Research Article Total 4EBP1 Is Elevated in Liver of Rats in Response to Low Sulfur Amino Acid Intake

Transcription

1 Journl of Amino Acids Volume 2013, Article ID , 11 pges Reserch Article Totl 4EBP1 Is Elevted in Liver of Rts in Response to Low Sulfur Amino Acid Intke Angelos K. Siklidis, 1 Kevin M. Mzor, 1 Minji Kng, 1 Hongyun Liu, 1,2 nd Mrth H. Stipnuk 1 1 Division of Nutritionl Sciences, Cornell University, Ithc, NY 14853, USA 2 College of Animl Sciences, Zhejing University, Hngzhou , Chin Correspondence should e ddressed to Mrth H. Stipnuk; mhs6@cornell.edu Received 19 April 2013; Accepted 30 July 2013 Acdemic Editor: Dorothy Gietzen Copyright 2013 Angelos K. Siklidis et l. This is n open ccess rticle distriuted under the Cretive Commons Attriution License, which permits unrestricted use, distriution, nd reproduction in ny medium, provided the originl work is properly cited. Trnsltion initition is known to e regulted y the inding of eukryotic initition fctor 4E (eif4e) y inding proteins (4EBPs), nd there is evidence tht mino cid deprivtion nd other cellulr stresses upregulte 4EBP1 expression. To pursue the question of whether diets limited in n essentil mino cid led to induction of 4EBP1 expression in vivo, diets tht vried in methionine nd cystine content were fed to rts for 7 dys, nd 4EBP1 mrna nd protein levels nd 4EBP1 phosphoryltion stte were determined. Totl 4EBP1 mrna nd protein undnce incresed in liver of rts with severely deficient intkes of sulfur mino cids (0.23% or 0.11% methionine without cystine) ut not in nimls with less restricted intke of sulfur mino cids (0.11% methionine plus 0.35% cystine) ut similrly restricted intke of totl diet (53 to 62% of control). The mount of 4EBP1 inding ctivity (α + β forms) ws elevted in liver of rts fed sulfur mino cid-deficient diets, wheres the hyperphosphoryltion of 4EBP1 ws not ffected y dietry tretment. Results suggest tht chnges in totl 4EBP1 expression should e considered when exmining mechnisms tht ttenute protein synthesis during mino cid deficiency sttes. 1. Introduction Regultion of protein synthesis in eukryotic cells occurs primrily t the initition step of mrna trnsltion, during which riosoml suunits re recruited to the mrna through the ction of eukryotic initition fctors (eifs). The regultion of mrna trnsltion initition plys criticl roles in the regultion of cell division, differentition, growth, survivl, nd poptosis, nd dysregultion of trnsltion initition is ssocited with cncer, oesity, insulin resistnce, nd impired responses to vrious stress situtions [1 7]. The two est understood mechnisms for regultion of mrna trnsltion initition re the regultion of formtion of the ternry complex, which consists of the methionine-chrged inititor trna, eif2, nd GTP, nd the regultion of ssemly of the eif4f complex, which involves the ssocition of the mrna 5 cp-inding protein eif4e with eif4g nd eif4a. Phosphoryltion of the lph suunit of eif2 (eif2α) locks ternry complex formtion, therey locking formtion of the 43S preinitition complex nd suppressing glol trnsltion. Mmmls hve four eif2α kinses tht re ctivted y different types of cellulr stress, including the unfolded protein response nd mino cid deprivtion, such tht downstrem effects of eif2α phosphoryltion re shred mong different stress-response pthwys [8]. The glol ttenution of trnsltion tht results from lck of 43S preinitition complex prdoxiclly increses the trnsltion of suset of mrnas, including tht encoding ctivting trnscription fctor 4 (ATF4) [9]. Upregultion of the trnsltion of ATF4 nd other trget proteins cn then led to incresed trnscription of stress-relted genes (such s Atf3, Asns, Cep, ndtri3), llowing the cell to synthesize the suset of proteins needed to respond to the stress tht initited the response [10 12].

2 2 Journl of Amino Acids Formtion of the eif4f complex is regulted y competition etween eif4e inding proteins (4EBPs) nd eif4g for inding to eif4e. The 4EBPs compete with eif4g for shred inding site of eif4e, such tht the inding of 4EBPs nd eif4g to eif4e is mutully exclusive. In response to the presence of growth fctors nd nutrients, mechnistic trget of rpmycin complex 1 (mtorc1) phosphoryltes 4EBP, which leds to further phosphoryltion of dditionl residues of 4EBP [13]. The hyperphosphoryltion of 4EBP drmticlly reduces its ffinity for eif4e nd therey promotes its ssocition with eif4g to form the trnsltionlly competent eif4f complex, which recruits the 43S preinitition complex to the mrna. 4EBP hyperphosphoryltion diminishes the cpcity of eif4e to ind TOP-like mrnas much more thn other mrnas, which explins why mtorc1 inhiition results in mrked inhiition of trnsltion of suset ofmrnasthttendtoencodeproteinsssocitedwith trnsltion (e.g., cytoplsmic riosoml proteins) nd more modest suppression of the trnsltion of other mrnas [14]. In mmmls, the 4EBP fmily consists of 3 proteins, 4EBP1, 4EBP2, nd 4EBP3. The est chrcterized 4EBP is 4EBP1, which contins six known Ser/Thr phosphoryltion sites, two of which re phosphorylted directly y mtorc1 [13, 15, 16]. 4EBP1 is most undnt in tissues involved in glucose nd lipid homeostsis, including dipose tissue, pncres, muscle, nd liver [17], wheres 4EBP2 is expressed uiquitously [18]. In contrst to 4EBP1 nd 4EBP2, 4EBP3 lcks conserved N-terminl regultory motif (RAIP) tht is criticl for phosphoryltion of 4EBP1/2 t the mtorc1- regulted sites [13, 19] nd my ply different cellulr role thn 4EBP1 nd 4EBP2 [20]. The regultion of 4EBP1 expression in vrious tissues hs not een studied extensively lthough studies with cell lines hve demonstrted TGFβ-SMAD4-medited [21], MYC-medited [22], eif2α kinse-dependent [23], oratf4- dependent [6] upregultion of 4Ep1 gene trnscription. In ddition, 4Ep1 gene trnscription ws negtively regulted y induction of Egr1 expression in vrious cells in response to ctivtion of ERK/mitogen-ctivted protein kinse or PI3K signling pthwys [24, 25]. Despite the complexity of the ody s responses to vrious stress situtions, the GCN2 (generl control nonderepressile 2, lso known s eif2α kinse 4) ATF4 pthwy is well known to regulte mny responses to mino cid deprivtion [26 28] nd is likely meditor of the induction of 4EBP1 y sulfur mino cid deprivtion. The 4Ep1 gene contins two CCAAT-enhncer inding protein-ctivting trnscription fctor (C/EBP-ATF) response elements (CARE), nd the upregultion of 4EBP1 mrna [23]orprotein[26] undnce in response to mino cid deficiency hs een reported for cells cultured in medium deficient in n essentil mino cid. Upregultion of 4EBP1 hs lso een shown to occur in murine tissues nd in MIN6 cells following induction of endoplsmic reticulum (ER) stress with thpsigrgin or tunicmycin [6]. Expression of dominnt-negtive form of ATF4 in MIN6 cells suppressed 4EBP1 induction y thpsigrgin, wheres expression of wild-type ATF4 drmticlly induced 4EBP1 expression, supporting criticl role for ATF4 in induction of 4EBP1 expression [6]. Furthermore, 4EBP1 mrna levels were not incresed y thpsigrgin in Atf4 / murine emryonic firolsts; the trnscriptionl inhiitor ctinomycin D completely locked induction of 4EBP1 protein y thpsigrgin in MIN6 cells; disruption of oth ATF4 inding sites in the 4Ep1 promoter olished reporter gene expression in MIN6 cells [6]. Thus, it seems likely tht stress conditions, such s mino cid deprivtion, my ffect trnsltionl control y incresed 4EBP1 undnce, which could inhiit eif4f ssemly, s well s y the well-estlished mechnism tht involves diminished formtion of ternry complex, with oth the decrese in ternry complex formtion nd the increse in 4EBP1 undnce dependent on the eif2α/atf4 signling pthwy.becusewepreviouslyswmrkedupregultion of eif2α phosphoryltion nd induction of stress responses in liver of rts fed sulfur mino cid-deficient soy protein diet [27], we decided to explore the expression of heptic 4EBP1 nd its ssocition with eif2α phosphoryltion nd mtormedited 4EBP1 hyperphosphoryltion/inctivtion in rts fed mino cid-sed diets tht differed in methionine nd cystine content. 2. Mterils nd Methods 2.1. Animls nd Diets. The study ws conducted using mle Sprgue-Dwley rts tht weighed pproximtely 110 g ( 5 weeks of ge) nd were purchsed from Hrln Sprgue Dwley (Indinpolis, IN, USA). Animl procedures were pproved y the Cornell University Institutionl Animl Cre nd Use Committee. Rts were housed individully in polycronte cges contining cornco edding in holding room mintined t 20 C nd 60 70% humidity. The room ws lighted from 21:00 to 09:00 h. Rts were fed diets tht contined crystlline mino cids insted of protein. The compositions of the experimentl diets, which vried in methionine nd cystine levels, re shownintle1. Diets were prepred y Dyets Inc. (Bethlehem, PA, USA). Sulfur mino cid levels were sed on previous rt studies tht demonstrted tht 2.3 g methionine is dequte to meet the solute requirement of growing rts for methionine (i.e., the requirement for methionine when cyst(e)ine is not limited in the diet) [29, 30]. For diet preprtion, the powdered diets were mixed with n equl volume (1 L/kg diet) of hot gr solution (3 g/l), nd the mixture ws cooled t room temperture, refrigerted, nd cut into cues for feeding. All rts were fed complete mino cid-sed diet () for 1 week for cclimtion purposes prior to experimentl group ssignment. At the end of the dpttion week, rts were rndomly ssigned to four experimentl groups, which were fed the complete mino cid-sed diet (), n mino cidsed diet tht contined 0.11% l-methionine nd 0.35% l- cystine (/0.35% C), diet tht contined 0.23% l- methionine ut no cystine (), or diet tht contined 0.11% l-methionine ut no cystine (). Experimentl diets were fed for one week, with fresh diet eing given t the eginning of the drk cycle ech dy. Feed intke nd ody weights were mesured dily.

3 Journl of Amino Acids 3 Tle 1: Composition of experimentl diets. Control / 0.35% C / 0.35% C 0.23% M 0.11% M Ingredient g/kg diet L-Amino cid mix L-Methionine L-Cystine Cornstrch Dextrinized corn strch Sucrose Cellulose Soyen oil tert-butylhydroquinone Minerl mix Vitmin mix Choline itrtrte Sodium icronte Methionine equivlents, g/kg M: L-methionine, C: L-cystine. L-mino cid mix (g/kg): L-rginine 6.3, L-histidine 4.5, L-tyrosine 9.2, L- phenyllnine 8.7, L-leucine 15.3, L-Isoleucine 8.4, L-vline 9.9, glycine 3.1, L-proline 20.4, L-glutmic cid 36.2, L-lnine 4.5, L-sprtic cid 11.3, L- serine 9.4, L-lysine-HCl 16.1, L-threonine 6.6, nd L-tryptophn 2.1. Sodium icronte ws dded to neutrlize lysine-hcl. Methionine equivlents = g L-methionine + (g L-cyst(e)ine 149/120). At the end of the dietry tretment period (i.e., etween 13:00 nd 14:00 h on dy 8), rts were nesthetized with CO 2, nd liver ws rpidly removed, rinsed with ice-cold sline, nd frozen in liquid nitrogen. Frozen tissue ws stored t 80 Cuntilnlyseswereperformed Mesurement of Heptic Nonprotein Bound Thiol Levels. Nonprotein-ound intrcellulr cyst(e)ine levels were mesured y the modified cid ninhydrin method of Gitonde [31] s descried y Dominy et l. [32] fter reduction of disulfides with dithiothreitol. Nonprotein-ound intrcellulr glutthione levels were mesured y the HPLC method of Cereser et l. [33] fter reduction of tissue cid superntnts with NBH Anlysis of 4EBP1, rps6, nd eif2α Protein Levels nd Phosphoryltion Stte nd eif4e Protein Level. Rt liver smples were homogenized in TNES uffer with mmmlin protese inhiitor cocktil (Sigm), PhosStop phosphtse inhiitor cocktil (Roche Applied Sciences), nd 50 mm NF to give 20% (w/v) homogente. Homogentes were centrifuged t 18,000 g for20mint4 C,ndtheproteinconcentrtion of the solule frction ws determined using the BCA protein ssy (Thermo Scientific). Fifty microgrms of protein per lne ws resolved y SDS-PAGE nd trnsferred onto PVDF memrne (Millipore Corp.). Memrnes were immunolotted using ntiodies to 4EBP1, riosoml protein S6 (rps6), rps6-p (Ser 240/244 ), eif2α, eif2α-p (Ser 51 ), eif4e, nd ctin (ll from Cell Signling, Dnvers, MA, USA). Visuliztion of nds ws ccomplished either using horserdish peroxidse-coupled secondry ntiodies (1 : 25,000 dilution in 5% (w/v) dry ft-free milk in 1 TBST) nd chemiluminescent sustrtes (West Dur, Pierce) with exposure to utordiogrphy film or using IRDye-leled secondry ntiody (1 : 15,000) in Odyssey locking uffer plus 0.1% Tween-20 nd 0.01% SDS (Li-Cor Biosciences, Lincoln, NE, USA). Film imges were digitized nd nlyzed using NIH Imge 1.63 softwre, nd Odyssey imges were nlyzed using Li-Cor Odyssey V3.0 softwre. Bnd intensities were normlized ginst corresponding nds for β-ctin Anlysis of 4EBP1 nd eif4e mrna Levels. RNA ws isolted using the RNesy Mini Kit ccording to the mnufcturer s directions (Qigen). Complementry DNA ws reverse trnscried using Applied Biosystems High Cpcity cdna kit (Applied Biosystems) nd quntified using Power Syr Green (Applied Biosystems) in conjunction with Roche 480 Lightcycler (Roche Dignostics). Primers for 4EBP1 mrna were forwrd (5-3 ) GATGAGCCTCCC- ATGCAG nd reverse (5-3 ) CCATCTCAAACTGTG- ACTCTTCA. Primers for eif4e mrna were forwrd (5-3 ) GCAATATGGACGACTGAATGTG nd reverse (5-3 ) GTGTCTGCGTGG GACTGATA. Vlues for mrna were normlized to vlues for tuulin Sttisticl Anlysis. Results were nlyzed y one-wy ANOVA, nd post hoc tests were done y Tukey s procedure. Due to unequl vrince, dt for rps6 nd 4EBP1 were trnsformed to squre roots prior to sttisticl nlysis. Differences were ccepted s significntly different t P Results 3.1. Body Weight nd Feed Intke. Rts fed ny of the three mino cid deficient diets (/0.35% C,, 0.11% M) exhiited lower feed intke (Tle 2) swellslower ody weight (Figure 1) compred to control rts fed the complete diet. Rts fed diets contining /0.35% C,, nd consumed 60%, 53%, nd 62%, respectively, s much diet s control rts. Notly, feed intke of these three sulfur mino cid deficient groups ws similr despite the differences in dietry sulfur mino cid deficiency. Rts fed the sulfur mino cid deficient diets lost weight over the 7-dy feeding period, wheres rts fedthecompleteminociddietginednvergeof6.9 ± 0.2 g per dy. Weight loss for the vrious sulfur mino cid deficient groups prlleled the mgnitude of the sulfur mino cid deficiency (Tle 2) Liver Weights. In solute weight, liver ws 67%, 57%, nd 51% of control for the /0.35% M,, nd groups, respectively (dt not shown). When

4 4 Journl of Amino Acids Tle 2: Weight chnge nd feed intke of rts fed diets differing in sulfur mino cid content. Dietry group Control /0.35% C Men weight chnge (g/d) 6.9 ± ± ± 1.1 c 4.3 ± 0.9 c Men feed intke (g/d) 19.3 ± 11.6 ± ± ± 0.7 Feed intke (% of control group) 100 ± 2 60 ± 3 53 ± 6 62 ± 4 Met equivlents consumed (g/dy) ± ± ± c ± d Met equivlents consumed (% of control group) 100 ± 2 49 ± 1 18 ± 2 c 10 ± 2 d Vlues re mens ± SEM for 4 rts. Vlues within row not followed y the sme superscript letter re significntly different t P 0.05 y ANOVA nd Tukey s comprison. Body weight (g) Dys on tretment diet /0.35% C Figure 1: Effects of feeding diets differing in sulfur mino cid levels on ody weight of rts. Vlues re mens ± SEM for 4 rts. djusted for ody weight, the liver weights were not significntly different (P > 0.05) mong groups lthough they still tended to decrese with the degree of sulfur mino cid deficiency (94%, 84%, nd 78% of control for the 0.11% M/0.35% M,, nd groups, resp.) Heptic Cysteine nd Glutthione. As shown in Figure 2, heptic thiol levels were mrkedly lower for rts fed the mino cid deficient diets thn for rts fed the control diet. Heptic totl cysteine levels decresed in stepwise fshion with ech decrese in sulfur mino cid content of the diet, with rts fed the /0.35% C diet hving 71%, rts fed the 0.23% M diet hving 52%, nd rts fed the diet hving 38% of control cysteine level. Chnges in heptic totl glutthione levels tended to prllel totl cysteine levels, eing 69%, 25%, nd 18% of control, respectively, for rts fed the 0.11% M/0.35% C,, nd diets Expression of Heptic 4EBP1 nd eif4e. Compred to control rts, oth heptic 4EBP1 mrna undnce nd heptic totl 4EBP1 protein undnce were 2- to 4-fold higher in rts fed the two most deficient diets ( nd ) (Figure 3). On the other hnd, the undnces of totl 4EBP1 protein nd of 4EBP1 mrna were not different from control in liver of rts fed the /0.35% C diet. Becuse n increse in 4EBP1 my hve little effect on trnsltion initition if the mount of eif4e chnges in similr direction, we lso mesured the undnce of eif4e. However, neither eif4e protein undnce nor mrna undnce ws ffected y dietry tretment (Figure 3) Phosphoryltion Stte of 4EBP1. The ctive, hypophosphorylted (lph nd et) forms of 4EBP1 were higher in liver of rts fed the two most deficient diets thn in liver of control rts, following trend similr to tht for totl 4EBP1 undnce (Figure 4). Neither the undnce of the hyperphosphorylted gmm form of 4EBP1 nor the rtio of gmm 4EBP1 to totl 4EBP1 differed mong the four groups (P > 0.05) mtorc1 nd eif2α Kinse Activtion. Although the filure to oserve difference in the proportion of totl 4EBP1 in the hyperphosphorylted form in rts fed dequte nd deficient diets suggests tht there ws no chnge in mtorc1 ctivity, it is possile tht the rtio of γ-4ebp1 to totl 4EBP1 ws impcted y the douling of totl 4EBP1 levels in rts fed the diets with or without cysteine. To further ssess mtorc1 ctivtion, we exmined the phosphoryltion stte of the rps6 (rtio of rps6-p to totl rps6) s nother indictor of mtorc1 ctivtion stte (Figure 5). The p70s6 kinse (S6K) is direct sustrte of mtorc1, nd rps6 is the trget of p70s6 kinse. The rtio of rps6-p to totl rps6 ws significntly lower thn control (P < 0.05) in liver of rts fed the /0.35% C nd diets ut not in liver of rts fed the diet, perhps due to the concurrent decrese in totl rps6 in rts fed the ltter diet. The mounts of rps6-p nd totl rps6 were significntly lower in liver of rts fed ll three of the mino cid deficient diets. Although the rtio of rps6-p to totl rps6 ws not significntly lower in the group thn in the control group, it ws similr to the rtios for the 0.11% M/0.35% C nd diet groups. Becuse mino cids cn lso signl vi ctivtion of GCN2 nd ecuse eif2α kinse ctivtion my e required for n increse in 4EBP1 expression, we lso mesured eif2α phosphoryltion. An increse in eif2α phosphoryltion ws

5 Journl of Amino Acids 5 40 nmol/mg protein c c nmol/mg protein c c Cysteine Glutthione /0.35% C () /0.35% C () Figure 2: Effects of feeding diets differing in sulfur mino cid levels on heptic nonprotein-ound cysteine nd glutthione levels. Vlues re mens ± SEM for 4 rts. Vlues represented y rs not leled with the sme letter re significntly different t P 0.05 y ANOVA nd Tukey s comprison. oserved only in liver of rts fed the diet. Surprisingly, rts fed the other mino cid deficient diets hd heptic eif2α-p to totl eif2α rtios tht were similr to or less thn those of control rts. 4. Discussion Rts given the control diet gined n verge of lmost 7 g per dy, ut those given the sulfur mino cid deficient diets did not even mintin their strting ody weights. Weight loss ws prtilly due to reduced feed intke, s estlished y follow-up comprison of rts fed the diet d liitumwithgrouppir-fedthecontroldietfor7dys.in the follow-up study (dt not reported), pir-fed rts gined 1.3 ± 0.2 g per dy, wheres rts given free ccess to the diet lost 4.6 ± 0.3 gperdy(comprletothe 4.3 ± 0.9 gperdylostythe0.11%mgroupinthemin study). Feed intke ws similr in the three sulfur mino cid deficient groups, so the contriution of reduced feed intke ws presumly similr for ll three groups. Lck of dequte sulfur mino cids, however, contriuted to weight loss in stepwise mnner, with weight loss eing gretest in those with the lowest intkes. The indequcy of dietry sulfur mino cids ws lso reflected in the reduced heptic cysteine nd glutthione levels, which lso exhiited stepwise decrese tht followed the mgnitude of the deficit. The effects of dietry sulfur mino cid level on growth of young rts is consistent with erlier studies demonstrting tht diet must provide pproximtely 5 g methionine equivlents per kg diet, with t lesthlfofthispresentsmethionine,inordertosupport dequte sulfur mino cid sttus nd mximl growth of Sprgue Dwley rts during their 6th to 8th weeks [27, 29, 30]. The control diet essentilly met this requirement, ut the other diets were low either in totl sulfur mino cids or in methionine. Totl heptic 4EBP1 mrna nd 4EBP1 protein undnceswereothelevtedinliverofrtsfedthe0.23%m or diet ut not in rts fed the /0.35% C diet, despite ll three groups hving similrly reduced feed intkes compred to the control group. This suggests tht essentil mino cid deficiency, not just low feed intke, is necessry for induction of 4EBP1 expression in liver of intct rts. Other oservtions in our lortory strengthen this conclusion. Rts fed protein-free diet hd nerly 60% higher (P 0.05) heptic4ebp1levelsswells 200%higher(P 0.05) levelof4ebp1mrnathn rts fed control 20% soy protein diet. Rts deprived of food for 60 h, on the other hnd, exhiited low levels of 4EBP1 mrna (45% of control, P 0.05) nd of 4EBP1 protein (39% of control, P 0.05) (Siklidis, Mzor nd Stipnuk, unreported oservtions). Furthermore, dditionl nlyses of liver of rts fed 10% soy protein with 0.34% l- methionine (control) or without supplementl methionine (deficient) [27] demonstrted roust induction of heptic 4EBP1 mrna nd 4EBP1 protein levels in the sulfur mino cid-deficient group fed the unsupplemented diet (to 3.4- nd 2.4-times control levels, resp.); in this study the sulfur mino cid-deficient rts consumed 83% s much feed nd gined 35% s much weight s did the control rts over the 7-dy tretment period. Thus, the upregultion of 4EBP1 expression in liver of rts ppers to occur in response to mild s well s severe deficiencies of dietry sulfur mino cids s long s the rts re consuming t lest hlf s much feed s control

6 6 Journl of Amino Acids 4EBP1 Actin c c Totl 4EBP1 4EBP1 mrna eif4e Actin eif4e eif4e mrna /0.35% C /0.35% C Figure 3: Effects of feeding diets differing in sulfur mino cid levels on the undnce of 4EBP1 nd eif4e protein nd mrna in liver of rts. Vlues re mens ± SEM for 4 rts. Vlues represented y rs not leled with the sme letter re significntly different t P 0.05 y ANOVA nd Tukey s comprison. Representtive western lots re shown; these were run y loding equl mounts of totl solule protein per lne with the order of smples eing the sme s forthe r grphs. Protein vlues were normlized yβ-ctin, wheres mrna undnces were normlized to tuulin. rts (Siklidis nd Stipnuk, unreported dt). In the cse of strvtion or lck of source of exogenous energy, it is likely tht mino cid concentrtions in liver increse due to incresed rekdown of muscle protein, which is consistent with our oservtion of higher cysteine nd glutthione levels in liver of strved rts thn control rts. Interestingly, we did not see chnges in totl 4EBP1 in gstrocnemius muscle of rts fed protein-free diet or in those deprived

7 Journl of Amino Acids 7 γ-4ebp1 β- 4EBP1 α- 4EBP1 Actin γ4ebp c c Rtio (α+β)4ebp1 γ4ebp1/totl 4EBP1 /0.35% C /0.35% C Figure 4: Effects of feeding diets differing in sulfur mino cid levels on the 4EBP1 phosphoryltion sttus in liver of rts. Vlues re mens ± SEM for 4 rts. Vlues represented y rs not leled with the sme letter re significntly different t P 0.05 y ANOVA nd Tukey s comprison; vlues for γ4ebp1/totl 4EBP1 were trnsformed to squre roots prior to sttisticl nlysis. A representtive western lot is shown; equl mounts of totl solule protein were loded per lne with the order of smples, eing the sme s for the r grphs. A higher percentge of polycrylmide nd longer run time were used for electrophoresis to otin etter seprtion of the nds thn for the western lots shown in Figure 3. Themountsofα4EBP1, β4ebp1 nd γ4ebp1 were normlized y ctin. The rtio of γ4ebp1 to totl 4EBP1 is the rtioofthedensityoftheγ4ebp1 nd to the sum of the densities for ll three 4EBP1 nds. of feed lthough oth showed drmtic decrese in 4EBP1 hyperphosphoryltion. This suggests tht the regultion of 4Ep1 gene expression my occur in tissue-specific mnner. Severe deficiencies of sulfur mino cids (i.e., intkes g Met equivlents per dy) were lwys ssocited with elevted heptic levels of oth totl nd hypophosphorylted 4EBP1, except in the cse of strvtion. The degree of sulfur mino cid deficiency reltive to totl feed (or energy) deficiency seems to ply role; however, modest deficiencies ppered to hve greter effect when totl feed (energy) intke ws more dequte (i.e., rts fed 10% soy protein diet in our previous study with feed intke equivlent to 83% of control nd Met equivlent intke of g/dy exhiited elevted heptic 4EBP1, wheres rts fed the 0.11% M/0.35% C diet with feed intke equivlent to 60% of control nd Met equivlent intke of Met equivlents per dy did not exhiit chnge in heptic 4EBP1 expression). The pprent interction etween sulfur mino cid intke nd

8 8 Journl of Amino Acids Reltive rtio Phospho rps6 Totl rps6 rps6-p/totl rps Reltive rtio c c Phospho eif2 α Totl eif2 α eif2 α-p/totl eif2 α /0.35% C /0.35% C /0.35% C Figure 5: Effects of feeding diets differing in sulfur mino cid levels on rps6 phosphoryltion sttus nd eif1α phosphoryltion sttus in liver of rts. Vlues re mens ± SEM for 4 rts. Vlues represented y rs not leled with the sme letter re significntly different t P 0.05 y ANOVA nd Tukey s comprison; vlues for phospho-eif2α nd eif2αp/totl eif2α were trnsformed to squre roots prior to sttisticl nlysis. Representtive western lots re shown; equl mounts of totl solule protein were loded per lne with the order of smples the sme s for the r grphs. The mounts of the indicted proteins were normlized y ctin. To void the dependence of rtios on exposure times with the different ntiodies, rps6-p/totl rps6 rtios nd eif2α-p/totl eif2α rtios were clculted s reltive rtios fter first expressing densities s fold of the control group. totl feed (energy) intke might e explined y greter muscle proteolysis in the rts with the lower feed intkes. However, dditionl studies will e needed to confirm this hypothesis. It is resonle to conclude tht the increse in 4EBP1 oserved in liver of rts fed sulfur mino cid deficient diets would contriute to the suppression of cp-dependent mrna trnsltion/protein synthesis. The undnces of eif4e mrna nd eif4e protein in liver of rts fed the sulfur mino cid deficient diets were not different from those in liver of control nimls, indicting tht there ws no compenstory increse in eif4e expression to offset the increse in 4EBP1 expression in rts fed diets severely restricted in sulfur mino cids. Assessment of chnges in the undnce of the hypophosphorylted forms of 4EBP1, the forms tht re ctive in inding eif4e, indicted tht higher levels of totl 4EBP1 expression were ssocited with higher undnce of the lph plus et forms of 4EBP1. Thus, these results suggest tht diets limited in essentil mino cids (t lest, sulfur mino cids) my elevte mounts of totl 4EBP1, which could in turn reduce cp-dependent protein synthesis. Although we did not mesure the ssocition of eif4e with either 4EBP1 or eif4g in this study, numerous studies with nimls hve shown tht n increse in the undnce of the ctive forms of 4EBP1 is ccompnied y incresed ssocition of eif4e with 4EBP1 nd decresed ssocition of eif4e with eif4g to form the trnsltionlly ctive eif4f complex [34 38]. In this study, the hyperphosphoryltion of 4EBP1, which is dependent upon mtorc1, ws not ffected y the different diets. Neither the reltive undnce of gmm 4EBP1 nor the rtio of gmm 4EBP1 to totl 4EBP1 ws different mong the four diet groups. This seems to indicte tht mtorc1 ctivity ws not suppressed in liver of rts fed the sulfur mino cid deficient diets, despite their lower feed (energy) intke nd lower essentil mino cid intke. Using phosphoryltion of rps6 s nother mesure of mtorc1 ctivity stte, the rtio of phosphorylted rps6 to totl rps6 ws lower in rts fed the sulfur mino cid deficient diets, suggesting tht mtorc1 ctivity ws reduced in rts with lower energy nd sulfur

9 Journl of Amino Acids 9 mino cid intkes. Other reports hve lso shown tht the mgnitude of incresed phosphoryltion of rps6 ws much higher thn tht of 4EBP1 in response to heptic mtorc1 ctivtion such tht it my e more difficult to oserve decrese in 4EBP1 phosphoryltion, leding to less gmm 4EBP1, thn to oserve decrese in rps6 phosphoryltion y rps6 kinse [39, 40]. Nevertheless, the overll outcome ws clerly greter undnce of the hypophosphorylted forms of 4EBP1 (i.e., lph + et 4EBP1) in liver of rts fed diets severely limiting in sulfur mino cids. The upregultion of 4EBP1 protein ws tightly ssocited with upregultion of 4EBP1 mrna undnce. Becuse cell culture studies hve suggested tht 4EBP1 expression my e upregulted y GCN2-eIF2α-ATF4 mechnism [23, 26] nd ecuse the role of ATF4 in 4Ep1 gene trnscription hs een clerly estlished in MIN6 cells [6], we ssessed the phosphoryltion of eif2α. In contrst to the close ssocitions oserved erlier etween eif2α phosphoryltion nd levels of ATF4, ATF3, ASNS, SLC7A11, CARS, nd CTH protein undnce in liver of rts fed diets limited in sulfur mino cids [27],wedidnotoserveconsistent ssocition of eif2α phosphoryltion with incresed 4EBP1 protein levels. Although oth eif2α phosphoryltion nd totl 4EBP1 expression were upregulted in liver of rts fed the diet compred to the /0.35% C diet, 4EBP1 expression ut not eif2α phosphoryltion ws upregulted in liver of rts fed the diet. These results might e explined y differences in the time courses of eif2α phosphoryltion in liver of rts fed the two diets; rts fed the diet my hve een le to dpt more dequtely such tht eif2α phosphoryltion ws reduced y 7 dys. Other investigtors hve reported tht eif2α phosphoryltion nd increses in ATF4 undnce tend to pek prior to pek expression of the downstrem stress response proteins [6, 41 43]. Another possiility is tht pthwy not involving eif2α phosphoryltion cn induce 4Ep1 gene expression. In this regrd, methionyltrna synthetse, which dds methionine to oth inititor nd elongtor trna Met,hseenshowntoesustrtefor GCN2, t lest under some conditions, nd phosphoryltion of methionyl-trna synthetse y GCN2 prevents inding of trna to the enzyme, reducing the minocyltion of oth inititor nd elongtor trna Met [44, 45]. Further work will e required to elucidte whether increses in heptic totl 4EBP1 expression in response to sulfur mino cid-limited diets is independent, or prtilly independent, of eif2α phosphoryltion sttus. Interestingly, GCN2 phosphoryltion of either eif2α or methionyl-trna synthetse would negtively impct ternry/preinitition complex formtion. Whether or not 4EBP1 expression would e incresed in response to deficiencies of essentil mino cids other thn sulfur mino cids ws not ddressed in this work, ut studies performed in cell culture systems suggest tht this would e the cse [26]. Deficiencies of ny essentil mino cid re knowntoctivtegcn2 skinsectivitylthoughresponses to prticulr mino cids tend to vry with cell type [11, 26, 46, 47]. Using HepG2 cells, Plii et l. [26] showedthtremovl of ny single essentil mino cid from the medium resulted in n increse in totl 4EBP1 undnce ut vrile increses in eif2α phosphoryltion or ATF4 undnce, suggesting likely crosstlk mong signling pthwys tht re not ll impcted similrly y lck of prticulr essentil mino cid. Even eif2α phosphoryltion nd ATF4 undnce were poorly correlted, with leucine nd threonine deficiency yielding the higher degrees of eif2α phosphoryltion ut vline nd methionine yielding the highest levels of ATF4 undnce [26]. It is possile tht methionine deficiency couldhvesomeuniqueeffecteyondthosemeditedy GCN2, perhps vi reduced vilility of chrged inititor trna Met s discussed ove. 5. Conclusions Results reported here for heptic 4EBP1 expression in rts fed sulfur mino cid deficient diets further support physiologicl role for chnges in 4EBP1 expression in the response of nimls to deficiency of essentil mino cids. In oth this study nd the previous study in intct rts, higher totl 4EBP1 undnce ws not ssocited with n increse in the proportion of the 4EBP1 in the hyperphosphorylted, inctive form. Thus, chnges in heptic 4EBP1 expression led to prllel chnges in the undnce of the ctive, hypophosphorylted forms of 4EBP1 ville to ind eif4e nd lock cp-dependent trnsltion initition. It seems likely tht elevted levels of 4EBP1 re involved in regultion of heptic protein synthesis under conditions of severe limittions of one or more essentil mino cids in the fce of only modest limittions of energy nd other nutrients. Induction of 4EBP1 expression in liver of rts fed diets severely limited in sulfur mino cids did not pper to require sustined eif2α phosphoryltion, lthough we cnnot rule out contriution of eif2α phosphoryltion to 4EBP1induction.Despitesimilrlevelsoftotl4EBP1inliver of rts fed the nd diets, the undnce of 4EBP1 mrna ws higher in liver of rts fed the 0.11% M diet, which lso hd elevted levels of phosphorylted eif2α, thn in liver of rts fed the diet, which did not hve elevted levels of phosphorylted eif2α. We re currently undertking studies in cell culture models to ddress how sulfur mino cid deficiency is sensed nd wht signling pthwys re involved in incresed expression of 4EBP1. Regrdless of the underlying mino cid sensing nd signling mechnisms, it is nevertheless cler from this study tht chnges in totl 4EBP1 expression should e considered when exmining mechnisms tht ttenute protein synthesis during mino cid deficiency sttes. Acknowledgments This project ws supported y Grnts DK nd DK from the Ntionl Institute of Dietes nd DigestivendKidneyDiseses.K.M.Mzorwssupportedy T32DK007158, Ntionl Institute of Dietes, Digestive nd Kidney Diseses. H. Liu ws supported y Zhejing University, Hngzhou, Chin. The content is solely the responsiility of the uthors.

10 10 Journl of Amino Acids References [1] O. Le Bcquer, E. Petroulkis, S. Pglilung et l., Elevted sensitivity to diet-induced oesity nd insulin resistnce in mice lcking 4E-BP1 nd 4E-BP2, Journl of Clinicl Investigtion, vol. 117, no. 2, pp , [2] Y. Mrtineu, R. Azr, C. Bousquet, nd S. Pyronnet S, Antioncogenic potentil of the eif4e-inding proteins, Oncogene, vol. 32, no. 6, pp , [3] G. Armengol, F. Rojo, J. Cstellví et l., 4E-inding protein 1: key moleculr funnel fctor in humn cncer with clinicl implictions, Cncer Reserch, vol. 67, no. 16, pp , [4] Nsr,F.Roert,J.A.PorcoJr.,W.J.Muller,ndJ.Pelletier, eif4f suppression in rest cncer ffects mintennce nd progression, Oncogene,vol.32,no.7,pp ,2012. [5] Y.Shi,S.I.Tylor,S.-L.Tn,ndN.Sonenerg, Whentrnsltion meets metolism: multiple links to dietes, Endocrine Reviews,vol.24,no.1,pp ,2003. [6]S.Ymguchi,H.Ishihr,T.Ymdetl., ATF4-medited induction of 4E-BP1 contriutes to pncretic β cell survivl under endoplsmic reticulum stress, Cell Metolism, vol. 7, no. 3, pp , [7]B.M.Zid,A.N.Rogers,S.D.Ktewetl., 4E-BPextends lifespn upon dietry restriction y enhncing mitochondril ctivity in Drosophil, Cell,vol.139,no.1,pp ,2009. [8] M. Holcik nd N. Sonenerg, Trnsltionl control in stress nd poptosis, Nture Reviews Moleculr Cell Biology, vol. 6, no. 4, pp , [9] H.P.Hrding,I.Novo,Y.Zhngetl., Regultedtrnsltion initition controls stress-induced gene expression in mmmlin cells, Moleculr Cell, vol. 6, no. 5, pp , [10] J.-I. Lee, J. E. Dominy Jr., A. K. Siklidis, L. L. Hirscherger, W. Wng, nd M. H. Stipnuk, HepG2/C3A cells respond to cysteine deprivtion y induction of the mino cid deprivtion/integrted stress response pthwy, Physiologicl Genomics,vol.33,no.2,pp ,2008. [11] A. K. Siklidis, J.-I. Lee, nd M. H. Stipnuk, Gene expression nd integrted stress response in HepG2/C3A cells cultured in mino cid deficient medium, Amino Acids, vol. 41, no. 1, pp , [12] J.Shn,M.-C.Lopez,H.V.Bker,ndM.S.Kilerg, Expression profiling fter ctivtion of mino cid deprivtion response in HepG2 humn heptom cells, Physiologicl Genomics,vol.41, no. 3, pp , [13] A.-C. Gingrs, B. Rught, S. P. Gygi et l., Hierrchicl phosphoryltion of the trnsltion inhiitor 4E-BP1, Genes nd Development,vol.15,no.21,pp ,2001. [14] C. C. Thoreen, L. Chntrnupong, H. R. Keys, T. Wng, N. S. Gry, nd D. M. Stini, A unifying model for mtorc1- medited regultion of mrna trnsltion, Nture,vol.485,no. 7396, pp , [15] I.Mothe-Stney,D.Yng,P.Fdden,T.A.J.Hysted,ndJ.C. Lwrence Jr., Multiple mechnisms control phosphoryltion of PHAS-I in five (S/T)P sites tht govern trnsltionl repression, Moleculr nd Cellulr Biology, vol. 20, no. 10, pp , [16] X. Wng, A. Beugnet, M. Murkmi, S. Ymnk, nd C. G. Proud, Distinct signling events downstrem of mtor cooperte to medite the effects of mino cids nd insulin on initition fctor 4E-inding proteins, Moleculr nd Cellulr Biology, vol. 25, no. 7, pp , [17] K. Tsukiym-Kohr, F. Poulin, M. Kohr et l., Adipose tissue reduction in mice lcking the trnsltionl inhiitor 4E- BP1, Nture Medicine, vol. 7, no. 10, pp , [18] K.Tsukiym-Kohr,S.M.Vidl,A.-C.Gingrsetl., Tissue distriution, genomic structure, nd chromosome mpping of mouse nd humn eukryotic initition fctor 4E-inding proteins 1 nd 2, Genomics,vol.38,no.3,pp ,1996. [19] F. Poulin, A.-C. Gingrs, H. Olsen, S. Chevlier, nd N. Sonenerg, 4E-BP3, new memer of the eukryotic initition fctor 4E-inding protein fmily, JournlofBiologiclChemistry,vol. 273, no. 22, pp , [20] C. C. Chen, J. C. Lee, nd M. C. Chng, 4E-BP3 regultes eif4e-medited nucler mrna export nd intercts with repliction protein A2, FEBS Letters,vol.586,no.16,pp , [21] R.Azr,A.Alrd,C.Susini,C.Bousquet,ndS.Pyronnet, 4E- BP1 is trget of Smd4 essentil for TGFΒ-medited inhiition of cell prolifertion, The EMBO Journl, vol.28,no.22,pp , [22] B. S. Blkumrn, A. Porrello, D. S. Hsu et l., MYC ctivity mitigtes response to rpmycin in prostte cncer through eukryotic initition fctor 4E-inding protein 1-medited inhiition of utophgy, Cncer Reserch, vol. 69, no. 19, pp , [23] P. D. Lu, C. Jousse, S. J. Mrcinik et l., Cytoprotection y preemptive conditionl phosphoryltion of trnsltion initition fctor 2, The EMBO Journl, vol. 23, no. 1, pp , [24] M. Rolli-Derkinderen, F. Mchvoine, J. M. Brn, A. Grolleu,L.Berett,ndM.Dy, ERKndp38inhiittheexpression of 4E-BP1 repressor of trnsltion through induction of Egr-1, Journl of Biologicl Chemistry,vol.278,no.21,pp , [25] R. Azr, S. Nji, H. Lhlou, C. Susini, nd S. Pyronnet, Phosphtidylinositol 3-kinse-dependent trnscriptionl silencing of the trnsltionl repressor 4E-BP1, Cellulr nd Moleculr Life Sciences,vol.65,no.19,pp ,2008. [26] S. S. Plii, C. E. Kys, C. Devl, A. Bruht, P. Ffournoux, nd M. S. Kilerg, Specificity of mino cid regulted gene expression: nlysis of genes sujected to either complete or single mino cid deprivtion, Amino Acids,vol.37, no.1,pp.79 88, [27] A. K. Siklidis nd M. H. Stipnuk, Growing rts respond to sulfur mino cid-deficient diet y phosphoryltion of the α suunit of eukryotic initition fctor 2 heterotrimeric complex nd induction of dptive components of the integrted stress response, The Journl of Nutrition,vol.140,no.6,pp , [28] M. S. Kilerg, J. Shn, nd N. Su, ATF4-dependent trnscription medites signling of mino cid limittion, Trends in Endocrinology nd Metolism,vol.20,no.9,pp ,2009. [29] P. J. Bgley nd M. H. Stipnuk, Rts fed low protein diet supplemented with sulfur mino cids hve incresed cysteine dioxygense ctivity nd incresed turine production in heptocytes, The Journl of Nutrition,vol.125,no.4,pp , [30] Y. Hosokw, S. Niizeki, H. Tojo, I. Sto, nd K. Ymguchi, Heptic cysteine dioxygense ctivity nd sulfur mino cid metolism in rts: possile indictors in the evlution of protein qulity, The Journl of Nutrition, vol. 118, no. 4, pp , [31] M. K. Gitonde Jr., A spectrophotometric method for the direct determintion of cysteine in the presence of other nturlly occurring mino cids, Biochemicl Journl,vol.104,no.2,pp , 1967.

11 Journl of Amino Acids 11 [32] J.E.DominyJr.,J.Hwng,ndM.H.Stipnuk, Overexpression of cysteine dioxygense reduces intrcellulr cysteine nd glutthione pools in HepG2/C3A cells, Americn Journl of Physiology. Endocrinology nd Metolism, vol.293,no.1,pp. E62 E69, [33] C. Cereser, J. Guichrd, J. Dri et l., Quntittion of reduced nd totl glutthione t the femtomole level y high-performnce liquid chromtogrphy with fluorescence detection: ppliction to red lood cells nd cultured firolsts, Journl of Chromtogrphy B,vol.752,no.1,pp ,2001. [34] T. A. Gutsch, J. C. Anthony, S. R. Kimll, G. L. Pul, D. K. Lymn, nd L. S. Jefferson, Avilility of eif4e regultes skeletl muscle protein synthesis during recovery from exercise, Americn Journl of Physiology. Cell Physiology, vol. 274, no. 2, pp. C406 C414, [35] S. R. Kimll, R. L. Horetsky, nd L. S. Jefferson, Impliction of eif2b rther thn eif4e in the regultion of glol protein synthesis y mino cids in L6 myolsts, Journl of Biologicl Chemistry,vol.273,no.47,pp ,1998. [36] M. Blge, S. Sinud, M. Prod Homme et l., Amino cids nd insulin re oth required to regulte ssemly of the eif4e eif4g complex in rt skeletl muscle, Americn Journl of Physiology. Endocrinology nd Metolism,vol.281,no.3,pp. E565 E574, [37] J. Escor, J. W. Frnk, A. Surywn, H. V. Nguyen, nd T. A. Dvis, Amino cid vilility nd ge ffect the leucine stimultion of protein synthesis nd eif4f formtion in muscle, Americn Journl of Physiology. Endocrinology nd Metolism, vol. 293, no. 6, pp. E1615 E1621, [38] A. Surywn, R. M. Torrzz, M. C. Gzzneo et l., Enterl leucine supplementtion increses protein synthesis in skeletl nd crdic muscles nd viscerl tissues of neontl pigs through mtorc1-dependent pthwys, Peditric Reserch, vol.71,no.4,pp ,2012. [39] T. Mtsumur, Y. Moring, S. Fujitni, K. Tkehn, S. Nishitni, nd I. Sonk, Orl dministrtion of rnched-chin mino cids ctivtes the mtor signl in cirrhotic rt liver, Heptology Reserch,vol.33,no.1,pp.27 32,2005. [40] S. R. Kimll, R. A. Orelln, P. M. J. O Connor et l., Endotoxin induces differentil regultion of mtor-dependent signling in skeletl muscle nd liver of neontl pigs, Americn Journl of Physiology. Endocrinology nd Metolism, vol. 285, no. 3, pp. E637 E644, [41] I. Novo, Y. Zhng, H. Zeng, R. Jungreis, H. P. Hrding, nd D. Ron, Stress-induced gene expression requires progrmmed recovery from trnsltionl repression, The EMBO Journl, vol. 22,no.5,pp ,2003. [42] H. Chen, Y.-X. Pn, E. E. Dudenhusen, nd M. S. Kilerg, Amino cid deprivtion induces the trnscription rte of the humn sprgine synthetse gene through timed progrm of expression nd promoter inding of nutrient-responsive sic region/leucine zipper trnscription fctors s well s loclized histone cetyltion, JournlofBiologiclChemistry,vol.279,no. 49, pp , [43] Z. Mounir, J. L. Krishnmoorthy, S. Wng et l., Akt determines cell fte through inhiition of the PERK-eIF2α phosphoryltion pthwy, Science Signling, vol. 4, no. 192, rticle r62, [44] N. H. Kwon, T. Kng, J. Y. Lee et l., Dul role of methionyltrna synthetse in the regultion of trnsltion nd tumor suppressor ctivity of minocyl-trna synthetse-intercting multifunctionl protein-3, Proceedings of the Ntionl Acdemy of Sciences of the United Sttes of Americ, vol. 108, no. 49, pp , [45] J. R. Murguí nd R. Serrno, New functions of protein kinse Gcn2 in yest nd mmmls, IUBMB Life, vol.64,no.12,pp , [46] V. Crrro, A.-C. Murin, S. Lmert-Lnglis et l., Amino cid vilility controls TRB3 trnscription in liver through the GCN2/EIF2/ATF4 pthwy, PLoS One, vol.5,no.12, Article ID e15716, [47] J.Shn,M.-C.Lopez,H.V.Bker,ndM.S.Kilerg, Expression profiling fter ctivtion of mino cid deprivtion response in HepG2 humn heptom cells, Physiologicl Genomics, vol. 41, no.3,pp ,2010.

12 Interntionl Journl of Peptides BioMed Reserch Interntionl Advnces in Stem Cells Interntionl Virolog y Interntionl Journl of Genomics Journl of Nucleic Acids Zoology Interntionl Journl of Sumit your mnuscripts t The Scientific World Journl Journl of Signl Trnsduction Genetics Reserch Interntionl Antomy Reserch Interntionl Enzyme Reserch Arche Biochemistry Reserch Interntionl Interntionl Journl of Microiology Interntionl Journl of Evolutionry Biology Moleculr Biology Interntionl Advnces in Bioinformtics Journl of Mrine Biology