Neuroligin-1 dependent competition regulates cortical synaptogenesis and synapse number

Transcription

1 Neuroligin- epenent ompetition regultes ortil synptogenesis n synpse numer Hyung-Be Kwon,3, Yevgeni Kozorovitskiy, Won-Jong Oh 2, Rui T Peixoto, Nzi Akhtr, Jessi L Sulnier, Chenghu Gu 2 & Bernro L Stini npg 22 Nture Ameri, In. All rights reserve. Memers of the neuroligin fmily of ell-hesion proteins re foun t exittory n inhiitory synpses n re mutte in some fmilil forms of utism spetrum isorers. Although they isply synptogeni properties in heterologous systems, the funtion of neuroligins in vivo in the regultion of synpse formtion n synpse numer hs een iffiult to estlish. We foun tht neuroligin- (NL), whih is lote t exittory postsynpti ensities, regultes tivity-epenent synptogenesis n mture synpse numer on ortil lyer 2/3 pyrmil neurons in vivo. However, synpse numer ws not sensitive to solute NL levels ut inste epene on trnsellulr ifferenes in the reltive mounts of NL. These effets were inepenent of the ell-utonomous regultion of NMDA-type glutmte reeptors y solute levels of NL. Our t inite tht trnsellulr ompetitive proesses govern synpse formtion n numer in eveloping ortex n tht NL hs entrl funtion in these proesses. Neoortil evelopment progresses through stges of synptogenesis n synpse refinement tht estlish ell-to-ell onnetivity n network topology,2. During erly evelopment, intrinsilly generte ptterne tivity helps estlish the orret onnetivity etween n in rin regions 3,4. During lter evelopment, perturtions of sensory experiene of the niml lter onnetivity in sensory orties, initing tht the tivity-epenent ontrol of synptogenesis shpes postntl evelopment 7. In ition, moleulr ues, inluing grients of signling moleules n interellulr ellhesion omplexes, regulte mny spets of iruit n ellulr evelopment 8. Thus, postntl evelopment of ererl ortex is governe y tivity-epenent n tivity-inepenent mehnisms tht regulte synpti onnetivity. Trns-synpti ell-hesion moleules, whih re present t synpses n meite trnsellulr n intrellulr signls, regulte oth tivity-epenent n tivity-inepenent synpti mturtion uring evelopment 9,,2,3. The neuroligin fmily of proteins, whih onsists of synptilly lolize ell-hesion moleules tht re expresse in evelopmentlly regulte mnner, hs een propose to regulte mny spets of synpti trnsmission n evelopment 4,. Four neuroligins hve een ientifie in mie, n loliztion of eh fmily memer vries 6 8. For exmple, NL is preominntly postsynpti t exittory synpses 4 n ins to presynpti neurexins, n intertion tht is thought to t fter initil synpse formtion to regulte synpse mturtion 9. In ontrst, NL2 is foun preominntly t inhiitory synpti terminls n regultes ssemly of GABAergi synpses 2. The importne of neuroligin-epenent signling to humn rin evelopment is highlighte y the fining of muttions in neuroligins n neurexins in fmilies with geneti forms of utism Defining the funtions of NL in synpse evelopment n seprting its trnsellulr versus ell-utonomous ontriutions hs een iffiult. Up- n ownregultion of NL inreses n ereses, respetively, synpti urrents meite y NMDA-type glutmte reeptors (NMDARs) 9,24 26 (ut see ref. ). However, whether the numer n struture of exittory synpses re regulte y NL remins unler, n results from stuies of vrious preprtions re in onflit. NL expresse in non-neuronl ells ttrts xons n inues formtion of ruimentry presynpti outons 27, suggesting tht NL is intrinsilly synptogeni. In ulture neurons, the numer of glutmtergi synpses inreses with overexpression of NL (refs. 9,28 34) n ereses with knokown of NL with RNA interferene (RNAi) 29. On the other hn, espite perintl lethl phenotype n perturtions of synpti trnsmission in respirtory nulei, neurons from NL, NL2 n NL3 triple knokout mie hve norml numer of synpses n norml synpti ultrstruture. Similrly, loss of NL in hippompus or mygl hs een reporte to not lter synpse numer,24,2. Thus, stuies of ulture neurons whose NL levels hve een mnipulte ex vivo inite tht NL regultes synpse numer n spine morphology, wheres nlyses in vivo or of tissue utely prepre from knokout nimls hve not supporte this onlusion. A possile explntion for these onfliting results is tht ifferenes in tivity ptterns etween neurons in ulture n in vivo my revel or msk the effets of NL mnipultion, hypothesis tht is onsistent with the epenene of the synpti effets of NL overexpression on tivity levels in ulture neurons 9. Alterntively, Howr Hughes Meil Institute, Deprtment of Neuroiology, Hrvr Meil Shool, Boston, Msshusetts, USA. 2 Deprtment of Neuroiology, Hrvr Meil Shool, Boston, Msshusetts, USA. 3 Present ress: Mx Plnk Flori Institute, Jupiter, Flori, USA. Corresponene shoul e resse to B.L.S. (stini@hms.hrvr.eu). Reeive Septemer; epte Otoer; pulishe online Novemer 22; oi:.38/nn.326 nture NEUROSCIENCE VOLUME NUMBER 2 DECEMBER

2 npg 22 Nture Ameri, In. All rights reserve. ifferenes my rise s result of the timing of the mnipultion, the rin region exmine or the frtion of neurons tht re ffete. To etermine whether NL regultes the formtion, morphology n funtion of exittory synpses in vivo, we exmine ortil lyer 2/3 pyrmil neurons whose levels of NL h een up- or ownregulte from the time of neuronl irth. Synpse struture n funtion in tissue in whih ll neurons lke NL ws ompre with tht in genetilly mosi tissue in whih NL levels vrie from ell to ell. Anlysis in ute rin slies revele tht erly postntl efets in NMDARs were triggere y oth glol n sprse loss of NL. Conversely, NL-epenent hnges in synpse numer n tivity-epenent synptogenesis were revele only when ifferenes in NL levels existe ross neurons. For this reson, the effets of NL knokown or overexpression were ifferent in wil-type, NL heterozygote n NL null mie. Thus, trnsellulr ifferenes in NL levels uring evelopment, ut not the solute levels of NL in iniviul ells, regulte tivity-epenent synptogenesis n etermine the mture struture n funtion of ortil neurons. RESULTS Moultion of synpse numer y sprse knokown of NL To etermine whether postsynpti NL levels regulte synpse evelopment in vivo, we inue RNAi to knokown NL in ortil NL NL-GFP E. #4 #7 GAPDH e. g Amplitue (pa) + humn NL µm + humn NL Spine ensity (µm ) Eletroportion V, ms, pulses.. 3 +hnl Frequeny (Hz) 2 #8 + #9 + humn NL ms NL 2 µm µm #7 No virus Vetor ontrol GAPDH GAPDH f. 2 pa +hnl h Amplitue (pa) + + µm + Frequeny (Hz) neurons using in utero eletroportion. Eletroportion t emryoni stge., when progenitors for lyer 2/3 ortil neurons re essile, resulte in sprse trnsfetion (up to ~2%) of lyer 2/3 pyrmil neurons while llowing neurons to evelop in vivo uner lrgely norml network tivity n onnetivity (Fig. ). Plsmis enoing smll-hirpin RNAs (shrna) with sequene homology to mouse Nlgn were esigne n purhse (Online Methos). Construts were teste in vitro for knokown of n NL- EGFP fusion protein in HEK293 ells (Fig. n Supplementry Fig. ). The most effetive onstrut, #7, ws use for the mjority of susequent experiments n we refer to it s. This onstrut ws effetive in neurons, s trnsution of issoite ortil ultures with lentiviruses enoing the plsmi strongly reue enogenous NL levels (Fig. n Supplementry Fig. ). Reution of NL expression i not sustntilly lter levels of the fmily memers NL2 n NL3 (Fig. n Supplementry Fig. ). Exmintion of enriti spines of expressing neurons in ute slies prepre from postntl y 7 2 in utero eletroporte mie revele tht spine length n he re were inrese n spine ensity ws reue ompre with ontrol EGFP-trnsfete neurons (,. ±.6 spines per µm; ontrol,.9 ±.4 spines per µm; 7 neurons, 2 27 enrites, P <.; Fig. e n Supplementry Fig. 2). Co-trnsfetion of n NLGN (humn NL), whih ontins sequene ltertions in the region trgete y, suppresse the effets of NL knokown (.93 ±. spines per µm, neurons, 22 enrites, P >. versus ontrol; Fig. e n Supplementry Fig. 2), initing µm Lyer 2/3 pyrmil neurons, p2 Spine ensity (µm ) 3 2 NL2 NL3.. ms #7 Vetor ontrol No virus 2 pa + + tht spine hnges in expressing neurons were the result of loss of NL. Similr morphologil hnges were oserve in iolistilly trnsfete hippompl CA pyrmil neurons in orgnotypi slie ultures (Supplementry Fig. 3). Figure Sprse knokown of NL, ut not glol knokout, reues synpse numer n spine ensity in ortil lyer 2/3 pyrmil neurons. () Left, shemti of the in utero eletroportion metho use to trnsfet neoortil lyer 2/3 pyrmil neurons in vivo. Right, low- n high-mgnifition imges of n ute slie showing EGFP expression in lyer 2/3 pyrmil neurons. () Western lot nlysis of knokown effiieny in n NL-GFP trnsfete HEK293T ells. (,) Western lot nlysis of enogenous NL, NL2 n NL3 expression in issoite ortil ultures trnsue with lentivirus enoing #7 or lentivirus rrying ontrol vetor ompre with tht in uninfete ontrols. (e) Top, exmples n summry of spine ensity in lyer 2/3 pyrmil neurons in ute rin slies expressing EGFP (ontrol), #7 (), or n humn NL. Bottom, representtive mepscs n their verge mplitue n frequeny for neurons of eh inite genotype. (f) Exmples n summry of spine ensity (top) n mepscs (ottom) in ute rin slies of, Nlgn / n Nlgn / neurons trnsfete with. P <. versus ontrol. Error rs represent s.e.m. 668 VOLUME NUMBER 2 DECEMBER 22 nture NEUROSCIENCE

3 npg 22 Nture Ameri, In. All rights reserve. e NMDAR uepscs (pa) f +4 mv C 2+ AMPAR uepscs (pa) µm 6 mv humn NL S D 3 2 ms % G/G st ms + humn NL % G/G st 7 pa ms ms AMPAR uepsc ( 6 mv) + humn NL pa ms + humn NL + CPP AMPAR AMPAR AMPAR AMPAR uepscs (pa) uepscs (pa) uepscs (pa) uepscs (pa) NMDAR uepscs (pa) NMDAR:AMPAR rtio Spine C 2+ Denrite C 2+ + humn NL The frequeny of miniture exittory postsynpti urrents (mepscs) in NL knokown neurons mesure y whole-ell voltge-lmp ws reue without signifint effet on their mplitue (mplitue:, 7.4 ±.4 pa, n = 8; ontrol, 8.36 ±.4 pa, n = ; P >.; frequeny:,.82 ±.2 Hz, n = 8; ontrol,.4 ±.7 Hz, n = ; P <.; Fig. e). These effets were prevente y o-trnsfetion of NLGN (mplitue, 8.7 ±.42 pa; frequeny,.8 ±.2 Hz; n =, P >. versus ontrol; Fig. e), onfirming the NL epenene of the effets on synpse numer. Nevertheless, similr effets were not oserve in lyer 2/3 pyrmil neurons of Nlgn / mie, whih h no spine morphology or ensity hnges ompre to those in wil-type nimls (,.9 ±. spines per µm, 9 neurons, 9 enrites; Nlgn /,.88 ±. spines per µm, neurons, 22 enrites; P >.; Fig. f n Supplementry Fig. 2). Notly, introution of into Nlgn / neurons h no effet on the struture n ensity of spines (Nlgn / +,.87 ±. spines per µm, neurons, 9 enrites, P >. versus ; Fig. e n Supplementry Fig. 2), onfirming tht the effets of in wil-type nimls were result of the loss of NL n not of possile off-trget effets of the shrna. Similrly, no hnges in mepsc mplitue n frequeny were oserve (frequeny:,.3 ±.6 Hz, n = 8; Nlgn /,.28 ±.3, n = 9; Nlgn / +,.3 ±., n = 8; mplitue:, 9. ±. Hz, n = 8; Nlgn /, 8.8 ±.7, n = 9; Nlgn / +, 8.7 ±.3, n = 9; Fig. f). Thus, reution of NL levels in sprse suset of ortil neurons lters synpse numer, wheres glol knokout of the gene hs no effet. Notly, oth sets of experiments were rrie out in the sme ell type n in the sme in vivo ontext. 2.. Spine C 2+ (% G/G st ) NMDAR uepsc (+4 mv) 2 + CPP Figure 2 NL moultes NMDAR-meite urrents n C 2+ signling t iniviul postsynpti terminls. () Left, imge of spine n enrite fille with 2 µm Alex-94 n 3 µm Fluo-F showing the lotion of the glutmte unging spot (rrowhe) n the orienttion of the line sn (she line). Right, time ourse of fluoresent trnsients mesure in the line sn interseting the spine (S) n enrite (D) following glutmte unging t the time inite y the rrowhe. Inrese green fluoresene inites C 2+ entry. () Left, quntifition of the green fluoresene trnsient in the spine n neighoring enrite t 6 mv. Right, AMPAR- n NMDAR-meite uepscs t 6 n +4 mv, respetively. The re otte line (7 ms fter unging pulse) inites the time t whih the mplitue of NMDAR uepscs ws mesure. () Averge uepscs t 6 mv n +4 mv for neurons of the inite genotypes n from NLGN-trnsfete neurons in the presene of CPP (re tre). () Averge C 2+ trnsients in spines (lrger tres) n enrites (smller tres) for neurons of the inite genotypes 6 mv. (e) Distriutions of AMPAR n NMDAR uepscs mplitues for eh spine in eh genotype. (f) Summry of (left to right) AMPAR uepsc mplitue, NMDAR uepsc mplitue, NMDAR-to-AMPAR uepsc mplitue rtio, n spine C 2+ re shown. P <. versus ontrol. Error rs represent s.e.m. NL moultes NMDAR-meite urrents n C 2+ influx A possile mehnism for NL-epenent moultion of synpse numer is y ownregultion of NMDARs, whih regulte synpse struture n funtion vi vriety of mehnisms n whose tivtion triggers tivity-epenent synptogenesis in eveloping lyer 2/3 pyrmil neurons 3. To etermine whether the funtionl properties of iniviul postsynpti terminls re ifferentilly ffete y sprse versus glol mnipultions of NL, we use glutmte unging to exmine AMPA reeptor (AMPAR)- n NMDARmeite urrents n C 2+ influx (Fig. 2 n Supplementry Fig. 4). Whole-ell reorings were otine from lyer 2/3 pyrmil neurons using intrellulr solutions ontining Alex Fluor 94 (2 µm) to visulize morphology n C 2+ initor, Fluo-F (3 µm), to monitor intrellulr C 2+. MNI-glutmte ( mm) in the extrellulr solution ws photolyse to relese glutmte y twophoton exittion with.-ms-long 72-nm lser pulses (Fig. 2). To improve voltge lmp n monitor single terminl AMPAR n NMDAR signls, we loke voltge-gte K +, N + n C 2+ hnnels with oktil of ntgonists (Online Methos). Unging glutmte ner visulize spine eliite unging-evoke AMPAR n NMDAR EPSCs (AMPAR uepscs n NMDAR uepscs) tht were mesure y holing ells t 6 n +4 mv, respetively (Fig. 2). Simultneous mesurement of green fluoresene ws use to monitor C 2+ trnsients in the tive spine n neighoring enrite t 6 mv. Uner these onitions C 2+ enters the spine through NMDARs, whih re not fully loke y extrellulr Mg 2+ (refs. 36,37). Voltge-lmp reorings from trnsfete neurons i not revel signifint ifferenes in AMPAR uepscs ompre with ontrol (, 4. ±.6 pa, n = 2; ontrol, 4.2 ±.7, n = 2; P >.; Fig. 2,f). At these sme postsynpti terminls, however, NMDAR uepscs (,. ±.8 pa, n = 2; ontrol, 3.7 ±.8 pa, n = 2; P <.) n C 2+ trnsients ( G/G st :, 4. ±.6%, n = 2; ontrol, 7.6 ±.%, n = 2; P <.) were smller in expressing neurons (Fig. 2 f), onsistent with reue NMDAR ontent in iniviul spines. Both NMDAR uepscs n C 2+ influx were restore or inrese eyon ontrol levels y oexpression of n humn NL (NMDAR uepscs, 8. ± 2.4 pa, n = 2, P >. versus ontrol; G/G st,.3 ±.4%, n = 2, P <.; Fig. 2 f). Similrly, lrger NMDAR uepscs n C 2+ trnsients were mesure from spines of ells expressing humn NL lone (NMDAR uepscs, 26. ± 2.7 pa, n = 2, P <.; G/G st, 9.9 ±.7%, n = 2, P <.; Fig. 2 f). This positive orreltion etween NL nture NEUROSCIENCE VOLUME NUMBER 2 DECEMBER

4 npg 22 Nture Ameri, In. All rights reserve. Figure 3 Constitutive NL knokout lowers NMDAR uepscs n C 2+ trnsients. (,) Averge AMPAR n NMDAR uepscs () n spine n enrite C 2+ trnsients t 6 mv () for neurons of the inite genotypes. () Reltionship etween AMPAR n NMDAR uepscs mesure in the inite genotypes. () Averge mplitues of AMPAR (left) n NMDAR (mile) uepscs n NMDAR:AMPAR urrent rtios (right). P <. versus wil type. Error rs represent s.e.m. levels n NMDAR-meite synpti signls suggests tht NL filittes inorportion or retention of NMDARs in the postsynpti terminl, onsistent with previous finings 3,33,38. The verge pek mplitue of uepscs mesure t 6 mv ws not moulte y NL levels, ut the uepsc ey ws slowe in humn NL (NLGN)-trnsfete neurons (Fig. 2). To etermine whether this prolongtion resulte from ltertions of AMPAR properties or whether it represente n unusul ontriution of NMDAR urrents t resting potentils, we repete reorings in the presene of the NMDAR ntgonist CPP ( µm). CPP pplition olishe the spine n enrite C 2+ signls, s well s the slow omponent of uepsc, onfirming tht they resulte from NMDAR tivtion (Fig. 2). Prllel nlyses were rrie out in Nlgn / mie (Fig. 3), in whih NMDAR/AMPAR urrent rtios hve een previously reporte to e reue in hippompl CA pyrmil neurons, mygl prinipl neurons n stritl meium spiny neurons 9,24,39. Consistent with these reports, we foun tht glutmte unging evoke AMPAR uepscs mesure from iniviul spines of lyer 2/3 pyrmil neurons were not ifferent etween Nlgn / n littermte mie, wheres NMDAR uepscs were signifintly smller in Nlgn / mie (AMPAR uepscs:,.7 ±.3 pa, n = 24; Nlgn /, 8.6 ±.2 pa, n = 2; P >.; NMDAR uepscs:, 9.9 ±.2 pa, n = 24; Nlgn /, 4. ±.8 pa, n = 2; P <.; Fig. 3,). NMDAR-meite spine C 2+ influx ws lso reue ( G/G st :, 8.8 ±.%, n = 24; Nlgn /,.2 ±.6 pa, n = 2; P <.; Fig. 3). Furthermore, introuing into Nlgn / neurons h no effet on NMDAR uepscs n C 2+ influx, initing tht, Glutmte unging Denrite Spine Suess rte (%) Before Humn NL (2) (3) (3) (22) (3) (3) (2) (3) () (23) (2) () () () (23) (24) (3) () 2 µm 3 pa 2 ms. Hz. Hz 2 Hz After. Hz. Hz 2 Hz e Amplitue (pa). Hz. Hz 2 Hz N.S. C 2+ NMDAR uepscs (pa) AMPAR uepscs (pa) +4 mv mv + 2% G/G st ms pa ms AMPAR uepscs (pa) AMPAR uepscs (pa) AMPAR uepscs (pa) NMDAR uepscs (pa) s expete for n NL-epenent phenomenon, meite effets were olue y onstitutive loss of NL (Nlgn / + : AMPAR uepscs,. ±.3 pa; NMDAR uepscs,.2 ±.6 pa; G/G st, 4.9 ±.%; n = 2, P >. for eh versus Nlgn / ; Fig. 3). Thus, the effets of NL loss on synpti NMDARs re similr in the glol knokout n RNAi-inue sprse knokown, initing tht the level of NL in eh ell intrinsilly regultes NMDAR signling ut not exittory synpse numer. NL levels moulte glutmte-inue spinogenesis Overexpression of NL in issoite neuronl ultures influenes synpse numer in n tivity-epenent mnner 9, suggesting tht NL regultes the seletion of synpses fter initil synpse formtion. To etermine whether NL lso regultes initil synpse formtion, we use glutmte unging protool tht triggere the rpi n e novo formtion of spine n the estlishment of new synpse (Fig. 4) 3. This proess requires Figure 4 NL regultes tivity-epenent spinogenesis. () Shemti of glutmte-inue spinogenesis. Denrites of EGFP-expressing ortil lyer 2/3 pyrmil neurons in ute slies from postntl y 8 2 (P8 2) mie were visulize with two-photon lser-snning mirosopy n glutmte (4 pulses) ws relese y photolysis of ge glutmte ner low-spine ensity setion of enrite. () Suess rte of e novo spine formtion in neurons in whih NL levels were reue or inrese. The numers of ttempts re shown in prentheses. P <. versus ontrol. () Representtive imges of ttempte spinogenesis experiments from wil-type neurons trnsfete with EGFP, or humn NL, n from n EGFP-trnsfete Nlgn / neuron. Yellow irles n lue rrowhes inite unging positions n, when pplile, nsent spines, respetively. (,e) Averge enriti NMDAR uepscs () n mplitues (e) reore t +4 mv in the presene of NBQX from P9 neurons of the inite genotypes. Glutmte ws relese. µm from the enriti shft. P <. versus wil type. N.S., P >.. Error rs represent s.e.m. NMDAR:AMPAR rtio VOLUME NUMBER 2 DECEMBER 22 nture neuroscience

5 Figure Spine ensity of Nlgn / neurons in vitro is ffete y presene of neighoring neurons. () Shemti of the o-ulture experiment. Nlgn / mie were in utero eletroporte to lel lyer 2/3 pyrmil neurons with EGFP. Dissoite ortil ultures were prepre from these mie n mixe with neurons of unlele wil-type mie t vrying rtios. () Representtive low- (left) n high-mgnifition (right) imges of neurons n spiny enrites. Sle rs for whole-ell (left) n enrite (right) imges in n represent 3 µm n µm, respetively. () Averge spine ensities in Nlgn / neurons mixe with neurons t ifferent rtios. P <. versus Nlgn /. N.S., P >.. Error rs represent s.e.m. + only Co-ulture ( + ) only Co-ulture ( :, :) npg 22 Nture Ameri, In. All rights reserve. tivtion of enriti NMDA reeptors, whih re perture y hnges in NL expression (see elow). In wil-type nimls, sprse knokown of NL in lyer 2/3 pyrmil neurons y RNAi lowere, wheres overexpression of NL inrese, the suess rte of new spine genertion (Fig. 4,). The mgnitue of the effets epene on the frequeny of stimultion suh tht NL overexpression enhne the low proility of spinogenesis seen with low-frequeny stimuli, wheres ownregultion of NL erese the high suess rte triggere y higher frequeny stimuli. In ontrst, the sme lss of neurons in Nlgn / mie isplye norml tivity-epenent spinogenesis. Furthermore, the norml synptogeneti potentil of neurons in Nlgn / mie ours espite ~% reution in enriti NMDAR urrents (NMDAR uepscs:,. ± 2. pa, n = ; Nlgn /,.9 ±.9 pa, n = ; P <.; Fig. 4,e), similr reution to tht seen in trnsfete neurons in wil-type nimls (4.7 ±.9 pa, n = 6, P >.; Fig. 4,e). Thus, sprse, ut not glol, mnipultions of NL moulte the threshol of tivity-epenent spinogenesis, likely explining the prllel oservtions in synpse n spine numer t lter evelopmentl stges. Exittory synpse numer is regulte y reltive levels of NL The finings tht synpse numer n struture re ltere in neurons with NL knokown, ut not in neurons with Nlgn /, my e expline y trnsellulr ompetitive mehnism 4,4. In this moel, ell expressing higher levels of NL reltive to its neighors hs n vntge in forming synpses. For exmple, eh Nlgn in situ Antisense 3 µm µm Co-ulture ( :, :) Sense Nlgn in situ, ortex Nlgn +DAPI Cx ortil neuron might ompete in n NL-epenent mnner with surrouning neurons to estlish proper onnetivity with limite numer of presynpti outons. If orret, this mehnism explins why mnipultions tht eliminte NL from ll neurons fil to repitulte the perturtions seen in genetilly mosi tissue. To test this moel, we performe o-ulture experiments in whih n Nlgn / neurons were mixe (Fig. ). We use in utero eletroportion to trnsfet EGFP into lyer 2/3 pyrmil neurons of Nlgn / mie. Cultures of ortil neurons were prepre y mixing, t speifi rtios, ells issoite from these mnipulte Nlgn / mie n ge-mthe wil-type mie (Fig. ). Consistent with the ompetition hypothesis, neurons in pure ultures of Nlgn / or ells h similr spine ensities (,.3 ±.3 spines per µm, 37 fiels of view; Nlgn /,. ±. spines per µm, 2 fiels of view; P >.; Fig. ). However, when Nlgn / ells were mixe : with neurons, spine ensity in the Nlgn / ells ws reue (.8 ±. spines per µm, 6 fiels of view, P <.; Fig.,). Spine ensity ws further reue when the rtio of Nlgn / to ells ws reue to : (.39 ±.4 spines per µm, 8 fiels of view, P <.; Fig. ). Thus, Pi the spine ensity of Nlgn / ortil lyer 2/3 pyrmil neurons in ulture epens ll-lll on the frtion of o-ulture neurons tht Spine ensity (µm ). N.S... : : only only : DAPI 2 µm Gph Nlgn Merge pi 2 µm µm St Cumultive proility.. µm µm... Nlgn:Gph mrna Figure 6 Vrile Nlgn mrna in ross ortil neurons. () Fluoresene ISH using n ntisense Nlgn rioproe (left) revele Nlgn mrna etetion in the ortex ompre with ontrol ISH with sense rioproe (right). () Nlgn mrna ws expresse roly (left; Cx, ortex; St, stritum). A high-mgnifition imge (right) of the ortex (otte ox) revele Nlgn mrna in ll ortil lyers. () Doule ISH etete Gph (left) n Nlgn (mile) in iniviul lyer 2/3 neurons (top). Representtive imges of neighoring neurons (rrowhes) showing ifferentil Nlgn mrna expression in spite of reltively onsistent Gph mrna levels (ottom). () Cumultive proility istriution of Nlgn:Gph ISH fluoresene rtios from ten sets (one per setion, three mie) of ten rnomly pike neighoring neurons (yellow irle in ). nture NEUROSCIENCE VOLUME NUMBER 2 DECEMBER 22 67

6 npg 22 Nture Ameri, In. All rights reserve. e g Spine ensity (% hnge) Spine ensity (µm ) 2 Wil type + ttomto express NL, initing tht trnsellulr intertions etermine synpse numer. These results were otine without use of RNAi, emonstrting ontext-epenent efets in synpse numers in neurons with onstitutive geneti loss of NL. Grients of NL levels exist n regulte spine numer To unerstn whether neuron-to-neuron vriility in NL expression in vivo oul support the ompetitive moel presente ove, we mesure mrna levels y fluoresene in situ hyriiztion (ISH) ross ortil neurons (Fig. 6). Nlgn mrna ws etete throughout ll ortil lyers without lyer-speifi expression (Fig. 6,). To etermine the egree of vrition of NL expression in ortil lyer 2/3, we performe two-olor fluoresene ISH of Nlgn n Gph (Fig. 6). Levels of enogenous Nlgn mrna expression lrgely vrie from ell to ell ompre with GAPDH (Fig. 6,), resulting in lrger oeffiient of vrition (GAPDH n NL: Gph, 26. ±.6%, n = fiels; Nlgn, 37.7 ± 4.3%, n = ; P <.). To iretly test in vivo whether trnsellulr grients of NL expression level regulte synpse numer, we exmine vriety of onitions in whih NL expression ws higher or lower in ell reltive to its neighors (Fig. 7 n Supplementry Fig. ). First, we exmine whether spine ensity is regulte in oseepenent mnner y NL. We took vntge of speifi, #9, whih prtilly reue NL levels (Fig. ). When trnsfete into neurons of wil-type nimls, #9 reue spine ensity only slightly (.7 ±.3 spines per µm, 27 enrites, f 2 pa ms E Nlgn +/ Wil type Nlgn +/ 3 2 N.S. + Eletroportion lentivirus Frequeny (Hz) P mepsc frequeny (% hnge) µm µm Amplitue (pa) Spine ensity (µm )... in mepsc frequeny (Hz) 2 pa s P <. versus wil type). In ontrst, #4, seon, very effiient shrna, gretly reue spine ensity (.4 ±.4 spines per µm, enrites, P <. versus wil type). Seon, if the mgnitue of trnsellulr grients in NL levels etermines the ensity of exittory synpses, then spine ensity in sprse suset of neurons tht overexpress NL in Nlgn / mie shoul e higher thn in neurons tht overexpress NL in wil-type mie. Inee, spine ensity in NLGN-trnsfete neurons in Nlgn / mie ws very high (.9 ±. spines per µm, neurons, 7 enrites; NLGN-trnsfete neurons in mie,.4 ±. spines per µm, neurons, 22 enrites; P <.; Fig. 7,). Inrese ensity of spines ws ompnie y inrese mepsc frequeny, initing tht more funtionl synpses h een me (NLGN in Nlgn /, 3.67 ±.3 Hz, n = 8; NLGN in, 2.9 ±.43 Hz, n = 6, P <.; Fig. 7,). Furthermore, ross mny mnipultions, the mgnitue of hnges in spine ensity n mepsc frequeny inue y mnipultions of NL epen on the NL ontent of neighoring neurons. The effets of NL knokown were reue in the Nlgn +/ hemizygote mie n were ompletely sent in Nlgn / mie (perent hnge in spine ensity:, 42 ± 6%; Nlgn +/, 3 ± 3%; Nlgn /, ± % ompre with the mthe kgroun; perent hnge in mepsc frequeny:, 8 ± 2%, n = 8; Nlgn +/, 27 ± 2%, n = 8; Nlgn /, ± %, n = 9; Fig. 7,). Conversely, the effets of overexpression of NL were more notle when NL levels were reue in neighoring ells (perent hnge in spine ensity: humn NL in, 47 ± %; humn NL in Nlgn +/, 68 ± 6%; humn NL in Nlgn /, 2 ± 9% ompre with the mthe kgroun; perent hnge in mepsc frequeny: humn NL in, 79 ± 43%, n = 6; humn NL in Nlgn +/, ± 3%, n = ; humn NL in Nlgn /, 87 ± 28%, n = 8; Fig. 7,). The hnges in spine ensity n synpse numer seen with perturtion of NL levels were Figure 7 Reltive levels of NL etermine spine numer in vivo vi interellulr intertions. () Representtive NLGN-trnsfete neuron in n Nlgn / mouse showing spines n mepscs. () Averge spine ensity n mepsc frequeny from humn NL expressing neurons in Nlgn / mie. The gry oxes inite the vlues men ± s.e.m. in ontrol neurons. (,) Spine ensity n mepsc frequeny were ifferently ffete y mnipulting NL levels up (humn NL) or own () epening on the levels of NL in the surrouning neurons. (e) Shemti of the experimentl esign. Mie were in utero eletroporte with humn NL + ttomto, followe y injetion of enoing lentivirus into ortex t P. (f) Left, representtive imges of spines from lyer 2/3 pyrmil neurons infete with lentivirus (top), neighoring ontrols (mile) or eletroporte with humn NL + ttomto (ottom). Right, representtive mepscs for the sme three neuronl lsses. Sle rs represent 2 µm, 2 pa n s. (g) Averge spine ensity, mepsc frequeny n mplitue in, ontrol n hnl neurons nlyze in the sme slies. Error rs represent s.e.m. P <. on post ho multiple omprison tests reltive to ontrol. N.S., P >.. Error rs represent s.e.m. 672 VOLUME NUMBER 2 DECEMBER 22 nture neuroscience

7 npg 22 Nture Ameri, In. All rights reserve. not result of vriility in these prmeters ross nimls, s they were oserve when wil-type, expressing n humn NL overexpressing neurons in the sme slie were ompre (spine ensity:,.3 ±.6 spines per µm, n = 2 neurons, 22 enrites; wil type,.6 ±. spines per µm, n = 9 neurons, enrites; humn NL,.4 ±. spines per µm, n = 8 neurons, 9 enrites; mepsc frequeny:,.37 ±.7 Hz, n = ; wil type,.47 ±.8 Hz, n = 7; humn NL, 2.8 ±.3 Hz, n = neurons; mepsc mplitue:, 9.3 ±.8 pa; wil type,.8 ±. pa; humn NL, 9.4 ±.4 pa; Fig. 7e g). Thus, spine ensity n mepsc frequeny in eh ell re etermine not y the ell s solute level of NL, ut y the ifferene in its expression of NL reltive to neighoring neurons. DISCUSSION The funtion of NL in vivo in the regultion of synptogenesis n the numer of exittory synpses per neuron hs een ontroversil, with some stuies onluing iret funtions of NL in oth proesses n other stuies proposing lter funtion of NL in tivity-epenent synpse vlition 9,27,42. To resolve some of these ontroversies, we exmine, in vriety of geneti ontexts, synpti n ellulr properties of ortil lyer 2/3 pyrmil neurons whose levels of NL h een ltere. Furthermore, we ompre the effets of sprse n glol mnipultions to etermine whether synpses re sensitive to the solute levels of NL in n iniviul ell or to reltive ifferenes in NL in omprison with neighoring neurons. We foun tht the efets in ellulr evelopment epene on the ontext in whih NL ws perture. Loss of NL in ll ells, n in only suset of ortil lyer 2/3 neurons, eqully ltere the level of extr-synpti n synpti NMDARs, onsistent with previous results 9, However, when NL levels were erese or inrese in one ell reltive to its neighors, itionl funtions of NL in the regultion of tivity-epenent spinogenesis n synpse numer were revele. Thus, neurons tht h reltively high levels of NL grew new spines more reily, leing to inrese spine ensity n funtionl synpse numer. In ontrst, neurons with reltively low levels of NL were efiient in the sme prmeters. Trnsellulr grients in NL Neuroligins hve een propose to t in the initil stges of synpse formtion to promote synptogenesis 27. This hypothesis ws supporte y the oservtion tht the numer of synpses n spine ensity erese with reution of neuroligin n inrese with enhne expression 9, Reently, it ws lterntively propose tht neuroligins funtion in synpse speifition n vlition suh tht synpses initilly form in neuroligin-inepenent mnner ut their stiliztion or mintenne require vlition y neuroligins 9. However, eh hypothesis hs een teste in ifferent systems n supporte ifferentilly y in vitro n in vivo t. Furthermore, often the effets of NL on synpse numer were seen following RNAi-meite knokown, whih is suseptile to iffiult-toexlue off-trget effets 43. To iretly exmine the role of NL in vivo in synpse formtion, we mnipulte NL expression levels in either suset of neurons or in ll neurons n exmine the effets on e novo tivity-epenent spinogenesis n mture synpse numer. All of our nlyses were performe in ortil lyer 2/3 pyrmil neurons. We onlue tht reltive ifferenes in NL ross neurons etermine the potentil for initil synpse formtion, whih likely unerlies the hnges in exittory synpse ensity oserve in more mture neurons. Notly, we foun tht the effets of RNAi ginst NL re speifilly the results of NL loss, s they were prevente y oexpression of humn NL, repitulte y severl shrna sequenes n, most notly, not seen when the shrna ws expresse in Nlgn / mie. This lst ontrol shoul e onsiere the gol stnr for off-trget effets in RNAi-se stuies. Thus, in vivo nlyses inite tht NL levels in ell tht re high reltive to its neighors put the ell t vntge in the proess of synpse formtion, resulting in higher ensity of exittory synpses. These results were onfirme in vitro, s ulture GFP-lele Nlgn / lyer 2/3 pyrmil neurons only isplye efets in spine ensity when mixe with neurons. The interellulr or intersynpse proesses tht etermine spine numer n growth my inlue ompetition for ining to presynpti neurexins n isplement y NL of other neurexin-ining prtners, suh s leuine-rih repet trnsmemrne neuronl proteins 44,4. Regultion of iniviul synpses y NL We lso foun tht the solute n reltive levels of NL regulte iniviul synpses. Loss of NL in ll ontexts erese NMDARevoke urrents n lium influx y ~%, n spine morphology ws ltere y sprse mnipultion of NL, onsistent with previous reports 9,29. These morphologil hnges re likely to hve funtionl effet, s spines with lrge hes n long neks trp signling moleules for longer perios 46,47. Inee, we foun ltere C 2+ signling in spines n enrites of neurons with ltere NL expression. This my lso ffet the temporl n sptil profiles of signling pthwys involve in synpti formtion, mturtion n plstiity. For exmple, protein kinse A is nhore in the enrite t rest, ut the tivte tlyti suunit moves into the spine n filittes inution of long-term potentition 48, proess tht my e hmpere y nrrow n long spine neks. Our finings resolve previous onflits in the literture y emonstrting tht the effets of NL on synptogenesis n synpse numer re highly ontext epenent. The omintion of our in vitro n in vivo results suggest tht efets in synptogenesis n synpse numer re revele in NL-lking neurons if neighoring neurons express NL. Similrly, the egree of perturtion of synpse numer is gre epening on the reltive ifferenes in NL ross neurons. Our finings resolve previous onflits in the literture y emonstrting tht the effets of NL on synptogenesis n synpse numer re highly ontext epenent. Methos Methos n ny ssoite referenes re ville in the online version of the pper. Note: Supplementry informtion is ville in the online version of the pper. Aknowlegments We thnk memers of the Stini lortory for their onstrutive omments on the mnusript. We lso thnk A. Giessel, J.F. Sturgill n B. Bloogoo for helping us with t nlysis. We re grteful to F. Vroqueux n N. Brose (Mx Plnk Institute for Experimentl Meiine) for proviing mouse NL expression vetor n Nlgn +/ mie. This work ws supporte y US Ntionl Institutes of Helth grnt RNS6483 (to C.G.), Leonr n Iselle Golenson Reserh Fellowship (to Y.K.) n SFARI grnt from the Simons Fountion (to B.L.S.). AUTHOR CONTRIBUTIONS H.-B.K. n B.L.S. oneive the stuy. H.-B.K. performe experiments n t nlysis. N.A. n J.L.S. performe western lot nlysis n ell ulture n provie tehnil ssistne. W.-J.O. n C.G. esigne n performe the experiments shown in Figure 6. Y.K. performe n esigne the experiments shown in Figure 7e g with esign ssistne from R.T.P. COMPETING FINANCIAL INTERESTS The uthors elre no ompeting finnil interests. nture NEUROSCIENCE VOLUME NUMBER 2 DECEMBER

8 npg 22 Nture Ameri, In. All rights reserve. Pulishe online t Reprints n permissions informtion is ville online t reprints/inex.html.. Ktz, L.C. & Shtz, C.J. Synpti tivity n the onstrution of ortil iruits. Siene 274, (996). 2. Snes, J.R. & Ymgt, M. Mny pths to synpti speifiity. Annu. Rev. Cell Dev. Biol. 2, 6 9 (29). 3. Huermn, A.D., Feller, M.B. & Chpmn, B. Mehnisms unerlying evelopment of visul mps n reeptive fiels. Annu. Rev. Neurosi. 3, (28). 4. Mooy, W.J. & Bosm, M.M. Ion hnnel evelopment, spontneous tivity, n tivity-epenent evelopment in nerve n musle ells. Physiol. Rev. 8, (2).. Grutzenler, J., Ksthuri, N. & Gn, W.B. Long-term enriti spine stility in the ult ortex. Nture 42, (22). 6. Hofer, S.B., Mrsi-Flogel, T.D., Bonhoeffer, T. & Huener, M. Experiene leves lsting struturl tre in ortil iruits. Nture 47, (29). 7. Trhtenerg, J.T. et l. Long-term in vivo imging of experiene-epenent synpti plstiity in ult ortex. Nture 42, (22). 8. Alvrez, V.A. & Stini, B.L. Antomil n physiologil plstiity of enriti spines. Annu. Rev. Neurosi. 3, (27). 9. Dlv, M.B., MClelln, A.C. & Kyser, M.S. Cell hesion moleules: signling funtions t the synpse. Nt. Rev. Neurosi. 8, (27).. Sheiffele, P. Cell-ell signling uring synpse formtion in the CNS. Annu. Rev. Neurosi. 26, 48 8 (23).. Sühof, T.C. Neuroligins n neurexins link synpti funtion to ognitive isese. Nture 4, 93 9 (28). 2. Contrtor, A. et l. Trns-synpti Eph reeptor-ephrin signling in hippompl mossy fier LTP. Siene 296, (22). 3. Ymgt, M., Snes, J.R. & Weiner, J.A. Synpti hesion moleules. Curr. Opin. Cell Biol., (23). 4. Song, J.Y., Ihthenko, K., Suhof, T.C. & Brose, N. Neuroligin is postsynpti ell-hesion moleule of exittory synpses. Pro. Ntl. A. Si. USA 96, (999).. Vroqueux, F. et l. Neuroligins etermine synpse mturtion n funtion. Neuron, (26). 6. Ihthenko, K. et l. Neuroligin : splie site speifi lign for et-neurexins. Cell 8, (99). 7. Ihthenko, K., Nguyen, T. & Suhof, T.C. Strutures, lterntive spliing, n neurexin ining of multiple neuroligins. J. Biol. Chem. 27, (996). 8. Jmin, S. et l. Reue soil intertion n ultrsoni ommunition in mouse moel of monogeni heritle utism. Pro. Ntl. A. Si. USA, 7 7 (28). 9. Chuykin, A.A. et l. Ativity-epenent vlition of exittory versus inhiitory synpses y neuroligin- versus neuroligin-2. Neuron 4, (27). 2. Poulopoulos, A. et l. Neuroligin 2 rives postsynpti ssemly t perisomti inhiitory synpses through gephyrin n ollyistin. Neuron 63, (29). 2. Durn, C.M. et l. Muttions in the gene enoing the synpti sffoling protein SHANK3 re ssoite with utism spetrum isorers. Nt. Genet. 39, 2 27 (27). 22. Feng, J. et l. High frequeny of neurexin et signl peptie struturl vrints in ptients with utism. Neurosi. Lett. 49, 3 (26). 23. Jmin, S. et l. Muttions of the X-linke genes enoing neuroligins NLGN3 n NLGN4 re ssoite with utism. Nt. Genet. 34, (23). 24. Blunell, J. et l. Neuroligin- eletion results in impire sptil memory n inrese repetitive ehvior. J. Neurosi. 3, (2). 2. Kim, J. et l. Neuroligin- is require for norml expression of LTP n ssoitive fer memory in the mygl of ult nimls. Pro. Ntl. A. Si. USA, (28). 26. Soler-Llvin, G.J., Fuillo, M.V., Ko, J., Suhof, T.C. & Mlenk, R.C. The neurexin ligns, neuroligins n leuine-rih repet trnsmemrne proteins, perform onvergent n ivergent synpti funtions in vivo. Pro. Ntl. A. Si. USA 8, (2). 27. Sheiffele, P., Fn, J., Choih, J., Fetter, R. & Serfini, T. Neuroligin expresse in non-neuronl ells triggers presynpti evelopment in ontting xons. Cell, (2). 28. Bour, A.A., Chuykin, A.A., Comoletti, D., Tylor, P. & Suhof, T.C. A splie oe for trns-synpti ell hesion meite y ining of neuroligin to lphn et-neurexins. Neuron 48, (2). 29. Chih, B., Engelmn, H. & Sheiffele, P. of exittory n inhiitory synpse formtion y neuroligins. Siene 37, (2). 3. Den, C. et l. Neurexin meites the ssemly of presynpti terminls. Nt. Neurosi. 6, (23). 3. Grf, E.R., Zhng, X., Jin, S.X., Linhoff, M.W. & Crig, A.M. Neurexins inue ifferentition of GABA n glutmte postsynpti speiliztions vi neuroligins. Cell 9, 3 26 (24). 32. Levinson, J.N. & El-Husseini, A. Builing exittory n inhiitory synpses: lning neuroligin prtnerships. Neuron 48, 7 74 (2). 33. Nm, C.I. & Chen, L. Postsynpti ssemly inue y neurexin-neuroligin intertion n neurotrnsmitter. Pro. Ntl. A. Si. USA 2, (2). 34. Prnge, O., Wong, T.P., Gerrow, K., Wng, Y.T. & El-Husseini, A. A lne etween exittory n inhiitory synpses is ontrolle y PSD-9 n neuroligin. Pro. Ntl. A. Si. USA, (24). 3. Kwon, H.B. & Stini, B.L. Glutmte inues e novo growth of funtionl spines in eveloping ortex. Nture 474, 4 (2). 36. Bloogoo, B.L. & Stini, B.L. Nonliner regultion of unitry synpti signls y CV(2.3) voltge-sensitive lium hnnels lote in enriti spines. Neuron 3, (27). 37. Stini, B.L., Oertner, T.G. & Svoo, K. The life yle of C 2+ ions in enriti spines. Neuron 33, (22). 38. Brrow, S.L. et l. Neuroligin: ell hesion moleule tht reruits PSD-9 n NMDA reeptors y istint mehnisms uring synptogenesis. Neurl Dev. 4, 7 (29). 39. Jung, S.Y. et l. Input-speifi synpti plstiity in the mygl is regulte y neuroligin- vi postsynpti NMDA reeptors. Pro. Ntl. A. Si. USA 7, (2). 4. Buffelli, M. et l. Geneti eviene tht reltive synpti effiy ises the outome of synpti ompetition. Nture 424, (23). 4. MClelln, A.C., Hrusk, M., Coenen, A.J., Henkemeyer, M. & Dlv, M.B. Trnssynpti EphB2 ephrin-b3 intertion regultes exittory synpse ensity y inhiition of postsynpti MAPK signling. Pro. Ntl. A. Si. USA 7, (2). 42. Chuykin, A.A. et l. Dissetion of synpse inution y neuroligins: effet of neuroligin muttion ssoite with utism. J. Biol. Chem. 28, (2). 43. Alvrez, V.A., Rienour, D.A. & Stini, B.L. Retrtion of synpses n enriti spines inue y off-trget effets of RNA interferene. J. Neurosi. 26, (26). 44. e Wit, J. et l. LRRTM2 interts with Neurexin n regultes exittory synpse formtion. Neuron 64, (29). 4. Ko, J., Fuillo, M.V., Mlenk, R.C. & Suhof, T.C. LRRTM2 funtions s neurexin lign in promoting exittory synpse formtion. Neuron 64, (29). 46. Sntmri, F., Wils, S., De Shutter, E. & Augustine, G.J. Anomlous iffusion in Purkinje ell enrites use y spines. Neuron 2, (26). 47. Svoo, K., Tnk, D.W. & Denk, W. Diret mesurement of oupling etween enriti spines n shfts. Siene 272, (996). 48. Zhong, H. et l. Suellulr ynmis of type II PKA in neurons. Neuron 62, (29). 674 VOLUME NUMBER 2 DECEMBER 22 nture neuroscience

9 npg 22 Nture Ameri, In. All rights reserve. ONLINE METHODS Plsmis. Mouse NL tgge with GFP on its C-terminl en 49 ws gift of N. Brose (Mx Plnk Institute). DNA ws purhse from OriGene (t # SC2726). Four ifferent trget sequenes for shrna irete ginst mouse Nlgn ( #~4) were esigne using the online utilities of the Whitehe Institute for Biomeil Reserh. 9 2-p oing, loop n reverse omplementry sequene nuleoties were synthesize (Integrte DNA Tehnologies) n ligte into pgur, vetor tht proues shrna uner n U6 promoter n EGFP uner CMV promoter. Four itionl onstruts ( #6~9) from Sigm were teste (t # NM_38666). Western lot nlysis showe tht #4 ( -GGGGGAAGGGTTGAAGTTTGTTTCAA GAGAACAAACTTCAACCCTTCCCCCCTTTTTG-3 n -AATTCAAAA AGGGGGGAAGGGTTGAAGTTTGTTCTCTTGAAACAAACTTCAACCCT TCCCCC-3 ) n #7 ( -GGGCAGACCTTCACTCGAACTTTCTCGAGAAA GTTCGAGTGAAGGTCTGCCCCTTTTTG-3 n -AATTCAAAAAGGGG CAGACCTTCACTCGAACTTTCTCGAGAAAGTTCGAGTGAAGGTCTGC CC-3 ) effiiently reue NL levels. Cell ulture, trnsfetion n virl infetion. For the experiments to vlite the effiieny of, HEK293 ells were plte n µg of NL-GFP n 4 µg of DNA ws trnsfete using lium phosphte trnsfetion kit (t # 44-2, Invitrogen). Cells were hrveste 2 lter n the lyste ws use for the western lotting. Orgnotypi hippompl slie ultures were prepre from 7 8--ol Sprgue Dwley rts. The rin ws tken out n immeitely ple in hille issetion mei. Trnsverse hippompl slies were hoppe t 4 -µm thikness n 4 6 slies were ple in sterile ulture plte insert (Milliell-CM, Millipore) in 6-well pltes ontining prewrme mei. DNA ws iolistilly trnsfete with Helios Gene Gun (Bior) 2 fter ulturing. Bullets were me with 6 µg of DNA or, for the resue experiments, 4 µg eh of n NLGN. For the virl infetion experiments, issoite hippompl ultures were prepre from --ol rts. We plte neurons in poly--lysine ote 24-well pltes. We e three infetious units of viruses per ell to the ulture mei 2 lter n hrveste ells t 7 8 fter infetion. Lentiviruses expressing n ontrol virus were purhse from Sigm (MISSION Lentivirl Trnsution Prtiles; for #7, t #TRCN322; for ontrol, t #SHCV). For western lots, we use ntioies to NL (:,, t #29), NL2 (:,, t #2922) n NL3 (:,, t #293) (Synpti Systems), n GAPDH (:2,, t #28 Cell Signling Tehnology). In utero eletroportion. All proeures for niml surgery n mintenne were performe following protools pprove y the Hrvr Stning Committee on Animl Cre n in orne with US Ntionl Institutes of Helth guielines. To trget neoortil lyer 2/3 pyrmil neurons, we eeply nesthetize emryoni y. time-pregnnt femle C7BL/6 mie (Chrles River) y intrperitonel injetion of 2.% Avertin (2, 2, 2-Triromoethnol, vol/vol) or 2% isoflurne. Uterine horns were refully expose n -2 µl of DNA ( µg µl ) were injete into one lterl ventrile. To visulize the injetion,.% fst green (vol/vol) ws mixe with the DNA. Glss miropipettes for the injetion were pulle, the tips roken to e ~ µm in imeter, n evele t 8 (Nrishige). After injetion, the emryo he ws hel with tweezer with roun plte eletroes (.-mm imeter) n eletri pulses were elivere five times per seon ( V, ms; CUY2 eletroportor, NEPA GENE). Wrm phosphteuffere sline ws roppe onto emryos perioilly to prevent rying. The uterus ws ple k into the pregnnt mouse, n the nterior musle n the skin were suture seprtely. Pups were house with the m until they were neee. For the experiments shown in Figure 7e g, pups in utero eletroporte with humn NL n ttomto were intrrnilly injete on postntl y with 2 nl of ~ 9 titer lentivirus enoing n GFP (Sigm MISSION Lentivirl Trnsution Prtiles, TRCN322-CMV-tGFP), using protool nlogous to tht esrie previously for eno-ssoite viruses 2. ISH n imge nlysis. Doule fluoresene ISH ws performe using tyrmie signl mplifition metho oring to the mnufturer s instrutions (NEL73KT, PerkinElmer). Briefly, rins of -month-ol mie were issete n immeitely frozen in liqui nitrogen. The rins were ut into 2 µm setions with ryostt (Lei), postfixe in 4% prformlehye (wt/vol), etylte in % triethnolmine (vol/vol) n.2% eti nhyrie (vol/vol), prehyriize, n hyriize t 6 C using the following nti-sense proes: Nlgn (RP_67 G8, Allen Institute for Brin Siene), Gph (RP_3 D, Allen Institute for Brin Siene), n EGFP (U76, nt9-74). For in vitro trnsription, Nlgn DNA ws synthesize from Gensript n Gph DNA ws lone out from mouse DNA lirry. Two fluoresein- or igoxigenin-lele rioproes generte y n in vitro trnsription metho (Promeg) were hyriize simultneously n stine y fluoresein or Cy3 hromogens, respetively. After stining, setions were mounte with Prolong Gol ntife regent (P36934, Invitrogen). Imges were ollete y fluoresene mirosopy using Nikon Elipse 8i mirosope equippe with Nikon DS-2 igitl mer. For mrna expression nlysis, imges were ollete y onfol lser-snning mirosopy using Zeiss LSM META n proesse using ImgeJ (US Ntionl Institutes of Helth). Imges from wil-type rin setions were tken t 4 mgnifition n ten ells lustere in the lyer 2/3 re were rnomly selete per imge for nlysis. To quntify the Nlgn n Gph mrna expression level, res with positive in situ signl for eh gene in the sme ell were mesure using ImgeJ n the oeffiient of vrition for Nlgn n Gph mrna levels were lulte from eh imge. The quntittive t from ten imges were ompile n nlyze s umultive proility istriutions. Spine nlysis. Spine he re n length were nlyze using MATLAB (MthWorks) progrm esrie previously 3. For eh spine, one line ws rwn long the length of the spine (mjor xis) n the other line ws rwn to ross the first line t the mile of the spine he where the fluoresent intensity is mximum (minor xis). He re ws lulte y ounting the numer of pixels insie the re where fluoresene intensity remine 3% of the mximl vlue. Spine length ws esignte s the istne to the point long the mjor xis where fluoresene roppe to 3% of the pek. Aute slie preprtion. C7BL/6 mie (7 2 ol) were eeply nesthetize with isoflurne n epitte. The rin ws rpily remove n ple in hille holine-se utting solution ontining 2 mm NHCO 3,.2 mm NH 2 PO 4, 2. mm KCl, 7 mm MgCl 2, 2 mm gluose, mm CCl2, mm holine hlorie,.6 mm sori i n 3. mm pyruvi i. Coronl setions of the rin were ut t 3-µm thikness using Lei VTS virtome (Lei Instruments) in ol utting solution. Slies were trnsferre to rtifiil ererospinl flui (ACSF) ontining 27 mm NCl, 2. mm KCl, 2 mm NHCO 3,.2 mm NH 2 PO 4, 2 mm CCl 2, mm MgCl 2 n 2 mm gluose. Both utting n ACSF solution were sturte with 9% O 2 n % CO 2 (ph 7.4). The slies were inute t 2 22 C for t lest h efore reoring. Eletrophysiology. A slie ws trnsferre to reoring hmer perfuse with ACSF. All voltge-lmp reorings were performe t room temperture, n urrent-lmp reorings t 32 C. For voltge-lmp reorings, the eletroe ws fille with n internl solution ontining 2 mm CsMeSO 3, 8 mm NCl, mm CsCl 2, mm TEA Cl, mm HEPES, 2 mm QX-34, 4 mm MgATP n.3 mm N 2 GTP (ph 7.3). The pipette resistne ws 3 4 MΩ. For urrent-lmping reoring, the pth eletroe ws fille with 2 mm KMeSO 4, mm KCl, mm HEPES, 4 mm MgATP,.3 mm N 2 GTP n mm phosphoretine (ph 7.3). Pth pipettes were pulle with miropipette puller (P-97, Sutter Instrument). Whole-ell reorings were me from ortil lyer 2/3 pyrmil neurons. For C 2+ imging experiments, t lest min were llowe to pss fter reking the ell memrne efore serhing for spine for nlysis. For mepsc reorings, ells were lmpe t 6 mv in the presene of µm CPP n µm iuulline. To mesure AMPAR n NMDAR uepscs, uepscs were mesure first t 6 mv n then t +4 mv. Glutmte unging-evoke EPSCs were mesure in the presene of µm -serine, µm tetrootoxin, µm ω-onotoxin-mviic, 2 µm nimoipine n 3 µm miefril. All reorings were me with MultiClmp 7A or Axopth 2B mplifiers (Axon Instruments). Two-photon mirosope n unging. Unging of MNI-glutmte n C 2+ imging ws hieve using ustom-uilt mirosope omining two-photon lser-snning mirosopy n two-photon lser phototivtion s previously oi:.38/nn.326 nture NEUROSCIENCE

10 esrie 4. Two moe-loke Ti:Spphire lsers (Chmeleon, Coherent) were use for imging n unging t wvelengths of 84 nm n 72 nm, respetively. Alex-94 (2 µm) n Fluo-F (3 µm) were loe in the ell through the reoring pth pipette. mm MNI-glutmte ws perfuse in the reirulting th n -µs-urtion lser pulse t 72 nm ws elivere to the trget spot to relese glutmte. C 2+ trnsients shown in Figures 2 4 re plotte in units of G/G st, whih ws lulte y iviing G/R y G st /R. G st /R ws mesure in : mixture of M CCl 2 n internl solution, whih sturtes the C 2+ initor. At lest five onseutive responses (AMPAR uepscs, NMDAR uepscs n C 2+ trnsients) were verge from eh spine. To eliver onstnt stimulus to eh spine, lser power ws set to leh re fluoresene in eh spine he y ~4% 36. Animls. B6;29 Nlgn +/ (heterozygous) mie were kinly provie y N. Brose (Mx Plnk Institute). Genotyping ws omplishe y PCR of genomi DNA from the mouse til. For genotyping, we use primers 428 (-GAGCGCGCG CGGCGGAGTTGTTGAC-3 ), 43 ( -GTGAGCTGAATCTTATGGTTAGA TGGG-3 ) n 6 ( -CGGTCAACAAACCTACTCAGAATCAGG-3 ). Dt shown in Figures, 3 n 7 were otine from Nlgn / n littermte ontrol resulting from heterozygous mting. Both mle n femle mie were use for the experiments. Sttistis. The Kolmogorov-Smirnov test ws use to etermine signifine of ifferenes in spine morphology. To etermine signifint ifferenes of suess rte of spinogenesis, we use the Fisher s ext test. For ll other experiments, sttistil signifine ws juge using Stuent s t test (two-sie) or one-wy ANOVA followe y Newmn-Keuls multiple omprison post ho tests. P <. ws juge s signifint. 49. Dresh, T., Nee, A., Meyer, G., Gunelfinger, E.D. & Brose, N. Synpti trgeting of neuroligin is inepenent of neurexin n SAP9/PSD9 ining. Mol. Cell. Neurosi. 27, (24).. Tvzoie, S.F., Alvrez, V.A., Rienour, D.A., Kwitkowski, D.J. & Stini, B.L. Regultion of neuronl morphology n funtion y the tumor suppressors Ts n Ts2. Nt. Neurosi. 8, (2).. Stoppini, L., Buhs, P.A. & Muller, D. A simple metho for orgnotypi ultures of nervous tissue. J. Neurosi. Methos 37, (99). 2. Kozorovitskiy, Y., Suners, A., Johnson, C.A., Lowell, B.B. & Stini, B.L. Reurrent network tivity rives stritl synptogenesis. Nture 48, (22). 3. Sturgill, J.F., Steiner, P., Czervionke, B.L. & Stini, B.L. Distint omins within PSD-9 meite synpti inorportion, stiliztion, n tivity-epenent trffiking. J. Neurosi. 29, (29). 4. Crter, A.G. & Stini, B.L. Stte-epenent lium signling in enriti spines of stritl meium spiny neurons. Neuron 44, (24). npg 22 Nture Ameri, In. All rights reserve. nture NEUROSCIENCE oi:.38/nn.326