British Journal of Nutrition
|
|
- Miranda Shepherd
- 5 years ago
- Views:
Transcription
1 (2013), 110, q The Authors 2013 doi: /s Dietry fire ffects intestinl mucosl rrier function nd regultes intestinl cteri in wening piglets Hong Chen 1,2, Xinging Mo 1,2, Jun He 1,2, Bing Yu 1,2, Zhiqing Hung 1,2, Jie Yu 1,2, Ping Zheng 1,2 nd Diwen Chen 1,2 * 1 Institute of Animl Nutrition, Sichun Agriculture University, No. 46, Xinkng Rod, Yucheng District, Yn, Sichun , People s Repulic of Chin 2 Key Lortory of Animl Disese-Resistnce Nutrition, Ministry of Eduction, Y n, People s Repulic of Chin (Sumitted 20 Septemer 2012 Finl revision received 19 Mrch 2013 Accepted 23 Mrch 2013 First pulished online 9 My 2013) Astrct The ojective of the present study ws to evlute the effects of fire source on intestinl mucosl rrier function in wening piglets. A totl of 125 piglets were rndomly llotted on the sis of their ody weight nd litters to one of five experimentl diets, i.e. control diet without fire source (CT), nd diets in which expnded mize ws replced y 10 % mize fire (MF), 10 % soyen fire (SF), 10 % whet rn fire (WBF) or 10 % pe fire (PF). The diets nd wter were fed d liitum for 30 d. Piglets on the WBF nd PF diets hd lower dirrhoe incidence compred with the MF- nd SF-fed nimls. A higher rtio of villous height:crypt depth in the ileum of WBF-fed piglets nd higher colonic golet cells in WBF- nd PF-fed piglets were oserved compred with CT-, MF- nd SF-fed piglets. In the intestinl digest, feeding WBF nd PF resulted in incresed Lctocillus counts in the ileum nd Bifidocterium counts in the colon. Lower Escherichi coli counts occurred in the ileum nd colon of WBF-fed piglets thn in SF-fed piglets. Tight junction protein (zonul occludens 1; ZO-1) nd Toll-like receptor 2 (TLR2) gene mrna levels were up-regulted in the ileum nd colon of pigs fed WBF; however, feeding MF nd SF rised IL-1 nd TNF- mrna levels. Furthermore, higher dimine oxidse ctivities, trnsforming growth fctor-, trefoil fctor fmily nd MHC-II concentrtion occurred when feeding WBF nd PF. In conclusion, the vrious fire sources hd different effects on the ilel nd colonic rrier function. Clerly, WBF nd PF improved the intestinl rrier function, proly medited y chnges in microiot composition nd concomitnt chnges in TLR2 gene expression. Key words: Dietry fires: Intestinl cteri: Intestinl rrier function: Toll-like receptor 2 The intestinl epithelium is single lyer of columnr epithelil cells tht hs two criticl functions: cting s rrier to hrmful sustnces nd s selective filter to essentil nutrients (1,2). It cn synthesise nd secrete mny mucosl rrier fctors, such s dimine oxidse (DAO), trefoil fctor fmily (TFF) nd trnsforming growth fctor- (TGF-), which re considered s centrl fctors to mintin nd restore intestinl mucosl integrity (3 5). Intestinl tight junctions re the piclmost dhesive junctionl complexes defining prcellulr permeility of the intct intestinl epithelium, which consist of integrl trnsmemrne proteins (occludin nd cludin) (6). Chnges in the intestinl rrier cn ffect the invsion of hrmful sustnces nd the sorption of nutrients. Intestinl rrier dysfunction is thought to result in mny intestinl diseses, including dirrhoe, inflmmtory owel disese, ischemic disese, food llergy nd Crohn s disese (7,8). Specific dietry nutrients hve een shown to ffect intestinl functioning, one of which is dietry fire. Recent studies hve shown tht dietry fire is eneficil nutrient for preventing intestinl disese (dirrhoe, constiption nd the irritle owel syndrome) nd improving intestinl helth in humn sujects nd nimls (9). However, due to resistnce to digestion nd sorption in the foregut, the effect of dietry fire on intestinl helth hs een primrily ttriuted to mutul effect on intestinl cteri (10), especilly in the hindgut. Previous studies hve indicted tht dietry fires could selectively regulte intestinl cteri, including the stimultion of eneficil cteril species nd the suppression of pthogenic cteril species (11,12). Commensl cteri hve een shown to chnge intestinl rrier integrity. In vitro, occludin nd cingulin gene mrna levels of Cco-2 cells were up-regulted y Lctocillus (13). Arevitions: ADF, cid-detergent fire; DAO, dimine oxidse; Bx, Bcl-2-ssocited X protein; MF, mize fire; NDF, neutrl-detergent fire; PF, pe fire; SF, soyen fire; TFF, trefoil fctor fmily; TGF-, trnsforming growth fctor-; TLR2, Toll-like receptor 2; VFA, voltile ftty cid; WBF, whet rn fire; ZO-1, zonul occludens 1. * Corresponding uthor: D. Chen, fx þ , emil dwchen@sicu.edu.cn
2 1838 H. Chen et l. Escherichi coli could result in tight junction disruption through the destilistion nd dissocition of tight junction proteins from the epithelil cells (14,15). These results suggest tht cteri could ffect intestinl rrier integrity y regulting the gene expression level of tight junction proteins. Menwhile, dietry fires (whet rn, pe fire, cellulose nd mixed fire) hve een shown to increse the excretion of intestinl mucin y stimulting the cpcity of mucosl protein synthesis in mny species including humn sujects (16,17). However, few studies hve shown the effect of dietry fire on intestinl mucosl rrier fctors (DAO, TFF nd TGF-). Therefore, it is prole tht dietry fire improves gut mucosl rrier function, such s intestinl mucosl tight junctions nd mucosl rrier fctors, through supporting etter intestinl microiot. Becuse piglets often suffer mjor stress t wening, ccompnied y intestinl mucosl dmge nd dirrhoe in conventionl pig production, we chose wened piglets s the experimentl niml. Generlly, mize fire (MF), whet rn fire (WBF), soyen fire (SF) nd pe fire (PF) re incresingly incorported in humn food nd niml diets s dietry fire sources. Previous studies hve shown tht these fire sources possess different physico-chemicl properties (soluility, fermentility) nd components, which results in discordnt intestinl helth (18,19). In order to further determine the mechnism y which dietry fire ffects intestinl helth, we hypothesise tht dietry fire could chnge intestinl helth y the regultion of intestinl mucosl tight junctions nd rrier fctors. Therefore, in the present study, complex fire sources purified from cerels (mize nd whet) nd legumes (soyen nd pe) were selected nd dded to wening piglet diets. The study imed to ssess whether supplementtion with dietry fires ffects intestinl mucosl tight junctions nd rrier fctors, nd regultes intestinl cteril popultions. Mterils nd methods The experimentl protocols used in the present study were pproved y the Sichun Agriculturl University Institutionl Animl Cre nd Use Committee. Preprtion of dietry fires MF, SF, WBF nd PF were purified from mize, soyen, whet nd pe, respectively, y Chinese Food Compnies. MF ws provided y Ci Yun Biotech Compny Limited, SF ws from Winwy Biotech Compny Limited, WBF ws from Shngyido Science nd Technology Compny Limited nd PF ws from Jinyun Food Compny Limited. Crude protein, crude fire, neutrl-detergent fire (NDF) nd cid-detergent fire (ADF), cellulose nd hemicellulose contents of the fire sources re summrised in Tle 1. The contents of crude fire, NDF nd ADF were ssyed in our lortory y using the method of Vn Soest (20). To void protein contmintion, sodium sulphite ws dded to NDF solution. Hemicellulose nd cellulose were clculted s follows: Hemicellulose ¼ NDF 2 ADF; Cellulose ¼ ADF 2 ðsh þ ligninþ: Experimentl design nd niml mngement The experiment followed rndomised lock design. A totl of 125 cross-red (Duroc Lndrce Yorkshire) piglets (wened t 28 (SEM 2) d) were locked nd ssigned to one of five experimentl diets sed on their ody weight nd litters. Ech tretment ws replicted with five pens of five pigs per replicte pen. The five tretments included control group nd four dietry fire groups. The temperture ws mintined t 268C for the first 3 d fter wening nd then reduced y 28C/week for the reminder of the experiment. Piglets consumed the diets nd wter d liitum for 30 d. All pigs were checked dily for generl helth nd dirrhoe during the experimentl period. Pigs showing loose feces/ dirrhoe were recorded. The incidence of dirrhoe ws clculted s follows: Dirrhoe incidence ð%þ ¼ðtotl numer of pigs per pen with dirrhoeþ=ðnumer of pigs per pen 30 dþ 100: Piglets were fed mize soyen mel diets (Tle 2) formulted to meet the nutrient recommendtions of the Ntionl Reserch Council (1998). The five experimentl diets included control diet without supplementl fire source nd four diets in which expnded mize ws replced y 10 % MF, 10 % SF, 10 % WBF or 10 % PF. To ensure similr energy levels in ll the diets, expnded mize ws reduced nd 2 % ft powder ws dded in the fire source diets. Tle 1. Crude protein (CP), crude fire (CF), neutrl-detergent fire (NDF), cid-detergent fire (ADF), cellulose nd hemicellulose contents of the fire sources Items Mize fire Soyen fire Whet rn fire Pe fire CP (%) CF (%) NDF (%) ADF (%) Cellulose (%) Hemicellulose (%) Lignin (%)
3 Fire ffects intestinl rrier function 1839 Tle 2. Composition of the experimentl diets (s-fed sis) Fire sources Items Con MF SF WBF PF Ingredients (%) Expnded mize Dehulled soyen mel, 47 9 % Mize strch Fishmel, 62 5 %* Soy protein concentrte, 65 % Whey powder Sucrose Glucose Ft powder MF SF WBF PF Slt L-Lys.HCl, 75 % DL-Met L-Thr L-Trp Limestone Monoclcium phosphte Choline chloride, 50 % Vitmin premix Trce minerl premixk Totl Anlysed chemicl composition DM (%) Gross energy (MJ/kg) CP (%) Lys (%){ C (%) Aville P (%){ P (%) Crude fire (%) NDF (%) ADF (%) Con, control; MF, mize fire; SF, soyen fire; WBF, whet rn fire; PF, pe fire; CP, crude protein; NDF, neutrl-detergent fire; ADF, cid-detergent fire. * Imported Peruvin red fishmel. Produced y WILMAR & ADM J.V. Mde of plm oils, produced y Shndong Tinjio Biotech Compny Limited. Provided the following per kg diet: 4 05 mg vitmin A; mg vitmin D 3 ; 24 mg vitmin E; 3 mg vitmin K 3 ; 3 mg vitmin B 1 ; 6 mg vitmin B 2 ; 3 mg vitmin B 6 ;24mg vitmin B 12 ; 15 mg pntothenic cid; 1 2 mg folic cid; 150 mg iotin; 1 g choline. k Provided the following per kg diet: 110 mg Fe (s FeSO 4.7H 2 O); 10 mg Cu (s CuSO 4.5H 2 O); 110 mg Zn (s ZnSO 4.7H 2 O); 6 mg Mn (s MnSO 4.H 2 O); 0 3 mg I (s KI); 0 3 mg Se (s N 2 SeO 3 ). { Clculted vlue. Smple collection After 30 d, five pigs per diet were nesthetised y lethl injection of sodium pentoritl (200 mg/kg ody weight), nd the domen ws immeditely opened to remove the ileum nd the colon, emptied nd smpled. The middle section (2 cm) of the ileum nd colon ws collected nd fixed in 10 % formldehyde-phosphte uffer for intestinl histology nlysis. Intestinl segments of the ileum nd colon were collected nd immeditely frozen t 2808C for quntittive rel-time PCR. Mucosl scrpings from the ileum nd colon were prepred nd stored t 2808C until ELISA nlysis. Approximtely 3 g of the digest from the middle section of the ileum nd colon were kept in sterile tues nd immeditely frozen t 2808C until nlysis for microil DNA nd voltile ftty cid (VFA) concentrtions. Histologicl mesurements Mesurements of villous height nd crypt depth were conducted s descried y Shen et l. (21). Fixed intestinl segments were pcked with prffin wx. Consecutive sections t 5 mm thickness were stined with hemtoxylin eosin for histomorphologicl exmintion. Intestinl mucosl morphology including villous height nd crypt depth ws mesured t 40 mgnifiction with n Olympus CK 40 microscope (Olympus Opticl Compny). Positively stined golet cells were counted in ten rndomly selected mucous lyers using Imge-Pro Plus softwre, version 6.0 (Medi Cyernetics).
4 1840 H. Chen et l. Voltile ftty cid nlysis VFA concentrtions in the intestinl digest were determined using gs chromtogrphic method descried y Frnklin et l. (22). Digest smples (1 g) were thwed nd suspended in 2 ml of distilled wter in screw-cpped tue. After eing vortexed, the smple ws centrifuged ( g) t 48C for 10 min. The superntnt (1 ml) ws trnsferred into centrifuge tues (2 ml) nd mixed with 0 2 ml metphosphoric cid. After 30 min t 48C, the tues were centrifuged ( g) gin t 48C for 10 min. Aliquots of the superntnt (1 ml) were nlysed using Vrin CP-3800 gs chromtogrph (Agilent Technologies). A flme ionistion detector ws used with n oven temperture of C. The polyethylene glycol column ws operted with highly purified N 2, s the crrier gs, t 1 8 ml/min. The lower detectle limit for ll VFA ws 0 1 mmol/l. ELISA nlysis of dimine oxidse ctivities, trnsforming growth fctor-, trefoil fctor fmily, MHC-II nd secretory IgA concentrtion Approximtely 1 g of mucosl scrpings ws homogenised y hnd fter eing suspended in 9 ml PBS. After centrifugtion t 700 g for 10 min, the superntnt ws removed nd centrifuged t g for 15 min. Then, the superntnt ws tken for the mesurement of intestinl fctors y n ntiswine ELSIA kit (BlueGene Biotech). The totl protein content of the intestinl smples ws mesured y the Brdford rillint lue method simultneously. The concentrtion of intestinl fctors ws expressed s mg/mg or g protein (12). DNA isoltion, design nd vlidtion of primers for Lctocillus, Escherichi coli nd Bifidocterium Bcteril DNA ws extrcted from the intestinl digest using the Stool DNA Kit (Omeg Bio-tek) ccording to the mnufcturer s instructions. For quntittive detection of Lctocillus, E. coli nd Bifidocterium, primers nd fluorescent oligonucleotide proes (Tle 3) were designed following 16S rrna sequences of mximum species of ech genus encountered in the pig intestinl trct downloded from the GenBnk dtse, EMBL nd DDBJ. To void ny non-specific mplifiction, the sequences of ll the gener fetched from the dtse were sumitted to DNAStr (MegAlign) progrm (DNASTAR, Inc.), s descried y Hn et l. (23). It ws reveled tht the Lctocillus, E. coli nd Bifidocterium locks of hypervrile regions comprised ll other gener. These sequences were sumitted to second round of lignment where the mximum numer of species elonging to one genus ws ligned nd the conservtive regions were selected s genus-specific primers nd proes of Lctocillus, E. coli nd Bifidocterium. Furthermore, to ensure tht the oligonucleotide sequences were complementry piring with the trget genus only, they were checked with the GenBnk progrm BLAST (NCBI BLAST, lst. nci.nlm.nih.gov/blst.cgi) nd the Riosoml Dtse Project (RDP) progrm Check-Proe (detils on RDP dt nd nlyticl functions cn e found t Primers (Tle 3) for totl cteri were otined from Lee et l. (24). All the primers nd proes (25,26) were commercilly synthesised y Life Technologies Limited. Microil quntittive PCR conditions Quntittive rel-time PCR ws performed y conventionl PCR on the Opticon DNA Engine (Bio-Rd). Ech rection ws run in volume of 25 ml with 1 ml of forwrd nd 1 ml of reverse primers (100 nm), 12 5 ml SYBR Premix Ex Tq (2 concentrted), 1 ml templte DNA nd 9 5 ml of douledistilled wter for detecting totl cteri. The PCR conditions were s follows: one cycle of pre-denturtion t 958C for 30 s; forty cycles of denturtion t 958C for 5 s; nneling t 608C for 30 s nd extension t 728C for 60 s. The PrimerScriptTM PCR kit (Perfect Rel Time; Tkr) ws used for Lctocillus, E. coli nd Bifidocterium. The rection protocol ws composed of one cycle of pre-denturtion t 958C for 2 min; fifty cycles of denturtion t 958C for 15 s; nneling t 608C for 30 s nd extension t 728C for 50 s. Ech rection Tle 3. Sequences of primers nd proes for intestinl cteri Primer Nucleotide sequence ( ) Anneling temperture (8C) Product size (p) Reference Totl cteri Forwrd ACTCCTACGGGAGGCAGCAG Hn et l. (23) Reverse ATTACCGCGGCTGCTGG Lctocillus Forwrd GAGGCAGCAGTAGGGAATCTTC Reverse CAACAGTTACTCTGACACCCGTTCTTC Qi et l. (25) Proe AAGAAGGGTTTCGGCTCGTAAAACTCTGTT Escherichi coli Forwrd CATGCCGCGTGTATGAAGAA Reverse CGGGTAACGTCAATGAGCAAA Qi et l. (25) Proe AGGTATTAACTTTACTCCCTTCCTC Bifidocterium Forwrd CGCGTCCGGTGTGAAAG Reverse CTTCCCGATATCTACACATTCCA Xing et l. (26) Proe ATTCCACCGTTACACCGGGAA
5 Fire ffects intestinl rrier function 1841 ws run in volume of 20 ml with 8 ml RelMsterMix (2 5 ), 1 ml of forwrd nd 1 ml of reverse primers (100 nm), 1 ml proe enhncer solution (20 ), 0 3 ml proe (100 nm), 1 ml DNA nd 7 7 ml of doule-distilled wter in ech rection for detecting Lctocillus, E. coli nd Bifidocterium. Stndrd curve For the quntifiction of cteri in the test smples, specific stndrd curves were generted y constructing stndrd plsmids, s presented y Hn et l. (23). The stndrd strins of Lctocillus, E. coli nd Bifidocterium were cultured neroiclly or eroiclly in the respective culture, including 1 % glucose t 378C from 12 to 48 h. The specific PCR product of ll cteri ws purified using the QIAQuick Gel Extrction Kit (Qigen), nd cloned into pgem-t Esy Vector (Promeg). After verifiction of the sequence, the recominnt plsmid ws isolted using the Endo-Free Plsmid Kit I (OMGA), nd stndrd plsmids for ll cteri were constructed successfully. DNA concentrtion of the stndrd plsmids ws mesured using spectrophotometer (Coulter DU 800; Beckmn). The copies were clculted y the following formul: ( copies/mol DNA concentrtion (mg/ml))/( DNA size (p)). A 10-fold seril dilution series of plsmid DNA ws used to construct the stndrd curves for totl cteri, Lctocillus, E. coli nd Bifidocterium. Ech stndrd curve ws constructed y liner regression of the plotted points, nd cycle threshold (CT) vlues were plotted ginst the logrithm of templte copy numers. Tle 4. Sequences of primers for the intestine-relted genes Rel-time PCR for quntifiction of cludin 1, occludin, zonul occludens 1, TNF-, IL-1, B-cell lymphom/ leukemi-2-ssocited X protein, B-cell lymphom/ leukemi-2 nd Toll-like receptor 2 Frozen intestinl tissue (0 1 g) ws homogenised in 1 ml TRIzol regent (Invitrogen) nd totl RNA ws extrcted following the mnufcturer s instructions. The concentrtion nd purity of RNA were nlysed spectrophotometriclly (Beckmn Coulter DU800; Beckmn Coulter Inc.), nd the OD 260 :OD 280 rtio (where OD is the opticl density) rnged from 1 8 to 2 0 for ll smples. The integrity of RNA ws mesured y formldehyde gel electrophoresis nd the 28S:18S riosoml RNA nd rtio ws determined s $1 8. The RNA smples were reverse trnscried into complementry DNA using the PrimeScripte RT regent kit (Tkr) ccording to the mnufcturer s instructions. The primers were synthesised commercilly y Life Technologies Limited, which re listed in Tle 4. Rel-time PCR for quntifiction of cludin 1, occludin (OCLN), zonul occludens 1 (ZO-1), TNF-, IL-1, B-cell lymphom/leukemi-2 (Bcl-2)-ssocited X protein, Bcl-2 nd Toll-like receptor 2 (TLR2) were crried out on the Opticon DNA Engine (Bio-Rd) using SYBR Green PCR regents (Tkr). -Actin ws chosen s the reference gene trnscript, nd the reltive expression rtio of the trget gene in comprison with the reference gene ws clculted s descried previously (27). Ech stndrd nd smple ws run simultneously in duplicte on the sme PCR plte, nd the verge of ech duplicte vlue expressed s the numer of copies ws used for sttisticl nlysis. Primer Nucleotide sequence ( ) Anneling temperture (8C) Product size (p) Reference -Actin Forwrd TCTGGCACCACACCTTCT Hn et l. (23) Reverse TGATCTGGGTCATCTTCTCAC CLDN1 Forwrd GCCACAGCAAGGTATGGTAAC Present study Reverse AGTAGGGCACCTCCCAGAAG OCLN Forwrd CTACTCGTCCAACGGGAAAG Present study Reverse ACGCCTCCAAGTTACCACTG ZO-1 Forwrd TGGCATTATTCGCCTTCATAC Present study Reverse AGCCTCATTCGCATTGTTT TNF- Forwrd ACCTCCTCTCTGCCATCAAG Present study Reverse CTGCCCAGATTCAGCAAAGT IL-1 Forwrd GCATGTGCTGAGCCTTTGTA Present study Reverse CCTGGTCCTCCCAAGATTGT Bx Forwrd AAGCGCATTGGAGATGAACT Present study Reverse TGCCGTCAGCAAACATTTC Bcl2 Forwrd TGCCTTTGTGGAGCTGTATG Present study Reverse GCCCGTGGACTTCACTTATG TLR2 Forwrd AGTTGAAGACGCTCCCAGATG Present study Reverse GAAGGACAGGAAGTCACAGGA CLDN1, cludin 1; OCLN, occludin; ZO-1, zonul occludens 1; Bx, B-cell lymphom/leukemi-2-ssocited X protein; Bcl2, B-cell lymphom/- leukemi-2; TLR2, Toll-like receptor 2.
6 1842 H. Chen et l. Tle 5. Effects of the dietry fire sources on the intestinl morphology of wening piglets (Men vlues with their pooled stndrd errors) Items Con MF SF WBF PF Pooled SEM P Ileum Villous height (mm) Crypt depth (mm) Villous height:crypt depth Golet cells (n/60 mm 2 ) Colon Crypt depth (mm) Golet cells (n/60 mm 2 ) ,0 001 Con, control; MF, mize fire; SF, soyen fire; WBF, whet rn fire; PF, pe fire. Men vlues with unlike superscript letters were significntly different (P,0 05). Sttisticl nlysis The pen ws considered s the experimentl unit for ll nlyses. Bcteril copies were trnsformed (log 10 ) efore sttisticl nlysis. Litters nd ody weight of piglets were used s locking fctors, nd five locks were included. All dt were sujected to one-wy ANOVA for rndomised lock design using the GLM procedure of SAS 9.0 (SAS Institute Inc.). Sttisticl differences mong the tretments were seprted y Tukey s multiple-rnge tests. For significnce determintion, the -level ws set s All dt re presented s mens with their pooled stndrd errors. Results Effects of fire sources on dirrhoe incidence There ws no difference in dirrhoe incidence etween the pigs fed the control diet (10 00 %) nd the fire source diets. However, lower dirrhoe incidence ws oserved in pigs fed the WBF (8 56 %) nd PF diets (8 72 %) compred with those fed the MF (11 47 %) nd SF diets (12 40 %). Effects of the fire sources on intestinl mucosl morphology The results of intestinl mucosl morphology nlysis re presented in Tle 5. In the ileum, pigs on the WBF diet hd higher villous height thn those fed the SF diet (P¼0 031). The ilel villous height:crypt depth rtio ws higher in WBF diet-fed pigs thn in those supplemented with the MF (P¼0 018) nd SF diets (P¼0 023). In pigs fed the WBF nd PF diets, the numer of mucosl golet cells incresed in the colon compred with pigs fed the control (P,0 001 nd, 0 001, respectively), MF (P¼0 001 nd 0 008, respectively) nd SF diets (P, nd P¼0 005, respectively). However, difference in ilel golet cells ws only oserved in pigs fed the WBF diet when compred with those on the control (P¼0 023), MF (P¼0 025) nd SF diets (P¼0 032). Effects of the fire sources on voltile ftty cid concentrtions VFA concentrtions in the intestinl digest re presented in Tle 6. In the colon, there ws no difference in VFA concentrtions etween the pigs fed the control diet nd the fire source diets; however, pigs on the MF diet hd the lowest VFA concentrtion when compred with those fed the other diets. Higher cette, propionte, utyrte nd totl VFA concentrtions were oserved in pigs on the SF diet when compred with those fed the MF diet (P¼0 026, 0 005, nd 0 010, respectively). The concentrtion of utyrte ws higher in pigs fed the WBF diet thn in those on the MF diet (P¼0 036). Menwhile, n increse in cette (P¼0 035) Tle 6. Effects of the dietry fires on the voltile ftty cid (VFA) concentrtions of wening piglets (Men vlues with their pooled stndrd errors) Items Con MF SF WBF PF Pooled SEM P Ileum (mmol/g) Acette Propionte Butyrte Totl VFA Colon (mmol/g) Acette Propionte Butyrte Totl VFA Con, control; MF, mize fire; SF, soyen fire; WBF, whet rn fire; PF, pe fire. Men vlues with unlike superscript letters were significntly different (P,0 05).
7 Fire ffects intestinl rrier function 1843 Tle 7. Effects of the dietry fires on the intestinl fctors of wening piglets (Men vlues with their pooled stndrd errors) Items Con MF SF WBF PF Pooled SEM P Ileum DAO (ku/g) TGF- (mg/g) TFF (ng/g) MHC-II (ng/g) SIgA (mg/g) Colon TGF- (mg/g) TFF (ng/g) ,0 001 MHC-II (ng/g) SIgA (mg/g) Con, control; MF, mize fire; SF, soyen fire; WBF, whet rn fire; PF, pe fire; DAO, dimine oxidse; TGF-, trnsforming growth fctor-; TFF, trefoil fctor fmily; SIgA, secretory IgA. Men vlues with unlike superscript letters were significntly different (P,0 05). nd totl VFA (P¼0 035) concentrtions ws oserved in PF diet-fed pigs compred with those on the MF diet. Effects of the fire sources on intestinl mucosl dimine oxidse ctivities, trnsforming growth fctor-, trefoil fctor fmily nd MHC-II concentrtion Concentrtions of the intestinl fctors re presented in Tle 7. In the ileum, DAO ctivity ws higher (P¼0 022) in pigs fed the WBF diet thn in those on the control diet. In the colon, pigs on the PF diet hd higher TFF (P¼0 003), TGF- (P¼0 041) nd MHC-II (P¼0 020) concentrtions thn those on the control diet. Menwhile, pigs supplemented with the WBF nd PF diets hd higher TFF concentrtions thn those on the MF (P, nd P¼0 006, respectively) nd SF diets (P, nd P¼0 004, respectively). MHC-II concentrtions were higher in pigs fed the PF diet thn in those on the SF diet (P¼0 013). However, there ws no effect on SIgA concentrtions etween the diets in the ileum nd colon. Effects of the fire sources on intestinl cteri Bcteril popultions in the intestinl digest were ffected y the dietry fires (Fig. 1). There ws no effect of the diets on totl cteril popultions in pigs. In the ileum, Lctocillus popultions were higher in pigs fed the PF diet thn in those on the control (P¼0 012) nd SF diets (P¼0 037). In the colon, n increse in Bifidocterium popultions ws found in pigs fed the WBF diet compred with those on the control (P¼0 035) nd SF diets (P¼0 040). Higher colonic Bifidocterium popultions were oserved in pigs fed the PF diet compred with those on the control diet (P¼0 047). A difference in E. coli popultions ws oserved in the ileum nd colon. Pigs supplemented with the WBF diet hd lower (P¼0 021) ilel E. coli popultions thn those on the SF diet. In ddition, colonic E. coli popultions decresed in pigs fed the WBF diet compred with those on the control (P¼0 010), MF (P¼0 024) nd SF diets (P¼0 016). Effects of the fire sources on intestinl gene expression The effects of the dietry fires on intestinl gene expression re presented in Fig. 2. In the ileum nd colon, n increse in OCLN nd TLR2 mrna levels ws oserved in pigs fed the WBF diet compred with those on the control diet (P¼0 049 nd 0 037, respectively). Pigs supplemented with the WBF diet hd higher ilel ZO-1 mrna levels thn those on the control diet (P¼0 045). Menwhile, the WBF diet incresed colonic OCLN mrna levels compred with the MF diet (P¼0 004). Pigs fed the WBF diet showed higher colonic TLR2 mrna levels when compred with those on the MF (P¼0 020) nd SF diets (P¼0 039). However, pigs supplemented with the MF nd SF diets hd higher IL-1 mrna levels in the colon compred with those on the control (P¼0 005 nd 0 004, respectively), WBF (P, nd, 0 001, respectively) nd PF diets (P¼0 007 nd 0 006, respectively), nd hd higher IL-1 mrna levels in the ileum compred with those on the control diet (P¼0 014 nd 0 011, respectively). Menwhile, higher ilel TNF- mrna levels were lso oserved in pigs fed the MF nd SF diets compred with those on the control (P¼0 014 nd 0 019, respectively) nd PF diets (P¼0 027 nd 0 036, respectively). However, no differences in Bcl-2- ssocited X protein nd Bcl2 mrna levels were oserved in pigs fed ll the diets. Discussion Dietry fire hs een reported to decrese dirrhoe incidence in pigs nd improve gut helth (28,29). According to Molist et l. (29), whet rn hs een shown to decrese the numer of pthogenic E. coli in the feces nd reduce the incidence of post-wening dirrhoe. Pe fire (pe hulls nd pe inner fire) hs lso een shown to improve intestinl helth in nimls y reducing the dhesion nd incresing the excretion of enterotoxigenic E. coli (30). However, in the present study, no effect on dirrhoe incidence ws oserved etween the pigs fed the control diet nd the fire source diets. A difference in dirrhoe incidence ws oserved mong the fire diets. The result indictes tht the effects of dietry fires on intestinl helth re relted to fire sources,
8 1844 H. Chen et l. (A) Ilel digest (copies/g) Totl cteri Lctocillus Escherichi coli Bifidocterium (B) 13 Colonic digest (copies/g) mye resulting from inconsistent intestinl function in regulting intestinl cteri (such s E. coli). Previous studies hve shown tht lower villous height: crypt depth rtio is ssocited with microil chllenges nd ntigenic components of the feed (31). Therefore, mesurement of intestinl mucosl morphology ws used to evlute the surfce re of the intestine undertken for mucosl integrity. The present results show tht supplementtion with the WBF diet elevted ilel mucosl integrity y improving ilel villous height nd the villous height:crypt depth rtio, in greement with previous study showing tht feeding pigs with high-insolule fire diets might e etter protected ginst pthogenic cteri y incresing the villous length (32). Previous studies hve found tht pigs fed solule nd insolule dietry fires hd more golet cells in the ileum thn those in fire-free group (33), in greement with the WBF nd PF diets in the present study. Golet cells hve een found to ply n importnt protective role in the intestine y synthesising nd secreting severl meditors, including mucin nd peptide trefoil fctors (TFF) (34). In the present study, higher colonic TFF concentrtion ws oserved in pigs fed on the WBF nd PF diets with n increse in golet cells. TFF, which is found minly in the smll nd lrge intestine, is reltively resistnt to proteolytic digestion nd cn stimulte the repir process (35). DAO ctivities in the intestinl mucos hve een determined s mrker for smll-intestinl mucosl mturity nd integrity in rts (36). According to Kiyoshi & Yoshihis (37), DAO ctivities in the smll intestine hve een,c c,c Totl cteri Lctocillus Escherichi coli Bifidocterium Fig. 1. Effects of the dietry fires on intestinl cteri in the (A) ilel nd (B) colonic digest. CT ( ), control; MF ( ), mize fire; SF ( ), soyen fire; WBF ( ), whet rn fire; PF ( ), pe fire. Vlues re mens (n 5), with stndrd errors represented y verticl rs.,c Men vlues with unlike letters were significntly different within cluster of rs, not cross the clusters of rs (P,0 05). found to e higher in rts fed fire diet, such s mixture of crystl cellulose nd croxymethyl cellulose sodium slt, thn in rts fed fire-free diet, in greement with pigs fed the WBF diet in the present study. Previous studies hve reported tht the function of mucosl TGF- is to mintin norml epithelil integrity s the lignd of the common epiderml growth fctor/tgf- receptor on djcent cells (38).In the colon, TGF- concentrtion ws higher in pigs fed the PF diet thn in those on the fire-free diet, suggesting tht pigs fed the PF diet hd etter epithelil integrity. Due to the ility to present peptide ntigens to CD4 þ T-lymphocytes, the MHC clss II molecule is necessry to initite the immune response (39). In the present study, pe fire could support stronger intestinl immunity defence response ginst extrcellulr pthogens y incresing colonic MHC-II concentrtion. Therefore, the present study indictes tht pe fire nd whet rn fire could improve intestinl rrier function y incresing the concentrtion of intestinl rrier fctors. Dietry fires hve een shown to selectively regulte intestinl cteri, including stimulting the growth of helthpromoting cteril species (ifidocteri nd lctocilli) nd suppressing the growth of potentil pthogenic cteril species (E. coli nd clostridi) (11,12), in greement with whet rn nd pe fires in the present study. Previous studies hve shown tht lctocilli re predominnt group in the smll intestine (40) ; however, ifidocteri re predominnt group in the colonic microiot (41), which could e the reson for
9 Fire ffects intestinl rrier function 1845 (A) 3 0 mrna copies per β-ctin copy ZO-1 CLDN-1 OCLN Bx Bcl2 IL-1 TNF- TLR2 (B) 2 5 mrna copies per β-ctin copy ZO-1 CLDN-1 OCLN Bx Bcl2 IL-1 TNF- TLR2 the difference in Lctocillus popultions oserved only in the ileum, nd the difference in ifidocteri popultions found only in the colon in the present study. With n increse in Lctocillus popultions in the ileum nd ifidocteri in the colon of piglets fed the WBF diet, the estlishment of E. coli ws inhiited possily y phenomenon known s competitive exclusion, first referred to s colonistion resistnce (42). However, we found tht not ll of the dietry fires selected could estlish etter intestinl microflor, nd there ws difference in E. coli popultions etween the pigs fed the WBF nd SF diets. According to Cstillo et l. (43), the host s intestinl cteri chnges in response to dietry fire composition due to specific sustrte preferences of cteri. Supplementtion with specific dietry fire llows the regultion of the composition of intestinl cteri (44). These results indicte tht more fire components esily used y ifidocteri nd lctocilli exist in whet rn nd pe fires thn in mize nd soyen fires. On the contrry, more fire components esily used y E. coli exist in soyen fire, compred with whet rn fire in the present study. Tight junction proteins (ZO-1, CLDN1 nd OCLN) ply crucil role in intestinl rrier integrity, which sel the prcellulr spce etween epithelil cells, thus preventing the Fig. 2. Effects of the dietry fires on intestinl gene expression in (A) the ileum nd (B) the colon. CT ( ), control; MF ( ), mize fire; SF ( ), soyen fire; WBF ( ), whet rn fire; PF ( ), pe fire; ZO-1, zonul occludens 1; CLDN-1, cludin 1; OCLN, occludin; Bx, Bcl-2-ssocited X protein; Bcl2, B-cell lymphom/leukemi-2; TLR2, Toll-like receptor 2. Vlues re mens (n 5), with stndrd errors represented y verticl rs. Men vlues with unlike letters were significntly different within cluster of rs, not cross the clusters of rs (P,0 05). prcellulr diffusion of intestinl cteri nd other ntigens cross the epithelium (45). In vitro, the proiotic Lctocillus lso hve shown to up-regulte occludin nd cingulin gene mrna levels of Cco-2 cells, suggesting tht cteri could ffect intestinl rrier integrity y regulting the gene expression level of tight junction proteins (13). In contrst, E. coli hs een reported to trigger tight junction disruption through destilistion nd dissocition of the ZO-1, occludin nd cludin 1 tight junction complex from the epithelil cells (14,15). Previous studies hve shown tht occludin mrna levels were higher in rts fed glcto-oligoscchride diet thn in those fed fire-free diet, nd the eneficil effect of glcto-oligoscchrides on occludin mrna levels hs een considered to e relted to the greter numer of ifidocteri nd lctocilli (12), in greement with whet rn fire in the present study. However, moleculr mechnisms y which intestinl cteri medite tight junction ltertions re still uncler. Toll-like receptor 2 (TLR2) hs een shown to ply key role in microil recognition nd the control of dptive immune responses (46). TLR2 ctivted y specific microil lignds is necessry to preserve intestinl epithelil tight junction-ssocited integrity ginst toxic or inflmmtory
10 1846 H. Chen et l. stress-induced dmge in rts (47,48). According to Gison et l. (49), TLR2 2/2 mice suffered impired epithelil rrier function medited vi ZO-1 nd cludin 3, suggesting tht TLR2 plys criticl role in mintining intestinl mucosl integrity during infection y cteril pthogen. These results suggest tht TLR2 could medite rrier function vi tight junction protein gene expression in pigs fed whet rn fire diet, s specific microil lignds in the present study. Menwhile, we found tht pigs fed the MF nd SF diets up-regulted intestinl pro-inflmmtory cytokine (IL-1 nd TNF-) mrna levels s interference fctors of the intestinl rrier (50). Pro-inflmmtory cytokines hve een shown to increse intestinl permeility through the dysregultion of tight junction proteins (51,52), which is the prtil reson why lower ZO-1 nd OCLN mrna levels were found in pigs fed the MF nd SF diets thn in those on the WBF diet. In the present study, difference in VFA concentrtions in the fire diets ws oserved only in the colon, ut not in the ileum, which is possily ecuse the digest is retined longer in the lrge intestine thn in the smll intestine nd ecuse microil popultions re greter in the colon thn in the ileum (53). According to Tcik et l. (54), chnge in totl VFA concentrtions ws oserved in the middle colon when pigs were fed different fire sources (potto fire or cellulose). A previous study hs indicted tht utyrte concentrtion ws higher in pigs fed whet rn fire diet thn in those on mize fire diet (55), in greement with the present study. Lower fermentle components oserved in the MF diet were due to VFA concentrtions eing lower in pigs fed the MF diet thn in those on the other fire diets, resulting in lower energy supply for the growth of the intestinl epithelium. However, fermentility of the fire sources could not explin why whet rn nd pe fires, nd not soyen fire, improved intestinl rrier function. From the composition nlysis of fire sources, it hs een found tht cerel (mize nd whet rn) fires hve higher NDF content thn legume (soyen nd pe) fires, which suggests higher insolule fire content in cerel thn in legume fires (20). However, positive effects of whet rn nd pe fires on ilel nd colonic rrier integrity pper to e relted to high ADF nd cellulose contents of fire sources rther thn to their otnicl origin nd soluility. Menwhile, there is n interesting difference in C: higher C content in whet rn nd pe fire diets, in greement with the present results showing chnges in epithelium integrity. Previous studies hve shown tht n increse in dietry C content hs eneficil impct on intestinl lkline phosphtse (56), which is key enzyme involved in the dephosphoryltion (nd detoxifiction) of pro-inflmmtory cteril components resulting in the down-regultion of intestinl inflmmtion (57). Also, eneficil effects of dietry C hve een documented in niml models of colonic inflmmtion (58 60). Incidentlly, the protective effects of C seem to depend on dietry P (59), nd the WBF diet lso displyed higher P content in the present study. In conclusion, complex fire sources could ffect intestinl mucosl rrier function nd regulte intestinl cteri in wening piglets. Also, the present results show tht piglets fed the different fire sources did not hve the sme qulittive or quntittive effects on ilel nd colonic rrier functions. Whet rn nd pe fires improved intestinl rrier function, proly medited y chnges in microiot composition nd concomitnt chnges in TLR2 gene expression. Additionlly, fire composition is considered s more importnt fctor to ffect intestinl rrier function in piglets thn their otnicl origin, soluility nd fermentility. Acknowledgements The present study ws supported y the ermrked fund for the Chin Agriculture Reserch System. Ech uthor fully contriuted to the design, experiment nd interprettion of the results of the study. There is no conflict of interest. References 1. Blikslger AT, Moeser AJ, Gookin JL, et l. (2007) Restortion of rrier function in injured intestinl mucos. Physiol Rev 87, Kunzelmnn K & Mll M (2002) Electrolyte trnsport in the mmmlin colon: mechnisms nd implictions for disese. Physiol Rev 82, Plyford RJ (1995) Peptides nd gstrointestinl mucosl integrity. Gut 37, Plyford RJ, Ghosh S & Mhmood A (2004) Growth fctors nd trefoil peptides in gstrointestinl helth nd disese. Curr Opin Phrmcol 4, Agostino L, Argenio G, Cicci C, et l. (1984) Dimine oxidse in rt smll owel: distriution in different segments nd cellulr loction. Enzyme 31, Turner JR (2006) Moleculr sis of epithelil rrier regultion from sic mechnisms to clinicl ppliction. Am J Pthol 169, Kuchrzik T, Wlsh SV, Chen J, et l. (2001) Neutrophil trnsmigrtion in inflmmtory owel disese is ssocited with differentil expression of epithelil intercellulr junction proteins. Am J Pthol 159, Meddings JB, Jrnd J, Urnski SJ, et l. (1999) Incresed gstrointestinl permeility is n erly lesion in the spontneously dietic BB rt. Am J Physiol Gstrointest Liver Physiol 276, Ingvr B (2004) Fire effects on intestinl functions (dirrhe, constiption nd irritle owel syndrome). Clin Nutr Suppl 1, Iin AB (2011) The physiologicl roles of dietry fire. Food Hydrocolloids 25, Gison GR, Betty ER, Wng X, et l. (1995) Selective stimultion of ifidocteri in the humn colon y oligofructose nd inulin. Gstroenterology 108, Zhong Y, Ci DL, Ci W, et l. (2009) Protective effect of glctooligoscchride-supplemented enterl nutrition on intestinl rrier function in rts with severe cute pncretitis. Clin Nutr 28, Anderson RC, Cookson AL, McN WC, et l. (2010) Lctocillus plntrum MB452 enhnces the function of the intestinl rrier y incresing the expression levels of genes involved in tight junction formtion. BMC Microiol 10, Spitz J, Yuhn R, Koutsouris A, et l. (1995) Enteropthogenic Escherichi coli dherence to intestinl epithelil
11 Fire ffects intestinl rrier function 1847 monolyers diminishes rrier function. Am J Physiol Gstrointest Liver Physiol 268, G374 G Muz-Moons MM, Schneeerger EE & Hecht GA (2004) Enteropthogenic Escherichi coli infection leds to ppernce of errnt tight junctions strnds in the lterl memrne of intestinl epithelil cells. Cell Microiol 6, Fuller MF & Cdenhed A (1991) Effect of the mount nd composition of the diet on glctosmine flow from the smll intestine. In Digestive Physiology in Pigs. EAAP Puliction No. 54, pp [MWA Verstegen, J Huismn nd LA den Hrtog, editors]. Wgeningen: Pudoc. 17. Lien KA, Suer WC & He JM (2001) Dietry influences on the secretion into nd degrdtion of mucin in the digestive trct of monogstric nimls nd humns. J Anim Feed Sci 10, Hmerg O, Rumessen JJ & Gudmndhoyer E (1989) Bloodglucose response to pe fier comprisons with sugr-eet fier nd whet rn. Am J Clin Nutr 50, Titgemeyer EC, Bourquin LD, Fhey GC, et l. (1991) Fermentility of vrious fier sources y humn fecl cteri in vitro. Am J Clin Nutr 53, Vn Soest PJ, Roertson JB & Lewis BA (1991) Methods for dietry fier, neutrl detergent fier, nd nonstrch polyscchrides in reltion to niml nutrition. J Diry Sci 74, Shen YB, Pio XS, Kim SW, et l. (2009) Effects of yest culture supplementtion on growth performnce, intestinl helth, nd immune response of nursery pigs. J Anim Sci 87, Frnklin MA, Mthew AG, Vickers JR, et l. (2002) Chrcteriztion of microil popultions nd voltile ftty cid concentrtions in the jejunum, ileum nd cecum of pigs wened t 17 vs 24 dys of ge. J Anim Sci 80, Hn GQ, Xing ZT, Yu B, et l. (2012) Effects of different strch sources on Bcillus spp. in intestinl trct nd expression of intestinl development relted genes of wenling piglets. Mol Biol Rep 39, Lee C, Lee S, Shin SG, et l. (2008) Rel-time PCR determintion of rrna gene copy numer: solute nd reltive quntifiction ssys with Escherichi coli. Appl Environ Micro 78, Qi HW, Xing ZT, Hn GQ, et l. (2011) Effects of different dietry protein sources on cecl microflor in rts. Afr J Biotechnol 10, Xing ZT, Qi HW, Hn GQ, et l. (2011) Rel-time TqMn polymerse chin rection to quntify the effects of different sources of dietry strch on Bifidocterium in the intestinl trct of piglets. Afr J Biotechnol 10, Michel WP (2001) A new mthemticl model for reltive quntifiction in rel-time RT-PCR. Nucleic Acids Res 29, e Wellock IJ, Fortomris PD, Houdijk JG, et l. (2008) The consequences of non-strch polyscchride soluility nd inclusion level on the helth nd performnce of wened pigs chllenged with enterotoxigenic Escherichi coli. Brit J Nut 99, Molist F, Gómez DS, Gs J, et l. (2009) Effects of dietry fire on phsycochemicl chrcteristics of digest, microil ctivity nd gut mturtion in erly wened piglets. Anim Feed Sci Technol 149, Becker PM, Wikselr PG, Jnsmn AJ, et l. (2009) Pe dietry fier for dhesion nd excretion of enterotoxigenic E. coli K88 to prevent intestinl coloniztion. J Anim Sci 87, Hung CW, Lee TT, Shih YC, et l. (2012) Effects of dietry supplementtion of Chinese medicinl hers on polymorphonucler neutrophil immune ctivity nd smll intestinl morphology in wenling pigs. J Anim Physiol Anim Nutr 96, Hedemnn MS, Eskildsen M, Lærke HN, et l. (2006) Intestinl morphology nd enzymtic ctivity in newly wened pigs fed contrsting fier concentrtions nd fier properties. J Anim Sci 84, Shingo H, Noki T, Kei S, et l. (2012) Smll intestinl golet cell prolifertion induced y ingestion of solule nd insolule dietry fier is chrcterized y n increse in silylted mucins in rts. J Nutr 142, Kirk SB, Julin AG, Mohmmd R, et l. (2008) Modultion of intestinl golet cell function during infection y n ttching nd effcing cteril pthogen. Infect Immun 76, Rymond JP, Surt G & Asif M (2004) Growth fctors nd trefoil peptides in gstrointestinl helth nd disese. Curr Opin in Phrmcol 4, D Agostino L, D Argenio G, Cicci C, et l. (1984) Dimine oxidse in rt smll owel: distriution in different segments nd cellulr loction. Enzyme 31, Kiyoshi E & Yoshihis N (1998) Comprtive effect of wtersolule nd -insolule dietry fier on owel function in rts fed liquid elementl diet. Nutr Res 18, Romno M, Polk WH, Awd JA, et l. (1992) Trnsforming growth fctor protection ginst drug-induced injury to rt gstric mucos in vivo. J Clin Invest 90, Tjdine MH, Erik S & Peter JE (2004) Function nd regultion of MHC clss II molecules in T-lymphocytes: of mice nd men. Hum Immunol 65, Bin L, Joshu G, Qi W, et l. (2011) In-vitro ssessment of the effects of dietry fiers on microil fermenttion nd communities from lrge intestinl digest of pigs. Food Hydrocolloids 25, Jing W, Boguo S, Ynping C, et l. (2010) In vitro fermenttion of xylooligoscchrides from whet rn insolule dietry fier y ifidocteri. Crohyd Polym 82, vn der Wij D, Berghuis-de Vries JM & Lekkerkerk Lekkerkerk-v (1971) Colonistion resistnce of the digestive trct in conventionl nd ntiiotic treted mice. J Hyg 69, Cstillo M, Skene G, Roc M, et l. (2007) Appliction of 16S rrna gene-trgetted fluorescence in situ hyridiztion nd restriction frgment length polymorphism to study porcine microiot long the gstrointestinl trct in response to different sources of dietry fire. FEMS Microiol Ecol 59, Brr UM, Seem H, Roert P, et l. (2010) Nonstrch polyscchrides modulte cteril microiot, pthwys for utyrte production, nd undnce of pthogenic Escherichi coli in the pig gstrointestinl trct. Appl Environ Micro 76, Dulnth U, Rchel CA, Wrren CM, et l. (2011) Regultion of tight junction permeility y intestinl cteri nd dietry components. J Nutr 141, Crio E (2005) Bcteril interctions with cells of the intestinl mucos: Toll-like receptors nd NOD2. Gut 54, Crio E (2008) Brrier-protective function of intestinl epithelil Toll-like receptor 2. Mucosl Immunol 1, Suppl. 1, S62 S Mnkertz J, Tvlli S, Schmitz H, et l. (2000) Expression from the humn occludin promoter is ffected y tumor necrosis fctor lph nd interferon gmm. J Cell Sci 113, Gison DL, M C, Rosenerger CM, et l. (2008) Toll-like receptor 2 plys criticl role in mintining mucosl
12 1848 H. Chen et l. integrity during Citrocter rodentium-induced colitis. Cell Microiol 10, Boivin MA, Ye D, Kennedy JC, et l. (2007) Mechnism of glucocorticoid regultion of the intestinl tight junction rrier. Am J Physiol Gstrointest Liver Physiol 292, G590 G Zund G, Mdr JL, Dzus AL, et l. (1996) Interleukin-4 nd interleukin-13 differentilly regulte epithelil chloride secretion. J Biol Chem 271, Berin MC, Yng PC, Ciok L, et l. (1999) Role for IL-4 in mcromoleculr trnsport cross humn intestinl epithelium. Am J Physiol Cell Physiol 276, C1046 C Simpson JM, McCrcken VJ, White BA, et l. (1999) Appliction of denturnt grdient gel electrophoresis for the nlysis of the porcine gstrointestinl microiot. J Microiol Methods 36, Tcik M, Pstuszewsk B, Tuśnio A, et l. (2010) Effects of two protein nd fire sources on SCFA concentrtion in pig lrge intestine. Livest Sci 133, Crneiro MS, Lordelo MM, Cunh LF, et l. (2008) Effects of dietry fire source nd enzyme supplementtion on fecl pprent digestiility, short chin ftty cid production nd ctivity of cteril enzymes in the gut of piglets. Anim Feed Sci Tech 146, Brun LR, Brnce ML & Riglli A (2012) Luminl clcium concentrtion controls intestinl clcium sorption y modifiction of intestinl lkline phosphtse ctivity. Br J Nutr 108, Llles JP (2010) Intestinl lkline phosphtse: multiple iologicl roles in mintennce of intestinl homeostsis nd modultion y diet. Nutr Rev 68, Schepens MAA, Schonewille AJ, Vink C, et l. (2009) Supplementl clcium ttenutes the colitis-relted increse in dirrhe, intestinl permeility, nd extrcellulr mtrix rekdown in HLA-1327 trnsgenic rts. J Nutr 139, Schepens MAA, ten Bruggencte SJM, Schonewille AJ, et l. (2012) The protective effect of supplementl clcium on colonic permeility depends on clcium phosphteinduced increse in luminl uffering cpcity. Br J Nutr 107, vn Ampting MTJ, Schonewille AJ, Vink C, et l. (2010) Dmge to the intestinl epithelil rrier y ntiiotic pretretment of slmonell-infected rts is lessened y dietry clcium or tnnic cid. J Nutr 140,
The effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationThe Ever Changing World of Feed Additives in The Poultry Industry
The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationProducts for weaners Benzoic acid or the combination of lactic acid and formic acid
Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationInfluence of Supplemental Dried Whey on Broiler Performance and Cecal Flora
Interntionl Journl of Poultry Science 5 (6): 58-54, 006 ISSN 68-856 Asin Network for Scientific Informtion, 006 Influence of Supplementl Dried Whey on Broiler Performnce nd Cecl Flor H. Kermnshhi nd H.
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationSoybean Hulls as an Alternative Feed for Horses
Animl Industry Report AS 650 ASL R1931 2004 Soyben Hulls s n Alterntive Feed for Horses Josie Booth Iow Stte University Howrd Tyler Iow Stte University Peggy Miller-Auwerd Iow Stte University Jenette Moore
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationHydroxy Minerals - The Newest Development in Mineral Nutrition
Hydroxy Minerls - The Newest Development in Minerl Nutrition By Jeff Cohen nd F. A. Stewrd For t lest 3 yers nutritionl sources of essentil trce minerls such s iron, zinc, copper nd mngnese hve een commonly
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationPreliminary investigation of antimicrobial effects of pomegranate (Punica granatum L.) leathery exocarp extract against some serious phytopathogens
Preliminry investigtion of ntimicroil effects of pomegrnte (Punic grntum L.) lethery exocrp extrct ginst some serious phytopthogens Elshfie H.S. 1,*, Skr S.H. 2, Mng S.M. 1, Frisullo S. 3, Cmele I. 1 1
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationThe Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers
Beef Reserch Report, 2000 Animl Science Reserch Reports 2001 The Effects of High-Oil Corn or Typicl Corn with or without Supplementl Ft on Diet Digestibility in Finishing Steers Crig R. Belknp Iow Stte
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationOverview Background production, fermentable
Microes sustinle qufeed resource for the future Liv Torunn Mydlnd, Odd Helge Romrheim, Thor Lndsverk, Anders Skrede nd Mrgreth Øverlnd. Overview Bckground production, fermentle sustrtes, cell growth type
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationSupporting information
Supporting informtion Multiple Univrite Dt Anlysis Revels the Inulin Effects on the High-ft-diet Induced Metolic Altertions in Rt Myocrdium nd Testicles in the Pre-oesity Stte Yixun Dun #, Ynpeng An #,
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationEffects of Dietary Protein and Energy on Growth Performance and Carcass Characteristics of Betong Chickens (Gallus domesticus) During Growing Period
Interntionl Journl of Poultry Science 9 (5): 468-472, 2010 ISSN 1682-8356 Asin Network for Scientific Informtion, 2010 Effects of Dietry Protein nd Energy on Growth Performnce nd Crcss Chrcteristics of
More informationProtein Quality Dynamics During. Grass-Legume Forage
Protein Qulity Dynmics During Wilting nd Preservtion of Grss-Legume Forge Eliset Ndeu 1, Wolfrm Richrdt 2, Michel Murphy 3 nd Horst Auerch 4 1 Swedish University of Agriculturl Sciences, Skr, Sweden 2
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More information4/16/2009. Gabler Laboratory Research Program. Long chain n-3 Fatty Acids, Fetal Programming and Swine. My Background. Swine Research Areas
/1/9 Gler Lortory Reserch Progrm Nichols Gler Venktesh Mni (PhD. student) Emily Kuntz (BSc. student) Mrth Jeffrey (L. Mnger) Deprtment of Animl Sciences Iow Stte University L Troe University B. Agriculturl
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationImplication of fermentable carbohydrates targeting the gut microbiota on conjugated linoleic acid production in high-fat-fed mice
British Journl of Nutrition, pge 1 of 14 q The Authors 213 doi:1.117/s7114513123 Impliction of fermentle crohydrtes trgeting the gut microiot on conjugted linoleic cid production in high-ft-fed mice Céline
More informationBritish Journal of Nutrition
British Journl of Nutrition (2015), 113, 923 934 doi:10.1017/s0007114514003201 q The Authors 2015. This is n Open Access rticle, distriuted under the terms of the Cretive Commons Attriution licence (http://cretive
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationEffects of Different Sources and Levels of Selenium on Performance, Thyroid Function and Antioxidant Status in Stressed Broiler Chickens
Interntionl Journl of Poultry Science 8 (6): 583-587, 2009 ISSN 1682-8356 Asin Network for Scientific Informtion, 2009 Effects of Different Sources nd Levels of Selenium on Performnce, Thyroid Function
More informationArabinoxylans, inulin and Lactobacillus reuteri 1063 repress the adherent-invasive Escherichia coli from mucus in a mucosa-comprising gut model
www.nture.com/npjiofilms ARTICLE OPEN Arinoxylns, inulin nd Lctocillus reuteri 1063 repress the dherent-invsive Escherichi coli from mucus in mucos-comprising gut model Pieter Vn den Aeele 1,3, Mssimo
More informationEnhanced glutathione peroxidases (GPx) activity in young barley seedlings enriched with selenium
Africn Journl of Biotechnology Vol. 10(55), pp. 11483-11487, 21 Septemer, 2011 Aville online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB11.1480 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationphosphatase isoenzyme activity: estimation of
J Clin Pthol 1988;41:202-206 Quntittive method for determining serum lkline phosphtse isoenzyme ctivity: estimtion of intestinl component M J PEAKE, M PEJAKOVIC, G H WHITE From the Deprtment ofbiochemistry
More informationEffect of Mannan Oligosaccharide (Bio-Mos) Addition With and Without Zinc Oxide on Performance and Immunocompetence of Weanling Pigs
Effect of Mnnn Oligoscchride (Bio-Mos) Addition With nd Without Zinc Oxide on Performnce nd Immunocompetence of Wenling Pigs E. Dvis, C. Mxwell, B. de Rods, nd D. Brown 1 Story in Brief An experiment involving
More informationFaculty of Kinesiology and Department of Biochemistry & Molecular Biology, University of Calgary, Calgary, AB T2N 1N4, Canada 2
Nutrients 214, 6, 1115-1127; doi:1.339/nu631115 Article OPEN ACCESS nutrients ISSN 272-6643 www.mdpi.com/journl/nutrients Effect of the Novel Polyscchride PolyGlycopleX on Short-Chin Ftty Acid Production
More informationEffects of phospholipids and HUFA levels on ontogene7c development and performance of pikeperch (Sander lucioperca) larvae
Effects of phospholipids nd HUFA levels on ontogene7c development nd performnce of pikeperch (Snder lucioperc) lrve DTU Aqu, FUNDP, ULPGC ACM 2017 Brcelon, Jnury 2017 The outcome of the experiments should
More informationPotential of plant-derived antimicrobials for controlling zoonotic and food-borne diseases
Potentil of plnt-derived ntimicrobils for controlling zoonotic nd food-borne diseses Kumr Venkitnrynn, DVM, MVSc, MS, Ph.D. Professor of Microbiology Grdute Progrms Chir Deprtment of Animl Science University
More informationEffect Of MiCroPlex Chromium Methionine And Vitamin E Supplementation On Growth Performance And Immune Status Of Stressed Beef Calves
Effect Of MiCroPlex Chromium Methionine And Vitmin E Supplementtion On Growth Performnce And Immune Sttus Of Stressed Beef Clves Z BCr - 16 Ojective Evlute MiCroPlex nd vitmin E effects on growth nd immune
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationEffect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant
Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationSupporting Information. In Situ Supramolecular Assembly and Modular Modification of Hyaluronic Acid Hydrogels for 3D Cellular Engineering
Supporting Informtion In Situ Suprmoleculr Assemly nd Modulr Modifiction of Hyluronic Acid Hydrogels for 3D Cellulr Engineering Kyeng Min Prk,, Jeong-A Yng,, Hyunte Jung, c Junseok Yeom, Ji Sun Prk, d
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationEffect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens
Interntionl Journl of Poultry Science 7 (12): 1232-1236, 2008 ISSN 1682-8356 sin Network for Scientific Informtion, 2008 Effect of Different Dietry Energy Sources on Induction of Ftty Liver-Hemorrhgic
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationSupplementation and Cooking of Pearl Millet: Changes in Protein Fractions and Sensory Quality
World Journl of Diry & Food Sciences 4 (1): 41-45, 29 ISSN 1817-38X IDOSI Pulictions, 29 Supplementtion nd Cooking of Perl Millet: Chnges in Protein Frctions nd Sensory Qulity Mh A.M. Ali, Adullhi H. El
More informationGoal: Evaluate plant health effects while suppressing dollar spot and brown patch
Newer Fungicide Products Alone nd In Rottion on Chicgo Golf Green Reserchers: Chicgo District Golf Assoc. Derek Settle, Tim Sibicky, nd Nick DeVries Gol: Evlute plnt helth effects while suppressing dollr
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationArchived at the Flinders Academic Commons:
Archived t the Flinders Acdemic Commons: http://dspce.flinders.edu.u/dspce/ Bjk, B.H., Topping, D., Coic, L., & Clrke, J.M., 26. Butyrylted strch is less susceptile to enzymic hydrolysis nd increses lrge-owel
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationEffect of Mannanase on Broiler Performance, Ileal and In-vitro Protein Digestibility, Uric Acid and Litter Moisture in Broiler Feeding
Interntionl Journl of Poultry Science 4 (1): 21-26, 2005 Asin Network for Scientific Informtion, 2005 Effect of Mnnnse on Broiler Performnce, Ilel nd In-vitro Protein Digestiility, Uric Acid nd Litter
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationDr. Javier Polo Vice President Research & Development
Efecto de l suplementción con concentrdo de inmunoglobulins prtir del suero bovino en l Microbiot y su contribución l slud intestinl y l sistem nervioso centrl Dr. Jvier Polo Vice President Reserch & Development
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationEffects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle
Effects of Recominnt Bovine Somtotropin Administrtion t Breeding on the Cow, Conceptus nd Susequent Offspring Performnce of Beef Cttle V. R. G. Mercdnte 1, F. M. Cirico 1, D. D. Henry 1, P. L. P. Fontes
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationImmunobiotic Lactobacillus jensenii as immune-health promoting factor to improve growth performance and productivity in post-weaning pigs
Sud et l. BMC Immunology 2014, 15:24 RESEARCH ARTICLE Open Access Immunobiotic Lctobcillus jensenii s immune-helth promoting fctor to improve growth performnce nd productivity in post-wening pigs Yoshihito
More informationEffect of 1-Methylcyclopropene on the Physiology and Yield of Cotton. Derrick Oosterhuis Eduardo Kawakami and Dimitra Loka University of Arkansas
Effect of 1-Methylcyclopropene on the Physiology nd Yield of Cotton Derrick Oosterhuis Edurdo Kwkmi nd Dimitr Lok University of Arknss Cotton Crop Gossypium hirsutum Unique out cotton Perennil grown s
More informationResponse of Commercial Egg-Type Pullets to Diets Varying in Protein and Energy Content in Arid Hot Climate
Interntionl Journl of Poultry Science 8 (9): 90-98, 2009 ISSN 682-8356 sin Network for Scientific Informtion, 2009 Response of Commercil Egg-Type Pullets to Diets Vrying in Protein nd Energy Content in
More informationSUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis
SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationdoi: /s British Journal of Nutrition (2016), 115, The Authors 2016
British Journl of Nutrition (2016), 115, 2236 2245 The Authors 2016 doi:10.1017/s0007114516000842 Supplementtion of rnched-chin mino cids to reduced-protein diet improves growth performnce in piglets:
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationChoice Feeding of Two Different Broiler Strains Using Diets with Constant Energy Level 1
Interntionl Journl of Poultry Science 7 (8): 726-737, 2008 ISSN 1682-8356 Asin Network for Scientific Informtion, 2008 Choice Feeding of Two Different Broiler Strins Using Diets with Constnt Energy Level
More informationBritish Journal of Nutrition
(2015), 113, 610 617 q The Authors 2015 doi:10.1017/s0007114514004231 Down-regultion of monocrboxylte trnsporter 1 (MCT1) gene expression in the colon of piglets is linked to bcteril protein fermenttion
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationPerformance and Carcass Characteristics of Broiler Chickens Fed Diets Supplemented with Graded Levels of Roxazyme G
Interntionl Journl of Poultry Science 6 (5): 5-9, 2007 ISSN 1682-856 Asin Network for Scientific Informtion, 2007 Performnce nd Crcss Chrcteristics of Broiler Chickens Fed Diets Supplemented with Grded
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationIbrahim, I. Hamid Animal Production Research Center-Khartoum North, Sudan
Interntionl Journl of Poultry Science 13 (8): 484-488, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 Investigtions into the Addition of Herl Methionine (Phytonin) As Sustitute of Synthetic
More informationType II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More information