Chromatin immunoprecipitation of UTX (Lan et al. 2007), H3K27me3, and H3K4me2 (Rinn et

Size: px
Start display at page:

Download "Chromatin immunoprecipitation of UTX (Lan et al. 2007), H3K27me3, and H3K4me2 (Rinn et"

Transcription

1 Wang et al., p. 1 Supplementary Methods ChIP-chip and data analysis Chromatin immunoprecipitation of UTX (Lan et al. 27), H3K27me3, and H3K4me2 (Rinn et al. 27) were as previously described. We used affinity-purified UTX anti-serum (gift of E. Canaani) that was used successfully for UTX ChIP by multiple groups (Agger et al. 27; Issaeva et al. 27; Lan et al. 27). Genomic DNA retrieved by ChIP was hybridized to arrays tiling human promoters (Roche Nimblegen, Madison, WI) as described (Rinn et al. 27), and ChIP target genes were defined as having one or more peaks with a false discovery rate (FDR) <.2, a parameter which has been empirically shown to better match predefined positive controls (Johnson et al. 28). Systematic comparison of biological replicates of UTX ChIP-chip experiments from two different primary human fibroblast lines and independent ChIP-qPCR validations showed that the most accurate results are obtained by accepting peaks that pass the FDR filter in at least one experiment; the combined list of UTX target genes are reported thereafter. The top gene networks and pathway map were generated through the use of Ingenuity Pathways Analysis (Ingenuity Systems, Fibroblast gene expression levels were obtained by mrna hybridization to Illumina whole genome bead array per manufacturer s instruction. Enriched Gene Ontology terms were found using the software DAVID ( Array data are available at GEO ( and Stanford Microarray Database ( Human cancer data analysis Gene Module map: Gene expression compendium of 1,973 microarrays representing 22 human tumor types and diverse normal controls were as described (Segal et al. 24). Briefly, for each

2 Wang et al., p. 2 microarray, we first identified genes that were induced or repressed by at least 2-fold, and tested for their enrichment in a set of 5 genes comprised of UTX plus its genomic targets shown in Fig. 2A over that expected by chance alone (p <.5, FDR <.5, hypergeometric distribution). The end result of step one is the identification of all array that show coordinate activation or deactivation of the UTX-bound RB associated network. Second, we examined whether any clinical annotation is enriched among samples that exhibit coordinate induction or repression. Each array in the cancer compendium has been previously annotated for 283 biological or clinical attributes ( For each annotation, we compared the frequency of UTX target induction or repression among the samples versus that expected by chance alone (p <.5, FDR <.5, hypergeometric distribution). Arrays showing coordinate regulation of UTX-RB genes and their enriched clinical annotations are shown in Fig. 2C. Gene Set Enrichment Analysis: The expression level of each gene across 295 breast cancers (van de Vijver et al. 22) was compared to that of UTX and ranked based on Pearson correlation, (the gene with most similar expression to UTX being ranked number one). We tested whether genes bound by UTX protein (as measured by ChIP-chip) was more likely to show similar expression pattern with UTX itself. Specifically, the top 3% of the UTX ChIP-chip targets, sorted by ChIP/control enrichment values, was compared to the breast cancer transcriptome sorted based on similarity to UTX by GSEA (Subramanian et al. 25). Kolmogorov Smirnov scanning statistics were calculated in the observed data versus 1 permuted sets to determine the statistical significance. GSEA and gene module map provide independent and complementary methods to test the co-expression of UTX with its candidate target genes, and both methods

3 Wang et al., p. 3 Kaplan-Meier survival analysis: To determine the significance of UTX and EZH2 expression and patient outcome, the expression data of 295 breast cancer patients was mean centered, and the expression values for UTX and EZH2 were isolated. Samples with expression values below were considered to have low expression, while values above were considered to have high expression. Kaplan-Meier analysis of patient survival and metastasis-free survival were calculated with WinSTAT (R. Fitch Software). Cell culture, RNA Interference, and Plasmids Primary human fibroblasts, wild type MEFs, and TKO MEFs were cultured in 1% Fetal Bovine Serum in DMEM. TKO MEFs were as described (Sage et al. 23). Two independent sirna duplexes targeting UTX were used as previously described (Lan et al. 27). sigfp duplex has been previously described (Rinn et al. 28). sirnas targeting luciferase, RB, and HBP1 were all purchased from Thermo Scientific Dharmacon. sirnas were either transiently transfected at 5nM with Lipofectamine 2 following manufacturer s protocol (Invitrogen) or 3ug nucleofected following manufacturer s protocol specific to cell type (Lonza). For UTX overexpression, full-length UTX was cloned into MSCV-puro vector. Catalytic mutant UTX was constructed by making a single codon substitution H1126A using Quikchange II XL site directed mutagenesis kit (Stratagene). All plasmids were nucleofected at 3ug each following manufacturer s protocol specific to cell type (Lonza). UTX protein was detected by Western blotting with a rabbit polyclonal antibody (Abcam). Primer sequences for qpcr and qrt-pcr assays are listed in Supplementary Table 3. BrdU Immunofluorescence

4 Wang et al., p. 4 BrdU staining was performed as previously described (Liu et al. 27) with the following modifications: TKO MEFs were incubated with BrdU for one hour. Since wild type MEFs and TKO MEFs had nucleofection efficiencies < 9%, a YFP plasmid was co-nucleofected for these cell lines and only nucleofected YFP+ cells were scored. Serial Cell Count Cells were re-plated at 1% confluence into a 96-well plate one day after plasmid or sirna insertion. Number of viable cells was quantified every 12 hours in triplicate using MTT cell proliferation kit (Roche). C. elegans RNAi Bacterial culture for the UTX-1 RNAi feeding clone was grown for ~7 hours at 37 C in LB medium containing 1μg/ml ampicillin. The bacterium was used to inoculate six-well plates that contained NGM agar, 1 mm IPTG, and 25 μg/ml carbenicillin. About 1 synchronized L3 worms for each strain were placed in the first well, transfered every 24 hours for two days, and maintained at 2 C. The F1 progeny from the last transfer were scored for the Muv phenotype using DIC microscopy. Strains used in this study were: N2, lin-15a(n767), lin-8(n111), lin- 38(n751), lin-56(n2728), lin-35(n745), lin-53(n833), lin-15b(n744), and mys- 1(n475)/nT1[qIs51]. Strains were maintained as described in Brenner (Brenner 1974).

5 Wang et al., p. 5 References Agger, K., Cloos, P.A., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I., Canaani, E., Salcini, A.E., and Helin, K. 27. UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature 449(7163): Brenner, S The genetics of Caenorhabditis elegans. Genetics 77(1): Chang, H.Y., Sneddon, J.B., Alizadeh, A.A., Sood, R., West, R.B., Montgomery, K., Chi, J.T., van de Rijn, M., Botstein, D., and Brown, P.O. 24. Gene expression signature of fibroblast serum response predicts human cancer progression: Similarities between tumors and wounds. PLoS Biology 2(2): Issaeva, I., Zonis, Y., Rozovskaia, T., Orlovsky, K., Croce, C.M., Nakamura, T., Mazo, A., Eisenbach, L., and Canaani, E. 27. Knockdown of ALR (MLL2) reveals ALR target genes and leads to alterations in cell adhesion and growth. Mol Cell Biol 27(5): Johnson, D.S., Li, W., Gordon, D.B., Bhattacharjee, A., Curry, B., Ghosh, J., Brizuela, L., Carroll, J.S., Brown, M., Flicek, P. et al. 28. Systematic evaluation of variability in ChIP-chip experiments using predefined DNA targets. Genome Res 18(3): Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S., Alpatov, R., Issaeva, I., Canaani, E. et al. 27. A histone H3 lysine 27 demethylase regulates animal posterior development. Nature 449(7163): Liu, H., Adler, A.S., Segal, E., and Chang, H.Y. 27. A transcriptional program mediating entry into cellular quiescence. PLoS Genet 3(6): e91. Rinn, J.L., Kertesz, M., Wang, J.K., Squazzo, S.L., Xu, X., Brugmann, S.A., Goodnough, L.H., Helms, J.A., Farnham, P.J., Segal, E. et al. 27. Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell 129(7): Rinn, J.L., Wang, J.K., Allen, N., Brugmann, S.A., Mikels, A.J., Liu, H., Ridky, T.W., Stadler, H.S., Nusse, R., Helms, J.A. et al. 28. A dermal HOX transcriptional program regulates site-specific epidermal fate. Genes Dev 22(3): Sage, J., Miller, A.L., Perez-Mancera, P.A., Wysocki, J.M., and Jacks, T. 23. Acute mutation of retinoblastoma gene function is sufficient for cell cycle re-entry. Nature 424(6945): Segal, E., Friedman, N., Koller, D., and Regev, A. 24. A module map showing conditional activity of expression modules in cancer. Nat Genet 36(1): Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S. et al. 25. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 12(43): van de Vijver, M.J., He, Y.D., van't Veer, L.J., Dai, H., Hart, A.A., Voskuil, D.W., Schreiber, G.J., Peterse, J.L., Roberts, C., Marton, M.J. et al. 22. A gene-expression signature as a predictor of survival in breast cancer. N Engl J Med 347(25):

6 Wang et al., p. 6 Supplementary Table 1. Genome-wide location analysis of UTX occupancy in primary human fibroblasts. UTX bound 2459 sites on promoters, defining 1945 unique genes. Columns A-J indicate the chromosomal location, enrichment, false discovery rate, and gene name of promoter sites significantly bound by UTX. A notable subset of UTX-occupied genes is associated with an RB network (column K). Most of UTX-occupied promoters are also occupied by H3K4me2 somewhere along the same promoter (column L); a minority of these promoters exhibit occupancy of H3K27me3 (column M). Supplementary Table 2. Gene Ontology terms of UTX target genes enriched for H3K4me2, H3K27me3, both, or neither histone modifications. UTX target genes with univalent H3K4me2 identify broad functional categories, such as cellular biogenesis and cell cycle. UTX target genes are relatively depleted of co-occupancy with H3K27me3 based on chance alone (see text), and this category includes known H3K27me3 targets, such as HOX genes. In contrast, UTX targets with bivalent H3K27me3 and H3K4me2 are highly enriched for protocadherin genes, leading to striking enrichment of GO terms homophilic cell adhesion and cell-cell adhesion. UTX target genes with neither H3K27me3 or H3K4me2 are strongly enriched for olfactory receptors, leading to striking enrichment of GO terms sensor perception of smell and related terms. We note that while the HOX genes are frequently occupied by UTX in fibroblasts, approximately half of the HOX genes show univalent H3K4me2 while other show H3K27me3. Thus, HOX genes do not emerge as a strong category in this analysis. All GO term enrichments shown have Benjamini Hochberg FDR <.5. Supplementary Table 3. Primer sequences for qpcr and qrt-pcr assays.

7 Wang et al., p. 7 Supplementary Figure 1. (A) UTX occupancy and histone modifications on an olfactory receptor gene cluster across ~2 Mb of human chromosome 11. (B) UTX occupancy and histone modifications on a protocadherin gene cluster across ~7 Kb of human chromosome 5. UTX_1 and UTX_2 are two independent replicates of ChIP-chip experiments done in human fibroblasts from lung and foot, respectively, showing very similar patterns of UTX occupancy. Supplementary Figure 2. Conditional relationship between UTX and EZH2 expression and breast cancer patient outcome. Kaplan-Meier analyses of primary human breast cancer patients stratified by high or low UTX and EZH2 expression are shown. (A, C) UTX level is a significant predictor of survival in tumors with low or normal EZH2 level than in those with high EZH2 level. (B, D) Conversely, EZH2 level is a significant predictor of survival in patients with normal or high UTX levels, but not in patients with low UTX level. Patient numbers: for patients with low EZH2 expression (A) 1 have high UTX expression and 57 have low UTX expression. For patients with high UTX expression (B), 6 have high EZH2 expression and 1 have low EZH2 expression. For patients with high EZH2 expression (C), 69 have high UTX expression and 69 have low UTX expression. For patients with low UTX expression (D), 78 have high EZH2 expression and 57 have low EZH2 expression. Supplementary Figure 3. (A) Little modulation of genes in the UTX-bound RB associated network upon serum stimulation of fibroblasts. Each column is a sample after serum stimulation for the indicated times; each row is a gene. Scale for heat map is shown below. The full dataset was previously reported (Chang et al. 24). While a few genes (such as CCND3, CENPF, PCNA, shown in red) are induced by serum stimulation, most genes, including UTX-dependent

8 Wang et al., p. 8 RBBPs such as HBP1 and RBBP6, are not induced by serum. (B) Modulation of UTX occupancy of RB network genes in a cell-type specific manner. UTX binds the RB network in fibroblasts but not in mouse embryonic fibroblasts (ESCs); in contrast, UTX binds olfactory receptor genes in both cell types.

9 Wang et al., Supplementary Fig.1 A 3. UTX_1 B 3. UTX_1 ChIP/input UTX_2 H3K27me3 ChIP/input UTX_2 H3K27me H3K4me2 5.9 H3K4me2

10 Wang et al., Supplementary Fig. 2 A 1.2 Tumors with Low EZH2 B 1.2 Tumors with High UTX Probability of Survival 1 High UTX Low UTX.2 p = Survival (years) Probability of Survival 1 Low EZH High EZH2.2 p = 3x Survival (years) C 1.2 Tumors with High EZH2 D 1.2 Tumors with Low UTX Probability of Survival Low UTX.4 High UTX.2 p = Survival (years) Probability of Survival 1.8 Low EZH2.6.4 High EZH2.2 p = Survival (years)

11 Wang et al., Supplementary Fig. 3 A hr.25 hr.5 hr 1 hr 1.5 hr 2 hr 3 hr 4 hr 6 hr 8 hr 1 hr 12 hr 16 hr 2 hr 24 hr 36 hr - -ID2 -CCND3 -RBBP5 -CDC2 CENPF PCNA -RBBP6 -RBBP4 -HBP1 -JARID1B -KAT2B B Number of genes bound by UTX RB network genes Olfactory Receptors Fibroblast ESC

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES

More information

Comparison of Gene Set Analysis with Various Score Transformations to Test the Significance of Sets of Genes

Comparison of Gene Set Analysis with Various Score Transformations to Test the Significance of Sets of Genes Comparison of Gene Set Analysis with Various Score Transformations to Test the Significance of Sets of Genes Ivan Arreola and Dr. David Han Department of Management of Science and Statistics, University

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental

More information

klp-18 (RNAi) Control. supplementary information. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach

klp-18 (RNAi) Control. supplementary information. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach DOI: 10.1038/ncb1891 A. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach embryos let hatch overnight transfer to RNAi plates; incubate 5 days at 15 C RNAi food L1 worms adult worms

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

How To Use MiRSEA. Junwei Han. July 1, Overview 1. 2 Get the pathway-mirna correlation profile(pmset) and a weighting matrix 2

How To Use MiRSEA. Junwei Han. July 1, Overview 1. 2 Get the pathway-mirna correlation profile(pmset) and a weighting matrix 2 How To Use MiRSEA Junwei Han July 1, 2015 Contents 1 Overview 1 2 Get the pathway-mirna correlation profile(pmset) and a weighting matrix 2 3 Discovering the dysregulated pathways(or prior gene sets) based

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

More information

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/8/e1701143/dc1 Supplementary Materials for Impaired DNA replication derepresses chromatin and generates a transgenerationally inherited epigenetic memory Adam

More information

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science

More information

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1 Genome-wide CHIP-Seq Analysis of Histone Methylation Reveals Modulators of NF- B Signaling And the Histone Demethylase JMJD3 Implicated in Myelodysplastic Syndrome Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun

More information

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics

More information

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated

More information

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality. Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with

More information

Award Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C.

Award Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C. AD Award Number: W81XWH-08-1-0306 TITLE: Characterizing an EMT Signature in Breast Cancer PRINCIPAL INVESTIGATOR: Melanie C. Bocanegra CONTRACTING ORGANIZATION: Leland Stanford Junior University Stanford,

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn- Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Package inote. June 8, 2017

Package inote. June 8, 2017 Type Package Package inote June 8, 2017 Title Integrative Network Omnibus Total Effect Test Version 1.0 Date 2017-06-05 Author Su H. Chu Yen-Tsung Huang

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies

More information

Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and

Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and Promoter Motif Analysis Shisong Ma 1,2*, Michael Snyder 3, and Savithramma P Dinesh-Kumar 2* 1 School of Life Sciences, University

More information

Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)

Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857) 3 (0.17) 24 (17.3) Sirt1 Hmg20 Gm4763 877 (857) c d Suppl. Figure 1. Screen validation for top candidate antagonists of Dot1L (a) Numer of genes with one (gray), two (cyan) or three (red) shrna scored

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

RNA preparation from extracted paraffin cores:

RNA preparation from extracted paraffin cores: Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity. Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

SUPPLEMENTARY APPENDIX

SUPPLEMENTARY APPENDIX SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature

More information

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Repressive Transcription

Repressive Transcription Repressive Transcription The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As Published Publisher Guenther, M. G., and R. A.

More information

H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells

H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells Nucleic Acids Research, 2017 1 doi: 10.1093/nar/gkx251 H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells Runsheng He 1,2 and

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest

More information

Whole liver transcriptome analysis for the metabolic adaptation of dairy cows

Whole liver transcriptome analysis for the metabolic adaptation of dairy cows Whole liver transcriptome analysis for the metabolic adaptation of dairy cows Ngoc-Thuy Ha Animal Breeding and Genetics Group Department of Animal Sciences Georg-August-University Goettingen, Germany 1

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

FUNCTIONAL GENE SETS IN POST-TRAUMATIC STRESS DISORDER

FUNCTIONAL GENE SETS IN POST-TRAUMATIC STRESS DISORDER PROCEEDINGS OF THE YEREVAN STATE UNIVERSITY C h e m i s t r y a n d B i o l o g y 2016, 1, p. 43 48 B i o l o g y FUNCTIONAL GENE SETS IN POST-TRAUMATIC STRESS DISORDER A. A. ARAKELYAN Institute of Molecular

More information

DeSigN: connecting gene expression with therapeutics for drug repurposing and development. Bernard lee GIW 2016, Shanghai 8 October 2016

DeSigN: connecting gene expression with therapeutics for drug repurposing and development. Bernard lee GIW 2016, Shanghai 8 October 2016 DeSigN: connecting gene expression with therapeutics for drug repurposing and development Bernard lee GIW 2016, Shanghai 8 October 2016 1 Motivation Average cost: USD 1.8 to 2.6 billion ~2% Attrition rate

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

A Transcriptional Program Mediating Entry into Cellular Quiescence

A Transcriptional Program Mediating Entry into Cellular Quiescence A Transcriptional Program Mediating Entry into Cellular Quiescence Helen Liu 1, Adam S. Adler 1, Eran Segal 2, Howard Y. Chang 1* 1 Program in Epithelial Biology, Stanford University School of Medicine,

More information

gliomas. Fetal brain expected who each low-

gliomas. Fetal brain expected who each low- Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include

More information

Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach)

Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach) High-Throughput Sequencing Course Gene-Set Analysis Biostatistics and Bioinformatics Summer 28 Section Introduction What is Gene Set Analysis? Many names for gene set analysis: Pathway analysis Gene set

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer

Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer European Review for Medical and Pharmacological Sciences 2016; 20: 3373-3377 Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer Z.-J. CHEN, Z. ZHANG, B.-B. XIE, H.-Y. ZHANG

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supplementary Information. Preferential associations between co-regulated genes reveal a. transcriptional interactome in erythroid cells

Supplementary Information. Preferential associations between co-regulated genes reveal a. transcriptional interactome in erythroid cells Supplementary Information Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells Stefan Schoenfelder, * Tom Sexton, * Lyubomira Chakalova, * Nathan

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript. Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Figure S1, Beyer et al.

Figure S1, Beyer et al. Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

PRC2 crystal clear. Matthieu Schapira

PRC2 crystal clear. Matthieu Schapira PRC2 crystal clear Matthieu Schapira Epigenetic mechanisms control the combination of genes that are switched on and off in any given cell. In turn, this combination, called the transcriptional program,

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure

More information

Inferring Biological Meaning from Cap Analysis Gene Expression Data

Inferring Biological Meaning from Cap Analysis Gene Expression Data Inferring Biological Meaning from Cap Analysis Gene Expression Data HRYSOULA PAPADAKIS 1. Introduction This project is inspired by the recent development of the Cap analysis gene expression (CAGE) method,

More information

BIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points)

BIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) Name: BIO360 Quiz #1 September 14, 2012 1. Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) 2. The controversial hypothesis that only a small subset

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs). MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

More information

Integrative analysis of survival-associated gene sets in breast cancer

Integrative analysis of survival-associated gene sets in breast cancer Varn et al. BMC Medical Genomics (2015) 8:11 DOI 10.1186/s12920-015-0086-0 RESEARCH ARTICLE Open Access Integrative analysis of survival-associated gene sets in breast cancer Frederick S Varn 1, Matthew

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

Histones modifications and variants

Histones modifications and variants Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome

More information

Package GANPAdata. February 19, 2015

Package GANPAdata. February 19, 2015 Type Package Title The GANPA Datasets Package Version 1.0 Date 2011-05-26 Package GANPAdata February 19, 2015 Author Zhaoyuan Fang, Weidong Tian and Hongbin Ji Maintainer Zhaoyuan Fang

More information

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark

More information