registration 09:30-09:40 Welcome & Opening Remarks Kenneth K. Wu, M.D., Ph.D. Fu-Tong Liu, M.D., Ph.D. Plenary Lecture I Chair: Kenneth K. Wu, M.D., Ph.D. 09:40-10:40

More information

PDF of Trial CTRI Website URL -

PDF of Trial CTRI Website URL - Clinical Trial Details (PDF Generation Date :- Sun, 25 Nov 2018 12:22:24 GMT) CTRI Number Last Modified On 06/07/2013 Post Graduate Thesis Type of Trial Type of Study Study Design Public Title of Study

More information

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata

More information

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy

More information