Supplementary figure legends

Transcription

1 Supplementary figure legends SUPPLEMENTRY FIGURE S1. Lentiviral construct. Schematic representation of the PCR fragment encompassing the genomic locus of mir-33a that was introduced in the lentiviral construct. SUPPLEMENTRY FIGURE S2. Reporter gene constructs. Schematic representation of the PCR product inserted in the reporter constructs for. human BC1, B. human CROT, C. human HDHB, D. human CPT1, E. Drosophila melanogaster CPTI, F. human TP8B1, G. NPC1 and H. SLC2525. Numbers denote the nucleotide position in GRCh37/hg19 human and BDGP R5/dm3 drosophila genome assembly. Feathered lines denote introns, and black boxes the PCR product, the mir-33 binding site or the open reading frame (ORF) as indicated. SUPPLEMENTRY FIGURE S3. mir-33b is localized in the SREBP1 gene. Schematic representation of the human SREBP1 locus with embedded mir-33b sequence including evolutionary conservation of the latter. SUPPLEMENTRY FIGURE S4. The binding site for mir-33 in BC1 is highly conserved and consists of tandem repetitions of seed-binding sites.. Evolutionary conservation of the predicted mir- 33 binding site in the 3 UTR of BC1. Light grey indicates possibility of classical Watson-Crick pairing with mir-33 and dark grey indicates GU pairs. B. The predicted mir-33 binding site in the 3 UTR of BC1 contains three tandem repeats of a sequence perfectly complementary to mir-33 (circled). The most favorable annealing is depicted. Since mutagenesis of one, two or three of these repeats might lead to alternative site usage in a potentially suboptimal annealing, which does not allow any conclusions about normal seed binding, we decided to mutagenize all three seed sequences in parallel. SUPPLEMENTRY FIGURE S5. mir-33 targets BC1 and HDHB in mouse adrenocortical cancer cell line Y1. Western Blot analysis of Y1 mouse adrenocortical cancer cell lines engineered to overexpress mir-33a. Note that the HDHB antibody crossreacts with a band around 45kDa in mouse samples. The band that corresponds to the size of human HDHB is marked with an arrow. SUPPLEMENTRY FIGURE S6. Conservation of mir-33 binding site in HDHB 3 UTR. Evolutionary conservation of the predicted mir-33 binding site in the 3 UTR of HDHB. Light grey shading indicates a residue that can undergo a classical Watson-Crick pair with mir-33 while dark grey shading indicates GU pairs. SUPPLEMENTRY FIGURE S7. Conservation of mir-33 binding site in CPT1 3 UTR.. and B. Predicted binding of mir-33a and mir-33b to the () unconserved and (B) conserved mir-33 binding site in the CPT1 3 UTR. C. lignment of the conserved mir-33 binding site in Drosophila and Ciona intestinalis CPT1 gene. D. Predicted seed binding region in the 3 UTR of Xenopus tropicalis CPT1. Shading represents the same as in Figure 5 SUPPLEMENTRY FIGURE S8. Conservation of mir-33 binding site in CROT 3 UTR. Evolutionary conservation of the predicted mir-33 binding site in the 3 UTR of CROT. B. and C. Predicted binding of mir-33b (B) shows two additional Watson-Crick pairs than binding to mir-33a (C). D. Evolutionary conservation of second mir-33 binding site in CROT 3 UTR. Shading represents the same as in Figure 5. SUPPLEMENTRY FIGURE S9. The splice variant carrying the predicted mir-33 binding site is dominant.. Schematic representation of the CPT1 alternative transcripts affecting the 3 UTR B. 1

2 bsolute Ct values of quantitative RT PCR for transcripts with or without the mir-33 binding site in different human organs SUPPLEMENTRY FIGURE S10. mir-33 potentially targets additional genes involved in lipid metabolism.. D. Evolutionary conservation of predicted binding sites in the 3 UTR of NPC1 ( and B), TP8B1 (C) and SLC2525 (D). Formating is identical to Figure 7. E. and F. Reporter assays to assess influence of premir-33 on the indicated 3 UTRs cloned downstream of a constitutively active firefly luciferase cassette in the pgl3-control plasmid. Experimental setup and presentation is identical to Figure 2B. SUPPLEMENTRY FIGURE S11. TLC analysis of cellular lipids. Representative Thin layer chromatography scan used to quantify cellular lipids after staining with Primulin and scanning using a fluorescence scanner. SUPPLEMENTRY FIGURE S12. Influence of culture conditions and mouse diet on mir-33 levels.. mir-33 levels are increased upon culture at high cell density and in medium containing lipid free FCS. B. Northern Blot analysis of mice fed with high fat diet or control chow for 16 weeks starting at age 4 weeks. s a positive control, HepG2 overexpressing mir-33a were used. Hybridization to mir-33a LN probe and for U6 RN are shown. C. Northern Blot analysis of mice fed with high fat diet or control chow for 16 weeks starting at age 8 weeks as in (B) D. Northern Blot analysis of mice on chow diet, after 16h and 39h of starvation or refeeding for 12h. SUPPLEMENTRY FIGURE S13. Tissue distribution of mir-33a. Equal amounts (10µg) of mouse tissue total RN were analyzed by northern blot for expression of mir-33a and U6. Position of mature mir-33a and premir-33a are indicated. Ethidium Bromide staining of polyacrylamide gels is shown to demonstrate equal loading. HepG2 cell transduced with a control lentivirus (HepG2 GIPZ) and a lentivirus driving mir-33a (HepG2 mir-33a) were loaded to show the expression level of mir-33a in overexpression experiments. Please note that the HepG2 mir-33a sample on the second gel is from the same gel and exposure as the remainder of this northern blot. 2

3 Chromosome 22: 1 kb SREBF2 Exon mir-33a PCR product Exon Supplemental Figure S1

4 Chromosome 9: kb PCR product seed 1 seed 2 seed 3 BC1 ORF 3 UTR B Chromosome 7: 500 bases PCR site1 site2 CROT ORF 3 UTR C Chromosome 2: 200 bases PCR site HDHB ORF 3 UTR D 1 kb Chromosome 11: PCR unconserved Supplemental Figure S2 -D conserved C-terminal splice variants CPT1

5 E Drosophila Chromosome 2R bases PCR site CPTI ORF 3 UTR F 1 kb Chromosome 18: PCR site 2 site 1 TP8B1 ORF 3 UTR G Chromosome 18: bases PCR site NPC1 ORF 3 UTR H 1 kb Chromosome 9: SLC PCR site ORF 3 UTR Supplemental Figure S2 E-H

6 chr17: SREBP-1 mir-33b Homo sapiens GUGCUUGCUGUUGCUUG Macaca mulatta GUGCUUGCUGUUGCUUG Pan troglodytes GUGCUUGCUGUUGCUUG Canis familiaris GUGCUUGCUGUUGCUUG Xenopus tropicalis GUGCUUGUUGUUGCUUG Tetraodon nigricans GUGCUUGUGUUGCUUG Supplemental Figure S3

7 B 3 CGUUCGUUGUCGUUCGUG 5 mir-33b 3 CGUUCGUUGUGUUCGUG 5 mir-33a : _ UUCUGCUGCUU-CUGC Homo sapiens (BC1 3 UTR) UUCUGCUGCCUU-CUGC Mus musculus (BC1 3 UTR) UUCUGCUGCCUU-CUGC Rattus norvegicus (BC1 3 UTR) UUCUGCUGCUU-CUGC Canis familiaris (BC1 3 UTR) CUCUGCUGCU-CUGC Gallus gallus (BC1 3 UTR) CCCUGCU-CUGC Danio rerio (BC1 3 UTR) GCUUCUGCG-GCUGC Tetraodon nigroviridis (BC1 3 UTR) CUCUGCUGCU-CUGC Xenopus tropicalis (BC1 3 UTR) U C U U U C U G C U G C U U C G U U C G U U G U C U G C U G C G U U C G U G Supplementary Figure S4

8 control mir-33a BC1 HDHB HDH CTIN Supplemental Figure S5

9 3 CGUUCGUUGUCGUUCGUG 5 mir-33b 3 CGUUCGUUGUGUUCGUG 5 mir-33a _ : _ : UCCCUGGCUGCCUUUCUGCU Homo sapiens (HDHB 3 UTR) UUGCCUGGGCUGCCUUUCUGCC Mus musculus (HDHB 3 UTR) UCGCCUGGGCUGCCUUUCUGCC Rattus norvegicus (HDHB 3 UTR) UCGCCUGGCUGCCUUCCUGCU Canis familiaris (HDHB 3 UTR) CUGUGCCUGGCUGCCUUUCUGCC Gallus gallus (HDHB 3 UTR) Supplemental Figure S6

10 B C 3 CGUUCGUUGUC-GUUCGUG 5 mir-33b 3'CGUUCGUUGU-GUUCGUG 5 mir-33a :: : GUCUCUUCGUUUUUGC Homo sapiens (CPT1 3 UTR) (conserved only in primates) 3 CGUUCGUUGUC-GUUCGUG 5 mir-33b 3'CGUUCGUUGU-GUUCGUG 5 mir-33a : :: : CUCGUGCGUUUCUGC Homo sapiens (CPT1 3 UTR) CUCCUGGCGUUCCUGC Mus musculus (CPT1 3 UTR) CUCCUGGCGUUCCUGC Rattus norvegicus (CPT1 3 UTR) CCGUGCGUUUCUGC Canis familiaris (CPT1 3 UTR) CUUGUGCGUUUCUGC Gallus gallus (CPT1 3 UTR) 3'CGUUCGCUGUGUUCGUG 5 Drosophila melanogaster mir-33 CUCUGC Drosophila melanogaster CUCUGC Drosophila simulans CUCUGC Drosophila sechellia CUUCUGC Drosophila yakuba CUCUGC Drosophila erecta GCCUGC Drosophila ananassae CUGCUGC Drosophila pseudo-obscura CUGCUGC Drosophila persimilis CUGC Drosophila willistoni UGGCUGC Drosophila virilis UGGCUGC Drosophila grimshawi UGCUGC Drosophila mojavensis UCUGC Ciona intestinalis (Ciona intestinalis sequence is derived from chr14q: 522, ,669 (assembly Mar (JGI 2.1/ci2)) unconserved site conserved site D Xenopus tropicalis CPT1 3 UTR (scaffold_1374:1,500-1,520; assembly JGI 4.1/xenTro2) 3 CGUUCGCUGUCGUUCGUG 5 mir-33b (Xenopus) 3 CGUUCGCUGUGUUCGUG 5 mir-33a : 5 GTTCTGTCCCTGCT 3 CPT1 3 UTR Xenopus Supplemental Figure S7

11 B C D 3 CGUUCGUUGUCGUUCGUG 5 mirn33b 3'CGUUCGUUGUGUUCGUG 5 mirn33a -:: : -: UCCUCUGUGCGCGCUGC Homo sapiens (CROT) UCCUGUGUUGCCCCUGC Mus musculus (CROT) UUCUGUGUUGCCGCUGC Rattus norvegicus (CROT) UCCUCUGUGCGUGCGUGCG Canis familiaris (CROT) UGGCCUUUGCCGCUGCG Gallus gallus (CROT) 3 CGUUCGUUGUCGUUCGUG 5 mirn33b :: : UCCUCUGUGCGCGCUGC Homo sapiens (CROT) 3'CGUUCGUUGUGUUCGUG 5 mirn33a -:: : _: UCCUCUGUGCGCGCUGC Homo sapiens (CROT) 3 CGUUCGUUGUCGUUCGUG 5 mirn33b 3'CGUUCGUUGUGUUCGUG 5 mirn33a _ UCUC-CUUUCUGC Homo sapiens (CROT) UGUUUU-GCCUCCUGCC Rattus norvegicus (CROT) UCUCU-UUUUUUGC Canis familiaris (CROT) conserved site unconserved site Supplemental Figure S8

12 2 kb SITE 2 SITE 1 CPT1 CPT1 CPT1 Sus CPT1 I I L Rattus Cpt1a Equus CPT1 Mus Cpt1a Ovis CPT1 Xenopus cpt1a Gallus CPT1 Danio LOC BE D BG variant 1 variant 2 variant 3 pig rat horse mouse sheep frog chicken zebrafish human ESTs human other species Rhesus Mouse Dog Elephant Opossum Chicken X_tropicalis Zebrafish rs SINE LINE LTR DN Simple Low Complexity evolutionary conservation SNPs genomic repeats B variant 2 variant 1 difference in Ct Brain Colon Heart Kidney Liver Lung Spleen Testis Thymus Supplemental Figure S9

13 3 CGUUCGUUGUCGUUCGUG 5 mir-33b 3 CGUUCGUUGUGUUCGUG 5 mir-33a : CUCUGUGGCCU--CUGCC Homo sapiens (NPC1-3 UTR) CUUUUUGGCCU--CUGC Canis familiaris (NPC1-3 UTR) UUUUUUGCGGU--CUGC Gallus gallus (NPC1-3 UTR) UUUUGCUGCCU--CUGCC Xenopus tropicalis(npc1-3 UTR) (not conserved in rodents) B 3 CGUUCGUUGUCGUUCGUG 5 mir-33b 3 CGUUCGUUGUGUUCGUG 5 mir-33a : UGUUUGGCUUUUUUGC Homo sapiens (NPC1-3 UTR) UGUUUGGCUUUUUUGC Mus musculus (NPC1-3 UTR) UGUUUGGCUUUUUUGC Rattus norvegicus (NPC1-3 UTR) UGUUUGGCUUUUUUGC Canis familiaris (NPC1-3 UTR) UGUUCUCUCUUUGC Gallus gallus (NPC1-3 UTR) C D 3 CGUUCGUUGUCGUUCGUG 5 mir-33b 3'CGUUCGUUGU-GUUCGUG 5 mir-33a : : : UGGGGUUGCUGC Homo sapiens (TP8B1 3 UTR) UGGGGGGUUGGCUGC Mus musculus (TP8B1 3 UTR) CGGGGGGUUGCUGC Rattus norvegicus (TP8B1 3 UTR) 3 CGUUCGUUGUC-GUUCGUG 5 mir-33b 3'CGUUCGUUGU-GUUCGUG 5 mir-33a : CUGGUGCGUCUGC Homo sapiens (SLC UTR) CGGUGCGUCUGC Mus musculus (SLC UTR) UGGUGCGUCUGC Rattus norvegicus (SLC UTR) UGGUGCGUCUGC Canis familiaris (SLC UTR) E F Relative luciferase activity control control mir-33 * SLC2525 NPC1 Supplemental Figure S10 * Relative luciferase activity * control PT8B1 control mir-33

14 Triacylglycerol Free fatty acids Cholesterol Phospholipids control mir-33a HepG2 Supplemental Figure S11

15 HepG2 mir-33a Normal serum sparse dense Delipidized serum sparse dense mir-33a U6 B HepG2 mir-33a Control High Fat diet diet HepG2 control mir-33a U6 C HepG2 mir-33a Control High Fat diet diet HepG2 control mir-33a U6 D HepG2 mir-33a chow diet 15h fasting 39h fasting refed HepG2 control mir-33a U6 Supplemental figure S12

16 Supplemental Figure S13 B HepG2 mir-33a brain stem brain cortex heart testis lung spleen stomach HepG2 HepG2 mir-33a muscle kidney brown adipose tissue gonadal white adipose tissue liver large intestine small intestine HepG2 pre-mir-33 mature mir-33 U6 Ethidium Bromide pre-mir-33 mature mir-33 U6 Ethidium Bromide