MicroRNA-182 is induced by IL-2 and promotes clonal expansion of
|
|
|
- Barrie Banks
- 5 years ago
- Views:
Transcription
1 1 Supplemental Material MicroRNA-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes Anna-Barbara Stittrich 1, Claudia Haftmann 1, Evridiki Sgouroudis 1, Anja Andrea Kühl 2, Ahmed Nabil Hegazy 1,3, Isabel Panse 1,3, Rene Riedel 1, Michael Flossdorf 4, Jun Dong 1,5, Franziska Fuhrmann 1,6, Gitta Anne Heinz 1, Zhuo Fang 7, Na Li 7, Ute Bissels 8, Farahnaz Hatam 1, Angelina Jahn 1, Ben Hammoud 1, Mareen Matz 9, Felix- Michael Schulze 10, Ria Baumgrass 1, Andreas Bosio 8, Hans-Joachim Mollenkopf 11, Joachim Grün 1, Andreas Thiel 5, Wei Chen 7, Thomas Höfer 4, Christoph Loddenkemper 2, Max Löhning 1,3, Hyun-Dong Chang 1, Nikolaus Rajewsky 7, Andreas Radbruch 1,12 and Mir-Farzin Mashreghi 1, Supplementary Legends Supplementary Figure 1 (related to Figure 1b) MiR-182 expression kinetics in mouse and human. (a) Expression kinetic of mir-182 measured by quantitative PCR in in vitro activated murine Th0 lymphocytes. (b,c) Expression of mir-182 in ex 19 vivo stimulated human CD45RO + memory helper T lymphocytes and human CD45RA + naive helper T lymphocytes from two donors, measured quantitative PCR. Supplementary Figure 2 (related to Figure 2) Target reporter. Scheme of target reporter vector and inserts with predicted binding sites (bs) for mir-96, mir-182 and mir-183 in the 3 UTR of Foxo1 mrna.
2 24 Supplementary Figure 3 (related to Figure 3a) MiR-182 and FOXO1 mrna expresssion in human. Overlayed expression kinetics of mir-182 and FOXO1 mrna in activated human helper T lymphocytes, measured by quantitative PCR. Supplementary Figure 4 (related to Figure 3 and 5) Inhibition of mir-182 with LNAs in vitro. (a-c) Expression of (a) mir-182, (b) Foxo1 mrna and (c) Foxo1 protein 24 h after transfection with mir-182-specific LNAs (LNA-182) or scambled control LNAs (LNA-scr), measured by quantitative PCR. (a-c) One representative out of at least two independent experiments is shown. (d) Absolute numbers of viable CD4 + helper T lymphocytes 24 h after treatment with LNA-182, LNA-scr or mir-182 binding site-masking LNAs (LNA-bs), measured by flow cytometry. SDs are based on pools of three independent experiments. 35 Supplementary Figure 5 (related to Figure 4) Regulation of mir-182. (a-c) STAT5 immunoprecipitation of a predicted STAT binding site at the mir-182 locus in Th1, Th2 and Th17 cells. (d) IL-2 expression measured by flow cytometry in Th0 lymphocytes treated either with STAT5 inhibitor (200 µm, compound 6) or DMSO as vehicle control. (e) MiR-182 expression in nt Reg cells that were activated with anti- CD3 and anti-cd28 or not activated (control) and cultured with indicated recombinant IL-2 concentrations, measured by quantitative PCR after 48 h of cultivation. Supplementary Figure 6 Retroviral Overexpression of mir-182 in vitro and in vivo. (a) Scheme of the 5 -LTR to 3 -LTR region of the mir-182 overexpression vector. (b) MiR-182 expression in Th0 cells two days after transduction with the mir- 182-overexpressing vector (mir-182rv GFP + ) or the scrambled control vector (scrrv GFP + ), measured by quantitative PCR. (c) X-fold clonal expansion of retrovirally transduced (GFP + ) helper T lymphocytes between day one and day five
3 after stimulation by LCMV infection (RV, empty control vector). Each group consisted of four mice, SEMs are depicted, statistical analysis was performed by Mann Whitney U Test for unpaired data. 52 Supplementary Table 1 (related to Figure 6) Histological scores for OVA induced arthritis. Table indicates scores of all histological categories examined for each mouse. Scores are based on exudates, granulocyte infiltration, hyperplasia, fibroblast proliferation and mononuclear cell infiltration, periarticular mononuclear cell infiltration (each scoring 0 3), bone and cartilage destruction (scoring 0 4) and an additional score of 1 for fibrin deposition and periarticular granulocyte infiltration, resulting in a maximum score of
4 Supplementary Figure 1 a b c
5 Supplementary Figure 2 5 -LTR hcd4 Foxo1 3 UTR BamHI HindIII mir-183 and mir-96-mir-182 bs (Foxo1 3 UTR nt) AAGUCCUUUCUCCUUUCCUCAGACUUGGCAACAGCGGCAGCACUUUCCUGUGCAGGAUGUUUGCCCAGCGUCCGCAGGUUU UGUGCUCCUGUAGAUAAGGACUGUGCCAUUGGGAAUCAUUACAAUGAAGUGCCAAACUCACUACACCAUGUAAUUGCAG AAAAGACUUUCAGA mir-183 mir-96-mir-182 mir-183 bs (Foxo1 3 UTR nt ) GAUGUUUGCCCAGCGUCCGCAGGUUUUGUGCUCCUGUAGAUAAGGACUGUGCCAUUGGGAAUCAUUACAAUGAAGUG mir-183 mir-96-mir-182 bs (Foxo1 3 UTR nt) CCAUUGGGAAUCAUUACAAUGAAGUGCCAAACUCACUACACCAUGUAAUUGCAGAAAAGACUUUCAGAUCCUGGAGUGCU UUCAA mir-96-mir-182 mir-96-mir-182mut bs (Foxo1 3 UTR nt) CCAUUGGGAAUCAUUACAAUGAAGACGGUAACUCACUACACCAUGUAAUUGCAGAAAAGACUUUCAGAUCCUGGAGUGCUU UCAA mir-96-mir-182-mut
6 Supplementary Figure 3
7 Supplementary Figure 4 a b c d
8
9 Supplementary Figure 6 a 5 -LTR ψ EF1α GFP 3 -LTR U6 b c pri-mir-182 or scr-mir-182
10 Supplementary Table 1 SCORE granulocyte infiltration fibroblast proliferation and mononuclear cell infiltration periarticular mononuclear cell infiltration bone and cartilage destruction visible fibrin deposition and periarticular granulocyte infiltration # exudate hyperplasia total Score antagomir-182 # antagomir-182 # antagomir-182 # antagomir-182 # antagomir-182 # control # control # control # control # control #
MicroRNA-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes
MicroRNA-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes Mir-Farzin Mashreghi, B. D Anna, Claudia Haftmann, Evridiki Sgouroudis, Anja Andrea Kühl, Ahmed Nabil Hegazy,
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Supplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
Tonic CAR signaling in T cells:
Tonic CAR signaling in T cells: toxicities and ways to manage Max Mamonkin, PhD CAR-TCR Summit 9/6/217 Boston, MA CAR signaling Antige n Target cell CAR Signal 2 T cell Signal 1 Clustering Signaling Tonic
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Original Article MicroRNA-182-5p inhibits inflammation in LPS-treated RAW264.7 cells by mediating the TLR4/NF-κB signaling pathway
Int J Clin Exp Pathol 2018;11(12):5725-5734 www.ijcep.com /ISSN:1936-2625/IJCEP0085118 Original Article MicroRNA-182-5p inhibits inflammation in LPS-treated RAW264.7 cells by mediating the TLR4/NF-κB signaling
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
Supplementary Information. Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases
Supplementary Information Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases Ulrike Mock 1, Kristoffer Riecken 1, Belinda Berdien 1, Waseem Qasim 2, Emma Chan
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplementary Figures
MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells
Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
Supplementary Data. Treg phenotype
Supplementary Data Additional Experiment An additional experiment was performed using cryopreserved peripheral blood mononuclear cells (PBMC) derived from five renal cell carcinoma (RCC) patients [see
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Supplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Sequestration of T cells in bone marrow in the setting of glioblastoma and other intracranial tumors
SUPPLEMENTARY INFORMATION Articles https://doi.org/1.138/s41591-18-135-2 In the format provided by the authors and unedited. Sequestration of T cells in bone marrow in the setting of glioblastoma and other
Nature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
a b c Esophageal eosinophilia
TSLP-elicited basophil responses can mediate the pathogenesis of eosinophilic esophagitis. Mario Noti, Elia D. Tait Wojno, Brian S. Kim, Mark C. Siracusa, Paul R. Giacomin, Meera G. Nair, Alain J. Benitez,
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
Micro RNA Research. Ken Kosik. Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr.
Ken Kosik Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr. Program Co-Director, Neurosciences Research Institute Micro RNA Research Neuroscience
Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
The possible mode of action of Tofacitinib, a JAK inhibitor
129 Mini Review The possible mode of action of Tofacitinib, a JAK inhibitor Satoshi Kubo 1), Kunihiro Yamaoka 1), Keisuke Maeshima 2) and Yoshiya Tanaka 1, ) 1) The First Department of Internal Medicine,
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Supplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
SUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies
SUPPLEMENTARY INFORMATION GENOTOXICITY In vitro Genotoxicity Studies The in vitro immortalisation (IVIM) assay relies on the induction of a survival advantage by insertional activation of cellular proto-oncogenes,
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Predicted CD28H protein sequences from human, chimpanzee (pan
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Supplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit
Supplementary information The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit Anna Raffaello 1,4, Diego De Stefani 1,4, Davide Sabbadin 2, Enrico
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Transduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans
Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Emilie Viennois 1*, Yuan Zhao 1, 2, Moon Kwon Han 1, Bo Xiao 1, 3, Mingzhen Zhang 1,
Supplementary material page 1/10
Supplementary Figure 1. Metoprolol administration during ongoing AMI reduces MVO in STEMI patients (a, b) Complete representative CMR exams (short-axis covering the entire left ventricle (LV) from base