PTP1B controls non-mitochondrial oxygen consumption by regulating RNF213 to promote tumour survival during hypoxia

Transcription

1 A RT I C L E S PTP1B ontrols non-mitohonril oxygen onsumption y regulting to promote tumour survivl uring hypoxi Roert S. Bnh 1,2,3, Cterin Iorio 2,11, Rihr Mrotte 2,11, Yng Xu 1,2,3,11, Dn Cojori 1,2, Ans Ael Rhmn 4,5, Juy Pwling 4, Wei Zhng 6, Ankit Sinh 1,2, Christopher M. Rose 7, Mrt Iss 7, Shung Zhng 3, Ronl Wu 1,2, Crl Virtnen 2, Toshiki Hitomi 8, Toshiyuki Hu 9, Shev S. Sihu 6, Akio Koizumi 8, Srh E. Wilkins 1, Thoms Kislinger 1,2, Steven P. Gygi 7, Christopher J. Shofiel 1, Jmes W. Dennis 4, Brly G. Wouters 1,2 n Benjmin G. Neel 2,3,12 Tumours exist in hypoxi miroenvironment n must limit exessive oxygen onsumption. Hypoxi-inuile ftor (HIF) ontrols mitohonril oxygen onsumption, ut how/if tumours regulte non-mitohonril oxygen onsumption (NMOC) is unknown. Protein-tyrosine phosphtse-1b (PTP1B) is require for Her2/Neu-riven rest ner (BC) in mie, lthough the unerlying mehnism n humn relevne remin unler. We foun tht PTP1B-efiient HER2 + xenogrfts hve inrese hypoxi, nerosis n impire growth. In vitro, PTP1B efiieny sensitizes HER2 + BC lines to hypoxi y inresing NMOC y α-kg-epenent ioxygenses (α-kgdds). The moymoy isese gene prout, n E3 ligse, is negtively regulte y PTP1B in HER2 + BC ells. knokown reverses the effets of PTP1B efiieny on α-kgdds, NMOC n hypoxi-inue eth of HER2 + BC ells, n prtilly restores tumorigeniity. We onlue tht PTP1B ts vi to suppress α-kgdd tivity n NMOC. This PTP1B//α-KGDD pthwy is ritil for survivl of HER2 + BC, n possily other mlignnies, in the hypoxi tumour miroenvironment. Mny, if not most, soli tumours ontin signifint res of hypoxi or noxi 1. Cells tivte three mjor ptive pthwys in response to oxygen efiit, whih together funtion to limit O 2 onsumption n mintin energy lne/metolism 2. In response to even mil hypoxi, the trnsription ftor HIF1α eomes stilize. HIF1α irets the expression of multiple genes, whih promote neo-vsulriztion, suppress protein synthesis, inrese glyolysis n erese mitohonril O 2 onsumption. More severe hypoxi tivtes AMPK, whih suppresses mtor n limits exess energy onsumption from the synthesis of protein, lipi n other mromoleules 3,4. Severe hypoxi lso uses enoplsmi (ER) stress n tivtes the unfole protein response (UPR). The UPR tivtes three istint ER sensors for unfole proteins, PERK, IRE1 n ATF6 5. Together, they impee trnsltion n inue the expression of genes for protein refoling n ER reox lne. Although mitohonri re responsile for the vst mjority of ellulr oxygen onsumption, numer of iologil proesses, inluing, ut not limite to, protein foling, lipi n ollgen synthesis, n DNA n histone emethyltion, involve retions tht utilize oxygen iretly. Whether (n how) non-mitohonril oxygen onsumption (NMOC) is regulte uring oxygen eprivtion is unknown. Mmmls hve lrge fmily of genes (>6) enoing α-kg (α-ketoglutrte)-epenent ioxygenses (α-kgdds), whih use α-kg n O 2 s o-sustrtes to tlyse hyroxyltion n emethyltion retions 6 9. These enzymes require Fe +2 n typilly, 1 Deprtment of Meil Biophysis, University of Toronto, Toronto, Ontrio M5G 2M9, Cn. 2 Priness Mrgret Cner Centre, University Helth Network, Toronto, Ontrio M5G 1L7, Cn. 3 Lur n Is Perlmutter Cner Center, New York University Lngone Meil Center, New York University, New York, New York 16, USA. 4 Lunenfel-Tnenum Reserh Institute, Mount Sini Hospitl, Toronto, Ontrio M5G 1X5, Cn. 5 Deprtment of Genetis, Reserh Center, King Fisl Speilist Hospitl n Reserh Center, Riyh 12713, Sui Ari. 6 Donnelly Centre for Cellulr n Biomoleulr Reserh, Bnting n Best Deprtment of Meil Reserh, University of Toronto, Toronto, Ontrio M5S 3E1, Cn. 7 Deprtment of Cell Biology, Hrvr Meil Shool, Boston, Msshusetts 2115, USA. 8 Deprtment of Helth n Environmentl Sienes, Grute Shool of Meiine, Kyoto University, Kyoto 66-81, Jpn. 9 Deprtment of Rition System Biology, Institute of Rition Biology Center, Kyoto University, Kyoto 66-81, Jpn. 1 Chemistry Reserh Lortory, Oxfor University, 12 Mnsfiel Ro, Oxfor OX1 3TA, UK. 11 These uthors ontriute eqully to this work. 12 Corresponene shoul e resse to B.G.N. (e-mil: Benjmin.Neel@nyum.org) Reeive 13 Mrh 216; epte 13 My 216; pulishe online 2 June 216; DOI: 1.138/n36 NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION 1

2 A RT I C L E S sorte (vitmin C), whih funtions to mintin the oxition stte of the Fe resiue 7 1. Exmples of α-kgdds inlue the HIF prolyl hyroxylses (PHD1-3), whih iret HIF uiquityltion n re ritil for its regultion y O 2, the FIH sprginyl hyroxylse, whih regultes HIF ssoition with P3, TET fmily DNA emethylses, the Jumnji histone emethylses, the ollgen hyroxylses n key enzyme in rnitine metolism, γ-utyroetine hyroxylse (BBOX). The protein-tyrosine phosphtse PTP1B, enoe y PTPN1, is est known s n essentil regultor of insulin n leptin reeptor signlling; oringly, Ptpn1 / mie re hypersensitive to insulin, len n resistnt to high-ft-iet-inue oesity PTP1B lso hs een implite s negtive regultor of severl other reeptortyrosine kinses (RTKs), n is suggeste to regulte pyruvte kinse M2 n PERK Surprisingly, however, PTPN1 is mplifie ( 5%) n overexpresse ( 72%) in mny rest tumours 17,18, n severl yers go, we n others reporte tht mouse Ptpn1 is require for effiient mmmry tumorigenesis y Her2/Neu 19,2. Furthermore, mmmry-speifi overexpression of PTP1B uses rest tumours 2. The unerlying mehnism of the pro-onogeni effets of PTP1B hs remine unler/ontroversil 19,2, however, s hs its role in humn HER2 + rest ner. Moymoy isese is rre isorer (iniene 1:,) 21 tht ours in spori n inherite forms. Chrterize y vsulr olusions, usully ffeting the irle of Willis, it typilly presents in olesents or young ults. The inherite form is strongly ssoite with single nuleotie polymorphisms in, whih enoes lrge protein (reltive moleulr mss 591, (M r 591K)) ontining AAA+ ATPse n E3-ligse omins. Up to 1% of the Jpnese popultion, n other Asins, hve the ustive single nuleotie polymorphism, suggesting tht importnt environmentl ontriutors n/or geneti moifiers must exist. In stuying the effets of PTP1B efiieny on HER2 + rest ner (BC) lines, we foun tht PTP1B is essentil for their response to severe hypoxi in vitro n in vivo. Further nlysis unovere previously unreporte pthwy involving PTP1B, n α-kgdds. Hene, our results revel unexpete onnetions etween tyrosine phosphoryltion, moymoy isese, α-kgdds n the regultion of NMOC in the tumour miroenvironment. RESULTS PTP1B is require for tumorigeniity of HER2 + BC ells To explore its potentil role in humn HER2 + BC, we eplete PTP1B from severl HER2 + BC lines y stly expressing PTPN1 short hirpin RNA (shrna; Supplementry Fig. 1). PTP1B efiieny i not ffet ell prolifertion in norml mei (1% serum), low serum (1% serum), low ensity, low gluose (.5 g l 1 ) or in the sene of glutmine (Supplementry Fig. 1,). PTP1B efiieny lso h no onsistent effet on growth ftor signlling, s ssesse y pstat3, pakt n perk levels (Supplementry Fig. 1). Nor i PTP1B efiieny ttenute olony formtion in soft gr or Mtrigel; in ft, for some lines, lk of PTP1B resulte in inrese olony size (Supplementry Fig. 1e,f). Hene, we onlue tht PTP1B is not require for prolifertion of HER2 + BC ells in vitro. Ptpn1-efiieny elys the onset of rest tumours n prolongs the survivl of MMTV Neu NT mie (refs 19,2; lso see Supplementry Fig. 2), so we investigte the role of PTP1B in tumour initition y humn HER2 + BC ell lines. In mrke ontrst to its lk of effets in vitro, ut onsistent with the effets of n llosteri PTP1B inhiitor 22, PTPN1-KD inhiite HER2 + tumour growth (Fig. 1). Re-expressing wil-type (WT) mouse PTP1B (m1b) in ells y using Ptpn1 omplementry DNA (whih is PTPN1 shrna-resistnt) resue tumour growth. By ontrst, the tlytilly impire R221M mutnt (m1b-rm) oul not restore tumorigeniity (Fig. 1). Therefore, the nti-tumorigeni effets of the PTPN1 shrna re on-trget, n PTP1B tlyti tivity is require for its pro-tumorigeni effets. PTP1B expression lso ws require for tumour mintenne, s shown y experiments using n IPTG-inuile PTPN1 shrna (i) expresse in ells (Fig. 1). Despite the mrke effet of PTP1B efiieny on tumour growth, there were no onsistent ifferenes in MEK, ERK, AKT or S6 phosphoryltion in prentl versus PTP1B-efiient tumours (Supplementry Fig. 3). Consistent with mouse moel 23, immunohistohemil nlysis showe no onsistent ifferene in prolifertion (BrU inorportion/ki67) or ngiogenesis (CD31) s onsequene of PTP1B efiieny (Supplementry Fig. 3 ). PTP1B efiieny/inhiition sensitizes HER2 + BC ells to hypoxi ell eth PTP1B-efiient HER2 + tumours, lthough sustntilly smller, were more neroti (Fig. 1; re rrows) n more hypoxi, s shown y EF5 immunostining (Fig. 1,e n Supplementry Fig. 3e). Inuing PTPN1-shRNA expression fter tumours h strte to form resulte in mrkely inrese EF5 retivity (Fig. 1f,g n Supplementry Fig. 3f), initing tht inrese hypoxi ws n ute effet of PTP1B epletion, rther thn response to sustine PTP1B efiieny. Similr effets were oserve in mouse moel: lthough nine-month-ol Ptpn1 / ; MMTV Neu NT n Ptpn1 +/+ ; MMTV Neu NT mie h omprle numers of hyperplsti lesions, in PTP1B-efiient nimls, these lesions isplye more EF5 stining (Supplementry Fig. 2 ). Hene, we onlue tht PTP1B ontrols HER2 + tumour hypoxi n survivl. Next, we ssesse the effet of PTP1B efiieny on HER2 + BC ells expose to hypoxi in vitro. PTPN1-KD erese the survivl of multiple HER2 + lines in ulk ulture (Fig. 2) n in lonogeni ssys (Fig. 2) following exposure to.1% or.2% O 2, respetively. Importntly, expressing WT m1b, ut not m1b-rm, resue hypoxiinue ell eth in ells (Fig. 2). Conversely, tretment with speifi PTP1B inhiitor 24 inue ell eth in prentl HER2 + BC ells expose to hypoxi, ut h no effet in normoxi, initing tht the protetive effet of PTP1B in hypoxi is phosphtse tivity epenent (Fig. 2). As in tumours, PTPN1-KD BC ells unerwent non-poptoti eth fter exposure to.1% O 2 (Supplementry Fig. 4,). Surprisingly, the inrese eth of PTPN1-efiient BC ells in low oxygen ws not ompnie y efetive tivtion of the known hypoxi response pthwys, inluing HIF1α, UPR or mtor, s ssesse y HIF1α stiliztion n tivity, n phosphoryltion of eif2α or S6, respetively (Supplementry Fig. 4 g). Inste, HIF1α stiliztion n eif2α phosphoryltion tully ourre erlier in some BC ells, suggesting tht they might e experiening more severe hypoxi thn prentl ells. 2 NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION

3 A RT I C L E S hptp1b Tumour volume (mm 3 ) Tumour volume (mm 3 ) Tumour volume (mm 3 ) 3 3 hptp1b mptp1b eif2α Weeks P =.2 P =.73 JIMT1 P =.4 JIMT1 P =.44 JIMT1 JIMT1 hptp1b hptp1b eif2α M r (K) + m1b WT + m1b RM Weeks i 4 i + IPTG 3 IPTG Weeks Tumour volume (mm 3 ) +m1b WT +m1b RM P <.1 P <.1 P <.1 i i in vitro xenogrfts M IPTG: r (K) hptp1b P <.1 f Tumour volume (mm 3 ) 4 3 Weeks Weeks Weeks +m1b WT H&E EF5 (hypoxi) Ki H&E EF5 (hypoxi) 11 Weeks 11 Weeks i i +IPTG 9 ys 9 ys P <.1 e g P <.1 Tumour volume (mm 3 ) hptp1b m1b WT JIMT1 MDA-MB-361 MDA-MB NS P <.12 NS Normlize EF5 stining (perentge mm 3 ) Normlize EF5 stining (perentge mm 3 ) Normlize EF5 stining (perentge mm 3 ) Normlize EF5 stining (perentge per mm 3 ).4.2 MDA-MB-361 MBA-MB-361 P =.24 JIMT1 i i + IPTG P =.13 P =.32 P =.39 P =.62 Figure 1 Inrese hypoxi n nerosis in PTP1B-efiient HER2 + rest tumours. () Tumour growth from ontrol n HER2 + rest ner ells injete suutneously into thymi nue mie. Inepenent mie were injete t the eginning of the experiment (n = 1 iologilly inepenent xenogrfts for ll groups exept MDA-MB-361, where n = 8). Tumours were ollete uring the experiment for histology n immunohistohemistry, leving n = 5 for the group t week 9 11, n = 8 for the group t week 5 7, n n = 9 for the MDA-MB- 361 mie n n = 7 for the MDA-MB-361 mie t week () Tumour growth from mie injete with (n = 1), (n = 7), + mptpn1 WT (n = 9) or BT74 + mptpn1 RM (n=1) ells. All n vlues represent iologilly inepenent xenogrfts. () ells expressing IPTG-inuile PTPN1 shrna (i) were llowe to form smll tumours. IPTG ws e to rinking wter of hlf of the mie (n = 5 iologilly inepenent xenogrfts). Immunolots in show PTP1B levels in iniviul tumours t the enpoint of eh experiment; or eif2α re loing ontrols. Note the nonspeifi n ( ) on the mptp1b immunolot in. () Representtive setions from xenogrfts (from ) t 11 weeks post-injetion, stine with H&E or EF5 (hypoxi). Insets n min imges represent.4 or 1 mgnifitions, respetively. Re rrows inite nerosis. (e) EF5 stining re, normlize to tumour size, from (n=9), (n=6), + mptpn1 WT (n=9), JIMT1 (n = 6), JIMT1 (n = 6), (n = 5) n 1B- KD (n=5) xenogrfts (from n ). (f) Representtive Ki67- or EF-stine setions (from ) t 9 ys post-injetion. (g) EF5 stining re, normlize to tumour size, from i tumours fter 28 ys tretment with or without IPTG. Eh point (totl n = 1 per onition) represents one setion from iologilly inepenent xenogrft. Sle rs for.4 mgnifitions represent 1 mm, wheres they represent µm for the 4 n 1 mgnifitions. Tumour growth urves n grphs (men ± s.e.m.) were ompre y two-tile Stuent t-test (e,g), one-wy ANOVA (e) or twowy ANOVA ( ), followe y Bonferroni post ho test. PTP1B regultes NMOC, vi multiple α-kg-epenent ioxygense(s) We therefore sought other explntions for the hypoxi hypersensitivity of PTP1B-efiient BC ells. First, we ske if PTP1B efiieny ffete oxygen onsumption. To ssess ATP-ouple respirtion, mximl respirtion n NMOC, we mesure the oxygen onsumption rte (OCR) slly n in the presene of oligomyin ( mitohonril (mt) ATPse inhiitor), FCCP (n NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION 3

4 A RT I C L E S Cell numer reltive to y (%) P = % O 2 hypoxi (h) Cell numer reltive to y (%) P =.8 P = % O 2 hypoxi (h) Numer of olonies % O 2 normoxi Cells plte Numer of olonies.2% O 2 hypoxi 1, Cells plte Cell numer reltive to y (%) P = % O 2 hypoxi (h) Cell numer reltive to y (%) MDA-MB-361 MDA-MB-361 P =.3 P < % O 2 hypoxi (h) Numer of olonies % O 2 normoxi Cells plte Numer of olonies 4 3.2% O 2 hypoxi 1, Cells plte Cell numer reltive to y (%) Cell numer reltive to y (%) + m1b WT + m1b RM % O 2 hypoxi (h) P =.83 P <. P <.1 P <.9 + m1b WT.1% O 2 hypoxi (h) Cell numer reltive to y (%) Cell numer reltive to y (%) [PTP1Bi] (μm) [PTP1Bi] (μm) P =.28 P =.31 P = P <.1 P = Cell numer reltive to y (%) Cell numer reltive to y (%) [PTP1Bi] (μm) MDA-MB [PTP1Bi] (μm) P =.34 P =.55 P =.1 P = Dy Normoxi (21% O 2 ) Hypoxi (.1% O 2 ) P = Figure 2 PTP1B efiieny sensitizes HER2 + BC ells to hypoxi in vitro. () Survivl of ontrol n HER2 + BC ells in.1% O 2. Dt shown represent men vlues from three inepenent experiments; lso see Supplementry Tle 8. () Colony formtion y ontrol n HER2 + BC ells expose for 24 h to normoxi (21% O 2 ) or hypoxi (.2% O 2 ) n then re-plte t the inite ell numers. Dt re erive from one experiment with nine tehnil replites. See Supplementry Tle 8 for rw t. () Survivl in hypoxi (.1% O 2 ) of ontrol n n ells or ells expressing WT mptpn1 DNA or phosphtse-impire mutnt (RM). Dt shown represent men vlues from three (-erive lines) or four (-erive lines) iologilly inepenent experiments (lso see Supplementry Tle 8). () Effet of n llosteri PTP1B inhiitor (PTP Inhiitor XXII, PTP1Bi) on prentl HER2 + BC ner ells mintine in normoxi (21% O 2 ) or hypoxi (.1% O 2 ). Cells were ounte fter 24-hour ( (n = 5 for eh group) n (n = 3 for eh group)) or 48-hour ( n MDA-MB-361 (n = 4 for eh group n ell line) exposure to.1% O 2, n men vlues re shown. For eh line, n represents the numer of iologilly inepenent experiments (lso see Supplementry Tle 8). Grphs represent men ± s.e.m. n were ompre y two-wy ( ) or one-wy () ANOVA, followe y Bonferroni post ho test. unoupling gent) or rotenone (mt omplex I inhiitor) plus ntimyin A (mt omplex III inhiitor). Consistent with the oserve HIF1α tivtion (see ove), mitohonril OCR ws reue in hypoxiexpose prentl n PTP1B-efiient ells, ompre with their normoxi ounterprts. In hypoxi-expose onitions, however, the OCR ws higher in HER2 + () ells thn in prentl ells. This ifferene ws lso evient in normoxi onitions in the presene of oligomyin or when rotenone n ntimyin A were e to lok the eletron trnsport hin (Fig. 3). These results inite tht NMOC ws inrese in ells. Consistent with this notion, there ws no inrese in mitohonril mss or tivity in suh ells (Supplementry Fig. 5 ). The effets of PTP1B efiieny on ell survivl were restrite to severe hypoxi (.1%.5% O 2 ); survivl of prentl n ells ws similr t higher oxygen onentrtions (Fig. 3). Moreover, n prentl ells ie t similr rtes uner noxi. These finings suggest tht in severe hypoxi, PTP1B-efiient HER2 + BC ells fil to inhiit NMOC n thus eplete remining oxygen reservoirs fster thn prentl ells. In prllel, we nlyse metolites in two HER2 + BC ( n ) ell lines using liqui hromtogrphy tnem mss spetrometry (LC MS/MS). Prinipl omponent nlysis revele glol ltertion of the metolome in the PTP1B-efiient ells, whih ws restore y mptp1b expression (Supplementry Fig. 6 e n Supplementry Tle 1). Control n PTP1B-efiient n ells showe multiple PTP1B-epenent ltertions in metolite levels, ut the only shre ifferene ws n 2-fol lower 4 NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION

5 A RT I C L E S normoxi (21% O 2 ) - normoxi (21% O 2 ) - hypoxi (.1% O 2 ) - hypoxi (.1% O 2 ) P =.7 P =.14 P =.2 P <.1 P =.47 Bsl OCR P =.93 P =.47 P =.5 P <.1 P =. OCR fter 1.5 μm oligomyin Bsl P =.4 OCR fter 1. μm FCCP Unouple Oligomyin FCCP Mximl Nonmitohonril Rotenone Antimyin Time (min) 35 P <.1 3 P =.2 P <.1 P = OCR fter 1. μm rotenone & ntimyin A Perentge of ells reltive to y Perentge of ells reltive to y Perentge of ells reltive to y Perentge of ells reltive to y % O 2 % O Hypoxi (h) Hypoxi (h) Hypoxi (h) Hypoxi (h) Perentge of ells reltive to y Perentge of ells reltive to y Perentge of ells reltive to y Perentge of ells reltive to y Hypoxi (h).1% O 2.1% O 2 12 P < P < Hypoxi (h).5% O 2.5% O 2 P =.34 P < Hypoxi (h) 1.% O 2 1.% O 2 P =.2 P = Hypoxi (h) Figure 3 PTP1B-efiient BC ells ie ue to inrese NMOC. () Oxygen onsumption rte (OCR) in ontrol n ells fter exposure to normoxi (21% O 2 ) or hypoxi (.1% O 2 ) for 24 h. Oligomyin inhiits ouple respirtion; FCCP ws e to mesure mximl respirtion; rotenone n ntimyin A lok eletron trnsport, enling mesurement of NMOC (n = 4 iologilly inepenent experiments for eh group n onition; lso see Supplementry Tle 8). () Effet of oxygen onentrtion on PTP1B-efiient HER2 + BC ells. Survivl of ontrol n n ells in noxi (%) or t the inite O 2 onentrtions (n = 3 iologilly inepenent experiments for eh group n onition; lso see Supplementry Tle 8). Grphs represent men ± s.e.m., n were ompre using one-wy () or two-wy ANOVA (), followe y Bonferroni post ho test. level of α-kg in PTP1B-efiient ells (Fig. 4,). This erese oul not e expline y onsistent ifferenes in the levels of glutmine metolism enzymes or y ltere isoitrte ehyrogense tivity (Supplementry Figs 5 n 6f). Inrese NMOC, onomitnt with erese α-kg levels, oul enhne inrese tivity of one or more α-kg-epenent ioxygenses (α-kgdds) 6 9. Consistent with this notion, there ws n inrese in the numer n intensity of ns etete with nti-hyroxyproline ntioies in HER2 + BC ells, whih ws reverse on tretment with the generi α-kgdd inhiitor IOXI (Fig. 4 h). Severl α-kgdds tlyse prolyl hyroxyltion, so these ifferenes oul reflet inrese tivity of multiple (if not ll) fmily memers, not just HIF1α hyroxylses. Crnitine iosynthesis requires nother α-kgdd, γ-utyroetine ioxygense (BBOX). Remrkly, rnitine levels were inrese in PTP1Befiient HER2 + BC ells in normoxi or hypoxi (Fig. 4i), onsistent with inrese BBOX tivity. DNA from PTP1B-efiient HER2 + BC ells in normoxi or hypoxi lso showe glolly erese retivity to n ntioy ginst 5-methyl ytosine, wheres retivity ws restore on IOXI tretment (Fig. 4j,k). This fining oul reflet inrese tivity of TET fmily DNA emethylses, whih lso re α-kgdds. Together, these results suggest tht multiple α- KGDD-epenent pthwys re tivte in PTP1B-efiient HER2 + BC ells. Most importntly, pre-tretment with the generi α-kgdd inhiitors IOXI or DMOG protete HER2 + BC ells from hypoxi-inue eth in ose-epenent mnner (Fig. 5,), n normlize the inrese NMOC in PTP1B-efiient ells (Fig. 3e). As expete, IOXI ition erese mximl OCR, onsistent with HIF1α stiliztion s onsequene of HIF prolyl hyroxylse inhiition. Together, these finings suggest tht PTP1B ontrols the tivity of one or more α-kgdds to regulte NMOC n, potentilly, α-kg levels. is puttive PTP1B sustrte Our results show tht PTP1B tlyti tivity is require to prevent hypoxi hypersensitivity. To serh for PTP1B sustrtes tht might meite hypoxi hypersensitivity in the sene of PTP1B, we stly expresse Flg mptpn1 WT or n mptpn1 sustrte-trpping mutnt (CS/DA) in ells. mptp1b CS/DA is oule mutnt of the tlyti ysteinyl resiue (C215S) n the sprtyl resiue (D181A) tht ts s generl i to effet PTP tlysis; suh mutnts n in, ut not promote hyrolysis of, sustrtes 29. As reporte previously 3, Flg mptp1b CS/DA trppe the EGFR from lystes of EGF-stimulte ells (Supplementry Fig. 7). Unise MS ientifition of potentil mptp1b sustrtes from normoxi or hypoxi ells i not ientify known α-kgdds or α-kgdd regultors. Inste, two proteins, ARHGAP12 n, were enrihe sustntilly in Flg mptp1b CS/DA o-immunopreipittions (Supplementry Fig. 7). ARHGAP12 is RHO-GTPse-tivting protein (lso known s RHOGAP12) thought to e involve in ell motility 31, n ws suggeste to e PTP1B sustrte in n erlier proteomi stuy 32. We onfirme the preferentil intertion of ARHGAP12 with sustrte-trpping NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION 5

6 A RT I C L E S Oxloette Citrte Mlte Fumrte Suinte Gluose Frutose-6-P Frutose-1,6-P G3P DHAP 3PG 2PG Ltte PEP Pyruvte Twofol hnge of ompre with prentl Aetyl-CoA Isoitrte α-ketoglutrte Suinyl-CoA e f.1% O 2 (h): % O 2 (h): IOXI (24 h): M r (K) Hyroxyproline Glutmte Glutmine Fol hnge reltive to Fol hnge reltive to Hyroxyproline P <.1 P <.1 +m1b WT α-ketoglutrte P =.4 α-ketoglutrte Hyroxyproline Hyroxyproline.1% O 2 (h): % O 2 (h): Hyroxyproline g.1% O 2 (h): IOXI (24 h): h.1% O 2 (h): IOXI (24 h): Hyroxyproline i Fol hnge reltive to Fol hnge reltive to m1b WT P =.4 P =. Normoxi.1% O 2 L-rnitine P =.356 Normoxi.1% O 2 L-rnitine j Control shrna: + PTPN1 shrna: μm IOXI (24 h): 5-Az (4 ys, μm):.1% O 2 (h): k 5-mC Control sirna: sirna: μm IOXI (24 h): 5-Az (4 ys, μm): 1, ng ng ng 5-mC 1, ng ng ng MDA-MB Figure 4 PTP1B efiieny tivtes multiple α-kg ioxygenses. () Shemti showing ifferenes in glyolyti n TCA metolites in ontrol n n ells uner normoxi; lso see Supplementry Fig. 6 n Supplementry Tle 1. () Levels of α-kg in prentl n n ells uner normoxi; note tht the effets of 1B epletion in ells re resue y mptp1b expression (n = 5 iologilly inepenent experiments for eh group n onition). ( e) PTP1B-efiient HER2 + BC ells hve glol inrese in hyroxyproline-ontining proteins, onsistent with enhne α-kgioxygense tivity. Anti-hyroxyproline immunolots of ontrol n 1B- KD HER2 + BC ells expose to.1% O 2 hypoxi for the inite times. (f h) Similr experiments s in e, ut µm IOXI ws use to ssess α-kg-ioxygense epeneny of ns. Re rrows inite ifferenes in n intensities. serves s loing ontrol. (i) Crnitine levels in prentl n PTP1B-efiient n ells s etermine y LC MS/MS (n = 5 iologilly inepenent experiments for eh group n onition for eh group, Supplementry Tle 1). (j,k) Retivity of nti-5- methylytosine (5-mC) ntioies with genomi DNA isolte from ontrol n MDA-MB-361 n ells in normoxi n/or hypoxi (s inite), trete with or without IOXI. In k, ells were trnsfete with ontrol sirna or sirna, s inite. 5-zytiine ws use s positive ontrol to lok DNA methyltion. Re rrows show tht PTP1B efiieny ereses nti-5-mc ntioy retivity, whih is restore y IOXI tretment n/or -KD. Grphs (men ± s.e.m.) were ompre y one-tile Stuent t-test (i), two-tile Stuent t-test () or one-wy ANOVA, followe y Bonferroni post ho test (,i). mutnts; however, ARHGAP12 epletion (with short interfering RNA (sirna)) h no effet on the hypoxi sensitivity of prentl or HER2 + BC ells (Supplementry Fig. 7,). is n M r 591K protein ontining RING E3 ligse n n AAA+ ATPse omin 33, ut h not previously een implite in PTP1B tion. We vlite the intertion of with 6 NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION

7 A RT I C L E S Cell numer reltive to y (%) Cell numer reltive to y (%) Cell numer reltive to y (%) [IOXI] (μm) [IOXI] (μm) MDA-MB , [DMOG] (μm) Dy Normoxi (21% O 2 ) Hypoxi (.1% O 2 ) P =.78 P =.51 P =.7 P =.5 P =.86 Cell numer reltive to y (%) Cell numer reltive to y (%) [IOXI] (μm) [IOXI] (μm) P =.24 P =.79 P =.79 P =.15 P =.45 P =.35 P =.36 8 P =.47 P = P =.1 P <.1 4 P = Bsl OCR OCR fter 1.5 μm oligomyin P <.1 P <.1 P =.26 4 P <.1 P <.1 P =.58 P <.1 3 OCR fter 1. μm FCCP Dy.1% O 2 hypoxi Dy.1% O 2 hypoxi MDA-MB-361 Cell numer reltive to y (%) P =.2 P =.17 P = , [DMOG] (μm) P =.1 P =.13 Cell numer reltive to y (%) + μm IOXI + μm IOXI , [DMOG] (μm) P =.36 P =.1 P =.7 Cell numer reltive to y (%) P =.2 Bsl Unouple Oligomyin FCCP Mximl Nonmitohonril Rotenone Antimyin Time (mins) , OCR fter 1. μm rotenone n ntimyin A [DMOG] (μm) P =.11 P =.31 Figure 5 Generi α-kgdd inhiitors normlize hypoxi hypersensitivity n NMOC in PTP1B-efiient BC ells. () Effets of the generi α- KGDD inhiitor IOXI on survivl of HER2 + BC ells in normoxi or hypoxi, s inite. Cells were ounte fter 24 (: n=4 iologilly inepenent experiments for eh onition, n : n = 3 iologilly inepenent experiments for eh onition) or 48 ( n MDA-MB-361: n = 3 for eh onition) hour exposure to.1% O 2 (lso see Supplementry Tle 8). () Effet of generi α- KGDD inhiitor DMOG on survivl of the inite ontrol n HER2 + BC ells in hypoxi. Cells were ounte fter 24 ( n ) or 48 ( n MDA-MB-361) hour exposure to.1% O 2. Plots show men ± s.e.m. from n =3 iologilly inepenent experiments for eh onition (lso see Supplementry Tle 8). () OCR of prentl n ells with or without overnight exposure to IOXI ( µm) or the inite mitohonril inhiitors (n = 5 iologilly inepenent experiments for eh group n onition). All grphs represent men ± s.e.m., n were ompre y one-wy ANOVA ( ), followe y Bonferroni post ho test. PTP1B CS/DA n with nother trpping mutnt, PTP1B D/A, y immunolotting (Fig. 6). PTP1B/ intertion ppers to require the PTP1B tlyti entre, euse the ompetitive inhiitor soium vnte (N 3 VO 4 ) preferentilly interfere with ining to Flg mptp1b DA, whih retins its tive site ysteine, ompre with Flg mptp1b CS/DA (Fig. 6). Consistent with these oservtions, is tyrosine-phosphorylte, lthough there ws no ovious ifferene in overll phosphotyrosine (py) levels on in prentl versus HER2 + BC ells (Fig. 6). The ltter result suggests tht PTP1B trgets speifi sites on. Most importntly, knokown resue multiple HER2 + BC ells from hypoxi-inue ell eth (Fig. 6). Furthermore, wheres -KD lone h miniml effets on OCR, it orrete the inrese NMOC in ells to levels omprle to prentl ells (Fig. 6e), normlize the inrese in IOXI-epenent, hyroxyproline ntioy-retive ns (Fig. 6f) n restore DNA methyltion to prentl levels (Fig. 4k). In ition, -KD erese HIF1α hyroxyltion in, ut not prentl, HER2 + BC ells, proviing eviene tht PTP1B/ n regulte speifi hyroxyltion events (Supplementry Fig. 7e,f). Finlly, -KD prtilly (ut signifintly) restore the growth of tumours (Fig. 6g i n Supplementry Fig. 7g i), while normlizing their inrese stining with EF5. PTP1B regultes E3 tivity n glolly ffets uiquityltion in HER2 + BC ells The ove finings inite tht PTP1B negtively regultes. To exmine the iohemil effets of PTP1B on n to ientify potentil sustrtes, we expresse HA-tgge uiquitin (HA U) in ontrol n HER2 + ells. Remrkly, PTP1B efiieny or inhiition sustntilly inrese overll uiquityltion (y immunolotting), n muh of this inrese ws suppresse y -KD (Fig. 7 n Supplementry Fig. 7j,k). We lso generte knokout (-KO) ells y using the CRISPR/Cs9 system. Consistent with the effets seen in -KD ells, PTP1B inhiitor tretment resulte in inrese NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION 7

8 A RT I C L E S f.1% O 2 (h): IP: Flg Blot: IP: Flg Blot: Flg e g Tumour volume (mm 3 ) + Control sirna + sirna + Control sirna + sirna 46 Control sirna: sirna:.1% O 2 (h): Hyroxyproline +Flg mptp1 +Flg mptp1 WT CS/DA P <.1 P <.1 P =.3 P =.4 P =.28 P = P <.1 3 P =.2 4 P = OCR fter 1.5 μm oligomyin OCR fter 1. μm FCCP OCR fter 1. μm rotenone n ntimyin A P =.6 P =.3 P <.1 Bsl OCR 46 + Control shrna No. 1 + shrna No. 7 + Control shrna No. 1 + shrna No Weeks Nonmitohonril Oligomyin FCCP Rotenone Antimyin Bsl Unouple Mximl P <.1 P <.1 P <.1 Flg m1b WT: Flg m1b DA: Flg m1b CS/DA: h Time (min) 46 Normlize EF5 stining (perentge/mm 3 ) 1 + Control shrna No. 1 + shrna No. 7 + Control shrna No. 1 + shrna No Control sirna: sirna: % O 2 (h): Hyroxyproline Flg IP: Flg N 3 VO 4 +N 3 VO 4 Lyste IP: IgG IP: IP: IgG IP: MDA-MB-361 IP: IgG IP: Control shrna: + + Control shrna: + + Control shrna: + + PTP1B shrna: + + PTP1B shrna: + + PTP1B shrna: + + py (4G1) py (4G1) py (4G1) P =.2 P =.45 P = i + Control shrna No. 1 + shrna No. 7 + Control shrna No. 1 + shrna No Control sirna: + + sirna: + + H&E 46 Control sirna: + + sirna: Control sirna: sirna: MDA-MB MDA-MB Cell numer reltive to y (%) + Control sirna + sirna + Control sirna + sirna 3 Dy Dy Dy EF5 (hypoxi) Normoxi (48 h) Normoxi (24 h) Normoxi (48 h) P =.3 + Control sirna + sirna + Control sirna + sirna Cell numer reltive to y (%) P =.2 P =.2 P =.4 P =.1.1% O 2 (48 h) P =.4 P =.8.1% O 2 (24 h) MDA-MB Control sirna MDA-MB sirna MDA-MB Control sirna MDA-MB sirna Cell numer reltive to y (%) P =.1 P =.51.1% O 2 (48 h) Figure 6 is novel PTP1B sustrte tht regultes oxygen onsumption n survivl of HER2 + BC ells in hypoxi. () immunolot of PTP1B immunopreipittes from ells expressing Flg mptp1b WT or sustrte-trpping mutnt (CS/DA). () Immunolot showing o-immunopreipittion of n Flg mptp1b WT or the inite sustrte-trpping mutnt (DA n CS/DA) in the sene or presene of the tive site tyrosine phosphtse inhiitor soium orthovnte (1 mm). () is tyrosine-phosphorylte in HER2 + BC ells. Anti-phosphotyrosine immunolots of immunopreipittes from ontrol n HER2 + BC ells. Note tht is tyrosinephosphorylte, lthough its overll level of phosphoryltion is similr in oth lines. () knokown protets HER2 + BC ells from hypoxi-inue eth (n=3 iologilly inepenent experiments for eh group n onition; lso see Supplementry Tle 8). Cells were ounte fter 24 () or 48 ( n MDA-MB-361) hour exposure to.1% O 2. Immunolots show sustntil epletion of 72 h posttrnsfetion with sirnas in normoxi, ompre with ontrol sirnas. (e) knokown normlizes inrese oxygen onsumption in ells (n=7 iologilly inepenent experiments for eh group in sl, unouple n mximl OCR; n=4 iologilly inepenent experiments for non-mitohonril OCR; lso see Supplementry Tle 8). (f) knokown normlizes levels of hyroxyproline-ontining proteins in HER2 + BC ells. Hyroxyproline ns in ontrol n HER2 + BC ells fter exposure to.1% O 2 for the inite times re inite y re rrows. (g) Growth of + ontrol shrna No. 1 (n = 12), + shrna No. 7 (n = 9), + ontrol shrna No. 1 (n = 12), + shrna No. 7 (n = 11) tumours. (h) EF5 stining re normlize to tumour size from + ontrol shrna No. 1 (n = 12), + shrna No. 7 (n = 9), + ontrol shrna No. 1 (n=13), + shrna No. 7 (n = 12) tumours. (i) Representtive imges of H&E n EF5 stining from ontrol n tumours expressing ontrol shrna No. 1 or ontrol shrna No. 7 (from g). All sle rs t.4 n 1 represent 1 mm or µm, respetively. Grphs represent men ± s.e.m., n were ompre y one-wy (,e,h) or two-wy (g) ANOVA, followe y Bonferroni post ho test. Unproesse originl sns of lots re shown in Supplementry Fig NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION

9 A RT I C L E S Control sirna: sirna: +pbe- Empty vetor: HA U: μm hloroquine +1 μm MG132 (3 h): pbe empty vetor: pbe HA U: μm hloroquine +1 μm MG132 (3 h): HA (HA U) HA (HA U) g MDA-MB-361 MDA-MB Empty vetor: 3xFlg WT: Control shrna: PTPN1 shrna: U (n) Blot: 46 Blot: Flg 46 Blot: 46 MDA- MDA-MB- MB IP: Flg Post- U ssy Pre- U ssy pbe empty vetor: pbe HA U: 1 μm MG132 + μm hloroquine (3 h): HA (HA U) h +m1b WT e KO 46 SHP2 KO pbe empty vetor: prk5 HA U: μm PTP1Bi (24 h): μm MG132 + μm hloroquine (3 h): HA (HA U) Control sirna: sirna: pbe empty vetor: pbe HA U: 1 μm MG132 + μm hloroquine (3 h): HA (HA U) Normoxi Hypoxi Oxygen onsumption Oxygen onsumption Mitohonril Non-mitohonril Mitohonril Non-mitohonril PTP1B HIF egrtion PTP1B HIF egrtion PTK? HIF PTK? HIF? PHDs? PHDs αkg-epenent HIF trget genes αkg-epenent HIF trget genes oxygense(s)? oxygense(s)? ADP αkg O ADP 2 +O 2 αkg O Suinte 2 +O +CO TCA Suinte 2 TCA 2? ATP Funtion? +CO ATP +H Mitohonri 2 2 O Funtion? +H 2 O Mitohonri? Hypoxi-inue eth f +4 μm PTP1Bi (24 h) Totl: HA U + KGG IP LFQ+pINT+KGG 3 PTPN1-KD (872 ) KD (265 ) 14 PTPN1-KD -KD (556) Totl proteins ientifie: 2,47 PTPN1-KD epenent : 36% 64% is epenent Figure 7 PTP1B efiieny, vi, lters the uiquitylome in HER2 + BC ells. ( ) Immunolot of HA uiquitin (HA U) from trnsfete ells trete with or without protesoml (MG132) n lysosoml (hloroquine) inhiitors for 3 h, s inite. Control n MDA-MB-361 ells (), ells () or ells trete with PTP1B inhiitor for 24 h () re shown. () Control n n MDA-MB-361 ells were trnsfete with HA U expression onstrut n the inite sirnas, trete with or without protesoml (MG132) n lysosoml (hloroquine) inhiitors for 3 h in normoxi, n sujete to nti-ha immunolotting. Re rrows inite uiquityltion in ontrol n ells without protesoml n lysosoml inhiitors. (e) Prentl n -KO ells were trnsfete with the HA U expression onstrut, n trete with or without n llosteri PTP1B inhiitor, protesoml n/or lysosoml inhiitor for the inite times. Immunolot shows lk of in -KO ells generte y CRISPR/Cs9 tehnology. SHP2 n serve s loing ontrols. (f) Venn igrm initing the numer of proteins tht show 1.5-fol inrese uiquityltion on PTPN1-KD lone,.67-fol erese uiquityltion on -KD lone or tht re ffete y knokown of PTPN1 n, s etermine y HA U IP MS n DiGly (KGG) enrihment. PTPN1-KD inrese the uiquityltion of 4% of the uiquitylome, of whih >6% were erese y -KD. (g) Auto-uiquityltion tivity of nti-flg immunopreipittes from ontrol n ells trnsfete with empty vetor or 3xFlg WT uner normoxi onitions. Anti-Flg n nti- pnels re loing ontrols. h, Moel for PTP1B regultion of tumour ell survivl in hypoxi vi. Ative (lk lines) n intive (grey lines) pthwys re shown uring normoxi n hypoxi, s inite. PTK, protein-tyrosine kinse; PHDs, prolyl hyroxylse omin proteins; TCA, triroxyli i yle. See text for etils. Unproesse originl sns of lots re shown in Supplementry Fig. 8. uiquityltion in ells, ut not in the -KO ells (Fig. 7e). -KD or -KO lone lso erese overll uiquityltion in prentl ells. As note ove, IOXI protete PTP1B-efiient HER2 + BC ells from hypoxi-inue eth, ut it i not normlize the inrese level of uiquitylte proteins in these ells (Supplementry Fig. 7l). Hene, α-kgdd regultion is ownstrem of. NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION 9

10 A RT I C L E S We use two istint, ut omplementry, methos, HA U immunopreipittion mss spetrometry (IP MS) n DiGly IP MS, to ientify n quntify hnges in the uiquitylome (Supplementry Fig. 7m n Supplementry Tles 2 n 3) 34. Consistent with the results of our immunolotting experiments, nerly 4% of the uiquitylome ws inrese in ells, n most (>6%) of this inrese ws suppresse y - KD (Fig. 7f). Pthwy nlysis of PTP1B/-epenent uiquitylte proteins revele mrke enrihment for proteins involve in uiquitin-meite proteolysis (E1s, E2s, E3s n euiquitylses; Supplementry Tle 4). These results suggeste tht PTP1B negtively regultes E3-ligse tivity. Inee, uto-uiquityltion tivity ws enhne in ells, ompre with their prentl ounterprts (Fig. 7g). Regultion of multiple proteins involve in uiquitin-meite proteolysis y oul explin the lrge hnges in uiquityltion in PTP1B-efiient HER2 + BC ells. DISCUSSION We hve isovere tht PTP1B is require for the survivl of HER2 + BC ells in severe hypoxi. Geneti n iohemil eviene suggest tht is PTP1B sustrte, whih in turn ontrols the tivity of one or more IOXI/DMOG-sensitive α-kgdds (Fig. 7h). We propose tht, in normoxi onitions, the exess NMOC use y these enzymes in PTP1B-efiient ells n e tolerte. By ontrst, in the hypoxi tumour miroenvironment, exessive NMOC (use y inrese α-kgdd tivity) results in oxygen epletion n neroti ell eth (Fig. 7h). Therefore, in prllel to the well-esrie regultion of mitohonril oxygen onsumption y HIF, ontrol of NMOC y this PTP1B//α-KGDD pthwy ppers to e essentil for hypoxi survivl of tumour ells. Our results lso ientify s mjor regultor of the uiquitylome, t lest in HER2 + BC ells. Ptpn1 efiieny impirs the ility of onogeni lleles of Neu (rt HER2) to use BC in mie 19,2. However, wheres ref. 2 reporte erese ERK n AKT tivtion in tumours tht eventully rose in the PTP1B-efiient nimls, we sw no onsistent effet on ERK or AKT in the rre tumours tht rose in ompoun mutnt mie 19. We i oserve onsistent erese in ERK tivity in PTP1Befiient hyperplsti lesions, ut these hnges were smll n of unertin iologil onsequene. Similrly, we oserve no effet of PTP1B efiieny or inhiition on ell prolifertion, viility or HER2 signlling events in humn BC lines in vitro or in the tumours. Reently, ref. 22 reporte tht MSI-1436, n llosteri inhiitor of PTP1B, impire HER2 ell prolifertion in vitro. Notly, those experiments use surrogte ssys for prolifertion rther thn the iret ell ounts use here. Severl lines of eviene inite tht is sustrte of PTP1B, n tht PTP1B negtively regultes. First, preferentilly ins to two sustrte-trpping mutnts of PTP1B. Intertion with the sustrte-trpping mutnt ontining n intt tlyti ysteine (DA) is preferentilly isrupte y the ompetitive inhiitor soium orthovnte, ompre with the trpping mutnt (CS/DA) without tlyti ysteine. These results suggest iret intertion etween n the PTP1B tlyti entre. Furthermore, from PTP1B-efiient ells shows inrese in vitro uto-uiquityltion tivity. Nevertheless, tyrosine phosphoryltion of is not inrese in PTP1Befiient/inhiite ells. We suspet tht only speifi tyrosine(s) is regulte y PTP1B; nevertheless, shoul e viewe s puttive sustrte until suh resiues re ientifie. Regrless, our -KD n -KO experiments show lerly tht is the essentil ownstrem meitor of the effets of PTP1B on hypoxi sensitivity. Coneivly, the vsulr olusions, inrese VEGF proution, n norml loo vessel genertion 33,35,36 in moymoy isese lso reflet e-regulte hypoxi response. Our results lso link to the ontrol of α-kgdds. Although the preise mehnism is unler, we suspet tht one or more sustrtes glolly regulte α-kgdds y ltering the levels of o-sustrtes/metolites, suh s sorte n/or iron. It lso is tempting to speulte tht su-linil efiieny of these sustnes oul represent ontriuting environmentl ftor(s) in moymoy isese pthogenesis. Although we fouse on the role of PTP1B in HER2 + BC, PTPN1 is mplifie in other mlignnies, inluing oloretl (1.1%) n ovrin (8%) ners. Future work will fous on whether PTP1B hs roer role in ontrolling hypoxi survivl in tumours n on efining the funtion, sustrtes n regultors of. Suh stuies oul suggest new therpeuti pprohes for HER2 + BC n other mlignnies. Although smll-moleule inhiitors of PTP1B hve een sought primrily for the tretment of ietes n oesity, our results suggest tht PTP1B inhiition, perhps in omintion with gents tht preferentilly kill normoxi ells (for exmple, rition) or rive tumours towrs hypoxi stte (for exmple, nti-ngiogenis), oul e enefiil in ner therpy. Finlly, it will e importnt to lrify the potentil role of PTP1B, α-kgdds n NMOC in moymoy isese pthogenesis. METHODS Methos, inluing sttements of t vilility n ny ssoite ession oes n referenes, re ville in the online version of this pper. Note: Supplementry Informtion is ville in the online version of the pper ACKNOWLEDGEMENTS We thnk G. Keller n T. W. Mk (Priness Mrgret Cner Center) for helpful omments on the mnusript. This work ws fune y NIH grnt R CA49152 n Cnin Institutes of Helth Reserh (CIHR) grnt 193 (to B.G.N.), CIHR grnt 629 (to J.W.D.), CIHR grnt (to S.S.S.), CIHR grnt (to T.K.), Terry Fox New Frontiers Reserh Progrm PPG9-5 (to B.G.W.), Cner Reserh-UK n the Wellome Trust (to S.E.W. n C.J.S), NIH grnt GM96745 (to S.P.G.) n Kin Kenkyu grnt A-347 to A.K. Work in the Neel n Wouters lortories ws prtilly supporte y the Priness Mrgret Cner Fountion n the Ontrio Ministry of Helth n Long Term Cre. B.G.N. n J.W.D. re Cn Reserh Chirs, Tier 1, n B.G.W. is Senior Investigtor of the Ontrio Institute for Cner Reserh. T.K. is supporte y the Cn Reserh Chir progrmme (Tier 2). R.M. ws prtilly supporte y Post-otorl Fellowship Grnt, n R.S.B. y Dotorl Fellowship Grnt, oth from the Cnin Brest Cner Fountion. W.Z. ws supporte y CIHR Post-otorl Fellowship Grnt. D.C. ws supporte y n Ontrio Grute Sholrship. A.A.R. ws supporte y MITACS-Aelerte internship. A.S. ws supporte y the Meil Biophysis Exellene Awr n the Kirsti Pii Cllum Memoril Fellowship. AUTHOR CONTRIBUTIONS R.S.B. esigne n performe most of the experiments, nlyse n interprete the t n wrote the mnusript. C.I. performe n nlyse in vitro ell growth n tumour growth experiments. Y.X. performe LC MS/MS to ientify PTP1Binterting proteins n sustrtes. R.M. provie oneptul vie n helpe to esign experiments. D.C. helpe set up oxygen onsumption mesurements. 1 NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION

11 A RT I C L E S A.A.R., J.P. n J.W.D. prepre, performe n helpe to nlyse the metolomis experiments. W.Z. n S.S.S. ssiste with the uto-uiquityltion ssys. A.S. performe LC MS/MS to ientify uiquitylte proteins from HA U pullowns. C.M.R. n M.I. performe nti-igly IP MS to ientify enogenous uiquitylte pepties. S.Z. generte the -KO line n ssiste with some of the uiquityltion experiments. R.W. performe ot lots with nti-5-mec ntioies. C.V. helpe with the ioinformti nlyses. T.Hitomi, T.Hu n A.K. provie regents for etetion n expression. S.E.W. n C.J.S. provie oneptul vie n regents for α-kgdds. B.G.W. provie oneptul vie on hypoxi n metolism experiments. B.G.N. oneive n supervise the projet, helpe to interpret the t n wrote the mnusript. All uthors ritilly nlyse t, n eite n pprove the mnusript. COMPETING FINANCIAL INTERESTS The uthors elre no ompeting finnil interests. Pulishe online t Reprints n permissions informtion is ville online t 1. Bertout, J. A., Ptel, S. A. & Simon, M. C. The impt of O 2 vilility on humn ner. Nt. Rev. Cner 8, (8). 2. Ppnreou, I., Cirns, R. A., Fontn, L., Lim, A. L. & Denko, N. C. HIF-1 meites pttion to hypoxi y tively ownregulting mitohonril oxygen onsumption. Cell Met. 3, (6). 3. M, X. M. & Blenis, J. Moleulr mehnisms of mtor-meite trnsltionl ontrol. Nt. Rev. 1, 318 (9). 4. Lplnte, M. & Stini, D. M. mtor signling in growth ontrol n isese. Cell 149, (212). 5. Ron, D. & Wlter, P. Signl integrtion in the enoplsmi retiulum unfole protein response. Nt. Rev. Mol. Cell Biol. 8, (7). 6. Loenrz, C. & Shofiel, C. J. Expning hemil iology of 2-oxoglutrte oxygenses. Nt. Chem. Biol. 4, (8). 7. Shofiel, C. J. & Rtliffe, P. J. Oxygen sensing y HIF hyroxylses. Nt. Rev. 5, (4). 8. Hewitson, K. S., Grntino, N., Welfor, R. W., MDonough, M. A. & Shofiel, C. J. Oxition y 2-oxoglutrte oxygenses: non-hem iron systems in tlysis n signlling. Phil. Trnst. A 363, (5), isussion Shofiel, C. J. & Zhng, Z. Struturl n mehnisti stuies on 2- oxoglutrte-epenent oxygenses n relte enzymes. Curr. Opin. Strut. Biol. 9, (1999). 1. Kuiper, C. & Vissers, M. C. Asorte s o-ftor for Fe- n 2-oxoglutrte epenent ioxygenses: physiologil tivity in tumor growth n progression. Front Onol. 4, 359 (214). 11. Elhely, M. et l. Inrese insulin sensitivity n oesity resistne in mie lking the protein tyrosine phosphtse-1b gene. Siene 283, (1999). 12. Zolotny, J. M. et l. PTP1B regultes leptin signl trnsution in vivo. Dev. Cell 2, (2). 13. Klmn, L. D. et l. Inrese energy expeniture, erese iposity, n tissuespeifi insulin sensitivity in protein-tyrosine phosphtse 1B-efiient mie. Mol. Cell. Biol. 2, (). 14. Bettie, A. et l. Protein tyrosine phosphtse 1B regultes pyruvte kinse M2 tyrosine phosphoryltion. J. Biol. Chem. 288, (213). 15. Krishnn, N., Fu, C., Pppin, D. J. & Tonks, N. K. H2S-inue sulfhyrtion of the phosphtse PTP1B n its role in the enoplsmi retiulum stress response. Si. Signl. 4, r86 (211). 16. Stuile, M., Dooy, K. M. & Tremly, M. L. PTP1B n TC-PTP: regultors of trnsformtion n tumorigenesis. Cner Metstsis Rev. 27, (8). 17. Comprehensive moleulr portrits of humn rest tumours. Nture 49, 61 7 (212). 18. Wiener, J. R. et l. Overexpression of the protein tyrosine phosphtse PTP1B in humn rest ner: ssoition with p185-erb-2 protein expression. J. Ntl Cner Inst. 86, 2 8 (1994). 19. Bentires-Alj, M. & Neel, B. G. Protein-tyrosine phosphtse 1B is require for HER2/Neu-inue rest ner. Cner Res. 67, (7). 2. Julien, S. G. et l. Protein tyrosine phosphtse 1B efiieny or inhiition elys ErB2-inue mmmry tumorigenesis n protets from lung metstsis. Nt. Genet. 39, (7). 21. Kim, J. S. Moymoy isese: epiemiology, linil fetures, n ignosis. J. Stroke 18, 2 11 (216). 22. Krishnn, N. et l. Trgeting the isorere C terminus of PTP1B with n llosteri inhiitor. Nt. Chem. Biol. 1, (214). 23. Blvenktrmn, K. K. et l. Epithelil protein-tyrosine phosphtse 1B ontriutes to the inution of mmmry tumors y HER2/Neu ut is not essentil for tumor mintenne. Mol. Cner Res. 9, (211). 24. Wiesmnn, C. et l. Allosteri inhiition of protein tyrosine phosphtse 1B. Nt. Strut. Mol. Biol. 11, 73 7 (4).. Anso, E. et l. Metoli hnges in ner ells upon suppression of MYC. Cner Met. 1, 7 (213). 26. MDonough, M. A. et l. Seletive inhiition of ftor inhiiting hypoxi-inuile ftor. J. Am. Chem. So. 127, (5). 27. Chowhury, R. et l. Seletive smll moleule proes for the hypoxi inuile ftor (HIF) prolyl hyroxylses. ACS Chem. Biol. 8, (213). 28. Yn, L., Colnre, V. J. & Hle, J. J. Prolyl hyroxylse omin-ontining protein inhiitors s stilizers of hypoxi-inuile ftor: smll moleule-se therpeutis for nemi. Expert Opin. Ther. Pt. 2, (21). 29. Tignis, T. & Bennett, A. M. Protein tyrosine phosphtse funtion: the sustrte perspetive. Biohem. J. 42, 1 15 (7). 3. Flint, A. J., Tignis, T., Brfor, D. & Tonks, N. K. Development of sustrtetrpping mutnts to ientify physiologil sustrtes of protein tyrosine phosphtses. Pro. Ntl A. Si. USA 94, (1997). 31. Gentile, A. et l. Met-riven invsive growth involves trnsriptionl regultion of Arhgp12. Onogene 27, (8). 32. Mertins, P. et l. Investigtion of protein-tyrosine phosphtse 1B funtion y quntittive proteomis. Mol. Cell. Proteomis 7, (8). 33. Liu, W. et l. Ientifition of s suseptiility gene for moymoy isese n its possile role in vsulr evelopment. PLoS ONE 6, e242 (211). 34. Kim, W. et l. Systemti n quntittive ssessment of the uiquitin-moifie proteome. Mol. Cell 44, 3 34 (211). 35. Weinerg, D. G. et l. Moymoy isese: review of histopthology, iohemistry, n genetis. Neurosurg. Fous 3, E2 (211). 36. Luttermn, J., Sott, M., Nss, R. & Gev, T. Moymoy synrome ssoite with ongenitl hert isese. Peitris 11, 57 6 (1998).. Comprehensive moleulr hrteriztion of humn olon n retl ner. Nture 487, 33 3 (212). NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION 11

12 M E T H O D S DOI: 1.138/n36 METHODS Regents. PTP Inhiitor XXII (CAS ) 38 ws purhse from EMD Millipore. IOXI (CAS ) ws purhse from Cymn Chemils. Oligomyin A, FCCP (trifluororonylynie phenylhyrzone), rotenone n DMOG (imethyloxloglyine) were purhse from Toris Biosiene. Antimyin A ws purhse from Enzo Life Sienes. Rit polylonl nti- ntioies were generte n use s esrie previously 39. Other ntioies were purhse n use for immunopreipittions n/or immunolotting t mnufturer-reommene onentrtions (Supplementry Tle 5). Cell ulture, infetions n trnsfetions. Brest ner lines were purhse from the Amerin Type Culture Colletion or Deutshe Smmlung von Mikroorgnismen un Zellkulturen. No lines use in this stuy re foun in the ICLAC or NCBI Biosmple tses of ommonly misientifie ell lines. All ell lines were uthentite y STR profiling (GenePrint 1 System 1 mrks, Centre for Applie Genomis, Hospitl for Sik Chilren, Toronto), n teste for myoplsm (MyoAlert, Lonz).,, MDA-MB-361 n JIMT1 ells were mintine in DMEM+1% FBS. ells were ulture in RMPI+1% FBS. Where inite, ells were stly infete with VSVGpseuotype retroviruses rrying psuper puro ontrol shrna or PTPN1 shrna or VSVG-pseuotype lentivirus hrouring plko (91) IPTG-inuile puro PTPN1 shrna. Reonstitution of PTP1B ws hieve y infeting ells with the VSVG-pseuotype retrovirus pfb neo mptp1-wil-type, the tlytilly impire mptp1 mutnt (R221M), Flg mptp1-wil-type or Flg-sustrtetrpping mutnt (D181A or D181A/C215S). To otin stle trnsutnts, infete ells were trete with 1.5 µg ml 1 (/), 3 µg ml 1 (MDA-MB-361), 4 µg ml 1 (), or 7 µg ml 1 (JIMT1) puromyin (Bioshop) for 3 ys or with 7 µg ml 1 G418 (Bioshop) for 7 ys. Smrtpools or iniviul sirnas for, ARHGAP12 n IDH1 (Thermo Sientifi) were introue into ells using Lipofetmine RNAiMAX (Invitrogen), s per the mnufturer s instrutions. All RNAi n shrna sequenes re shown in Supplementry Tle 6. For soft-gr ssys, 5, ells were mixe into.3% gr (top lyer), n seee onto 1 m pltes ontining.6% gr (ottom) lyer. Mei were hnge every 4 ys for 4 weeks. Imges were otine t 4 mgnifition using Lei DFC42 igitl mer n Lei FireCm softwre. Colonies were ounte in 1 fiels using. m 2 gri. For Mtrigel ssys, 48-well pltes were ote with 3-D Culture Mtrix-Reue Growth Ftor Bsement Memrne Extrt (Cultrex), n inute t C for 3 min. Eh well ws seee with 5, ells in µl of growth mei. Mei were hnge every 4 ys for 3 weeks, n imges were otine s ove. Xenogrfts, mouse moels n histology. Brest ner ells (1 1 6 ) were suspene in 4 µl of % growth ftor-reue Mtrigel (BD Siene), n injete suutneously into the right flnks of 6 8-week-ol femle Bl/ thymi nue mie implnte with ( n MDA-MB-361) or without (JIMT1 n ) 6-y relese pellet ontining.72 mg 17β-oestriol (Innovtive Reserh of Ameri). Experiments were not rnomize, nor were the investigtors line to llotion uring experiments n outome ssessment. Tumours were mesure weekly with llipers, n tumour volume ws lulte s length with 2.52 (ref. 4). For tumour mintenne experiments, IPTG (1 mm) ws e to the rinking wter to inue expression of PTPN1 shrna. No sttistil metho ws use to pre-etermine smple size, ut se on the results of pilot experiment onsisting of 9 mie eh for prentl n tumours, power nlysis inite tht 8 mie per group were suffiient to etet n pproximtely threefol ifferene in men tumour size. Ptpn1 / n MMTV Neu NT mie (mixe kgroun, 129/B6/FVB) were esrie previously 41. Femles ontining one opy of MMTV Neu NT from Ptpn1 +/ MMTV Neu NT ; Ptpn1 +/ rosses were kept s virgins for the entire stuy perio. Mie tht ie for unknown resons were exlue from nlysis. All niml stuies were pprove y the University Helth Network Animl Cre Committee (Protool no. 1239). Before euthnizing, mie were injete with 1.5 mg BrU n 2 µmol EF5 for 24 h or 4 h, respetively. Tumours n mmmry glns were fixe in formlin n emee in prffin. Setioning n H&E stining were performe y the University Helth Network Pthology Reserh Progrm (UHN PRP). Immunohistohemil nlyses were performe y the UHN PRP or the Priness Mrgret Cner Centre Applie Moleulr Profiling Lortory (AMPL). Slies were snne t the Priness Mrgret Cner Center Avne Optil Mirosopy Fility, n nlyse with Aperio ImgeSope softwre (Lei Biosystems). In eh smple, the perentge of EF5 stining ws normlize to tumour size. In vitro hypoxi ssys. Cells were seee t ells per 6 mm plte (4 1 6 per plte for MDA-MB-361), n llowe to here overnight. The next y (Dy ), ells were ounte, n the meium (3 ml) ws exhnge, efore replites were ple into stnr inutor (normoxi), tri-gs inutor (5% O 2, Snyo MCO-18M), hypoxi hmer (.1 1.% O 2, Whitley H35 Hypoxysttion) or noxi hmer (% O 2, Whitley H85 Hypoxysttion). PTP1B inhiitor n/or the oxygense inhiitors IOXI or DMOG were e fter the meium ws hnge on Dy, ut efore pling ells in the normoxi or hypoxi hmer. Cells remining on the plte were ounte t the inite times. Experiments were sle up or own onto ifferent size pltes on the sis of surfe re. For olony formtion ssys, ells were expose to normoxi or.2% O 2 hypoxi for 24 h, n then reseee onto 1 m pltes t the inite ensities in triplite. Mei were hnge every 3 ys for 3 4 weeks. Colonies were stine using methylene lue n ounte. Genertion of -knokout ells. An -knokout ell line ws generte y CRISPR/Cs9-meite genome engineering 42. Briefly, trget sequene in the thir exon of (ACAATGGCGTCGGCCTCGGA) ws esigne y onsulting the wesite n lone into the BsI site of pspcs9 (BB) 2A GFP (PX458) (Agene). ells were trnsfete with the PX458 sg vetor using FuGENE 6 Trnsfetion Regent (Promeg). Forty-eight hours post-trnsfetion, GFP-positive ells were sorte, ulture t limiting ilution n single lones were isolte. Homozygous muttion ws ientifie y DNA sequening n onfirme y immunolotting. Flow ytometry. Cell eth ws nlyse y Sytox Blue n Annexin V stining. Culture superntnts n trypsinize ells were ollete, omine n reovere y entrifugtion t 365g in tletop entrifuge (Bekmn Coulter). Cells were wshe with Hnks Blne Slt Solution (HBSS, Wisent), resuspene in 1 Annexin V ining uffer (BD Siene) n stine with Annexin V-PI (BD Phrmingen) n Sytox lue (Invitrogen), s reommene y the mnufturers. Totl n tive mitohonri were stine with Mitotrker yes (Invitrogen). Cells were stine with µm of Mitotrker Green n CMXROS (oth from Invitrogen) for 3 min. All smples were nlyse using Beton Dikinson (BD) LSRII (BD Biosienes) n FlowJo softwre. Quntittive rel-time PCR. Cellulr RNA ws extrte y using the mirnesy kit (Qigen), n then reverse trnsrie using the RT 2 first stn kit (Qigen). The resultnt DNA (2 ng) ws mixe with SYBR Green Supermix (Qigen n Life Tehnologies), long with primers speifi to HIF1α trget genes, s esrie previously 43, or nlyse y using the RT 2 profiler PCR rry humn hypoxi signlling pthwy (see Supplementry Tle 7). Retions were performe on the CFX96 rel-time PCR mhine (Bio-R). CT ws lulte using RPL13A s loing ontrol. Fol hnge ws lulte reltive to prentl HER2 + rest ner ells in normoxi. Oxygen onsumption mesurements. Oxygen onsumption rte (OCR) ws mesure with n XF96 nlyser (Sehorse Biosiene). Briefly, ells (, per well) were seee in DMEM (no uffer) + 2%FBS in 96-well pltes. The pltes were entrifuge t 21g in tletop entrifuge (Bekmn Coulter) with no eelertion for 5 min, efore plement into the nlyser. Injetion ports were loe to hieve the following finl working onentrtions: oligomyin A (1.5 µm), FCCP (1 µm), rotenone (1 µm) n ntimyin A (1 µm). Before OCR mesurements, ells were expose to normoxi or.1% O 2 hypoxi for 24 h, trete with IOXI overnight (16 h), or trnsfete with sirnas for 72 h, s inite. Metolomis. Metolites were prepre s esrie previously 44. Briefly, ells were flsh frozen in liqui N 2, n extrte with 4% etonitrile:4% methnol:2% H 2 O. Extrts were ple into 1.5 ml Eppenorf tues (Corning), vortexe t 4 C for 1 h n entrifuge t 4 C for 1 min t 18,g in n Eppenorf mirofuge. Superntnts were evporte in Speev (Ai- Resistnt CentriVp Vuum Conentrtors, Lono), n smples were resolve y LC MS/MS. Anlysis ws performe in positive n negtive moes t the optimum polrity in MRM moe on n eletrospry ioniztion (ESI) triplequrupole mss spetrometer (ABSiex4Qtrp), s esrie previously Some metolites pper in uplite ue to using ifferent ions to onfirm the metolites. Prinipl omponent nlysis n het mps were generte y using Mss Profiler Professionl (Agilent). DNA methyltion ot lots. Genomi DNA n methylte DNA stnrs (Ct. no. 58; Ative Motif) were het-enture in.4 M NOH (Sigm) n 1 mm EDTA (Sigm) t C for 1 min n hille on ie for 5 min. Smples were twofol serilly ilute n pplie to positively hrge nylon memrne (Bioyne B; Pll Life Sienes) using the Bio-ot mirofiltrtion pprtus (Bio-R). Memrnes were ultrviolet-rosslinke t 12, µj m 2 (CL; UVP), n loke in TBS,.1% Tween-2 (TBST), 5% milk for 1 h. Primry ntioies ginst 5-mC (1:1,; t ; Ative Motif) were inute with the memrne in NATURE CELL BIOLOGY

13 DOI: 1.138/n36 M E T H O D S TBST overnight. Dot lots were wshe 3 in TBST, inute in HRP-onjugte IgG seonry ntioies (GE Helthre) for 1 h, n etete y stnr ECL methos (Supersignl West Pio; Thermo Fisher Sientifi). Immunolotting n immunopreipittion. For immunolotting, whole ell lystes were generte in moifie rioimmunopreipittion (RIPA) uffer ( mm Tris- HCl ph 8., mm NCl, 2 mm EDTA, 1% NP-4, n.1% SDS, without soium eoxyholte). TNE lysis uffer ( mm Tris-HCl ph 8., mm NCl, 2 mm EDTA, n 1% NP-4) ws use for immunopreipittions. Lysis uffers were supplemente with protese (4 µg ml 1 phenylmethyl sulfonyl fluorie, 2 µg ml 1 ntipin, 2 µg ml 1 pepsttin A, 2 µg ml 1 leupeptin, n 2 µg ml 1 protinin) n phosphtse (1 mm NF, 1 mm N 3 VO 4, 1 mm β-glyerophosphte, n 1 mm soium pyrophosphte) inhiitors. Lystes were inute, s inite, with nti- ntioies n G-Sephrose 4 Fst Flow (GE Helthre) or nti-flg M2 grose (Sigm-Alrih) for 3 h t 4 C on rotting pltform. Bes were wshe 4 in their respetive lysis uffer, n then nlyse y immunolotting, essentilly s esrie previously 47. To etet, lystes n immunopreipittes were resolve y moifie SDS PAGE, using 3 8% Tris-ette gels n Tris-ette running uffer (Invitrogen). Tris-ette gels were trnsferre in 1 trnsfer uffer, 1% methnol n.1% SDS. All other proteins were resolve y stnr SDS PAGE, n trnsferre using 1 trnsfer uffer n 15% methnol 47. Memrnes were inute with their respetive primry ntioies, n visulize with IRDye infrre seonry ntioies, using n Oyssey Infrre imging system (Li-Cor Biosienes). Isoitrte ehyrogense (IDH) tivity mesurements. IDH tivity ws mesure s esrie previously 48,49. Briefly, ells were lyse in PBS +.1% Triton-X-, supplemente with protese inhiitors s ove. Aliquots of eh lyste (4 µg protein) were e to ssy uffer ( mm Tris-HCl ph 7.5,.5 mm EDTA, 1.5 mm MnCl 2, 1. mm isoitrte), n OD 34 ws mesure with plte reer every 3 s. Bkgrouns (wells without lyste) were sutrte to yiel OD 34 vlues. Protein mss spetrometry. Cells were lyse in MS uffer ( mm Hepes ph 7., mm KCl,.5% NP-4, 2 mm EDTA, 1% glyerol), supplemente with protese n phosphtse inhiitors, s ove. Lystes were immunopreipitte with 8 µl of % slurry of M2 Flg grose es (Sigm-Alrih) for 3 h t 4 C on rotting pltform. Bes were wshe 3 in MS uffer, n 4 in rinse solution ( mm NH 4 HCO 3 n mm KCl), n then elute with three liquots ( µl eh) of.5 M NH 4 OH. Poole elutes were lyophilize, trypsinize, psse through C18 ZipTip Pipette Tips (Millipore), n sujete to LC MS/MS on Q-Extive MS (Thermo Sientifi). Dt were nlyse with Proteome Disoverer (Thermo sientifi), followe y Sffol (Proteome Softwre), using the Uniprot tse. Uiquitylome nlysis. Cells were trnsfete with empty pbe-puro vetor or pbe-puro expressing HA-tgge uiquitin (HA U) using Fugene 6 (Promeg), s per the mnufturer s instrutions. Trnsfete ells were expose to normoxi or.1% O 2 for 24 h, n trete with n without 1 µm MG132 n µm hloroquine to inhiit the protesome n lysosome, respetively. Cells were lyse in RIPA uffer (+1 mm IAM n NEM), n lystes were nlyse y immunolotting s esrie ove. For HA U IP MS, ells were lyse in RIPA uffer, n lystes were immunopreipitte with µl of % slurry of HA grose es (Sigm- Alrih) overnight t 4 C on rotting pltform. Bes were wshe 3 in RIPA uffer, 4 in rinse solution n then elute with three liquots ( µl eh) of.1% trifluoroeti i (TFA). Smples were prepre n lene s esrie in the Protein mss spetrometry setion. Lyophilize peptie pellets were resuspene in 1 µl of.1% formi i. LC MS/MS ws performe s esrie previously, exept the entire 1 µl of smple ws injete for eh nlysis. MxQunt version ws use to serh rw t from the mss spetrometer ginst using the UniProt omplete humn proteome sequene tse (version: , numer of sequenes: 2,232) 51. Crmiomethyltion of ysteines ws efine s fixe moifition, n oxition of methionine n etyltion of protein mino termini s vrile moifitions. Flse isovery of pepties ws ontrolle using trget eoy pproh, where pepties uner the threshol of 1% flse isovery rte were rrie on for nlysis. Susequently, protein groups ientifie with t lest two or more pepties were rrie forwr in nlysis. All post-serh n sttistil nlysis of proteomis t ws performe using R. LFQ intensities ssigne to protein groups were use s proxy for protein intensities; however, missing LFQ intensities were sustitute y juste ibaq intensities. Remining missing t were impute with onstnt vlue. Further etils re ville from A.S. or T.K. For igly enrihment, proteins were extrte from ells y ing lysis uffer (8M ure, mm NCl, mm HEPES (ph 7.5), 1 mm EDTA, protese inhiitor (Rohe)), n pssing the ells 2 times through 21G neele. Proteins were reue with 1 mm TCEP, lkylte with 15 mm NEM, n ppe with 1 mm ithiothreitol. Before igestion, proteins were preipitte with hloroform/methnol, n the pellet ws resuspene in 8 M ure, mm HEPES using syringe, s esrie ove. Proteins were ilute in mm HEPES to 4 M ure, n igeste with LysC (1: enzyme/sustrte rtio) for 6 h t 3 C. This solution ws ilute to 1 M ure with mm HEPES efore the ition of LysC n trypsin (1: enzyme/sustrte) n inution t C overnight. Before enrihment, pepties were iifie efore eslting y pssge over C-18 soli phse extrtion (SPE) olumns (Wters). Lyophilize pepties from 11 mg of protein were issolve in 1.5 ml of IAP uffer ( mm MOPS (ph 7.5), 1 mm N 2 HPO 4, mm NCl), n entrifuge t mximl spee for 5 min to remove insolule mteril. Superntnts were remove, n inute for 2 h t 4 C with nti-igly ntioy (Cell Signling Tehnologies; 32 µg/ip), rosslinke to protein A grose s esrie previously 52. Following ining, superntnts ontining unoun pepties were retine, n the es were wshe 2 with IAP n 3 with PBS efore elution of enrihe pepties with.15% TFA. A seon enrihment ws performe using the unoun pepties from the first enrihment. Elute pepties were eslte y using C-18 stge tip. Isori lelling of peptie elutes ws performe using 1-plex tnem mss tg (TMT) regents (Thermo Fisher Sientifi) 53. Before use, TMT regents (.8 mg) were issolve in 4 µl of nhyrous etonitrile (ACN). Dry, enrihe pepties were issolve in 18 µl of mm HEPES (ph 8.) n 4 µl nhyrous ACN. Lelling ws performe y the ition of 3 µl TMT, followe y inution t room temperture for 1 h. Retions were quenhe with 2 µl of 5% hyroxylmine (3% v/v hyroxylmine). Smples were mixe n eslte y Stge Tip efore nlysis y mss spetrometry. Spetr were quire on n Oritrp Fusion mss spetrometer, ouple to n Esy-nLC (Thermo Fisher Sientifi) 54. Pepties were seprte over n nlytil olumn ( µm ID) pke with.5 m of Mgi C-18 (5 µm, A, Mihrom Bioresoures) n 35 m of Sepx Tehnologies GP-C18 resin (1.8 µm, 12 A), using liner grient from 8 to 26% ACN with.1% formi i over 18 min t flow rte of 4 nl min 1. High-resolution (12, resolving power, AGC =,) survey sns (MS1) were use to guie t-epenent smpling n susequent CAD frgmenttion (NCE = 35) of the top ten most-intense pepties. MS2 frgment ions were nlyse in the ion trp (MS2 AGC = 5,, MS3 AGC =,), n the top 1 frgment ions were isolte y synhronous preursor seletion, frgmente y HCD (NCE = 55) to proue TMT 1-plex reporter ions, n nlyse in the Oritrp t resolution of 6, (refs 55,56). Preursors with unssigne or +1 hrge sttes were exlue, n previously interrogte preursors were exlue using ynmi winow (6s, ± 1 ppm) roun the ssigne monoisotopi pek. A ompiltion of in-house softwre ws use to onvert mss spetrometri t to mzxml formt, s well s to orret monoisotopi m/z mesurements n erroneous peptie hrge stte ssignments. MS/MS spetr were mppe to peptie sequenes y using SEQUEST 57 to serh n in silio trypti igest (2 misse levges) of Uniprot protein tse ontining trget n eoy humn proteins, s well s known ontminnts. SEQUEST serhes llowe ppm preursor ion tolerne n.9 D frgment ion tolerne. TMT lels on peptie N termini/lysine resiues ( D) n N-ethylmleimie on ysteine resiues ( D) were set s stti moifitions, wheres methionine oxition ( D) n the i-glyine uiquitin remnnt moifition of lysine resiues ( D) were set s ynmi moifitions. Peptie spetrl mthes were filtere to 1% FDR y pplying the trget eoy strtegy, s esrie previously 58. Susequently, proteins were groupe n filtere to 1% FDR 56. Following protein grouping, moifie version of Asore ws use to onfiently (P.5) lolize uiquityltion sites (Asore >13) 59. Anlysis of HA U IP MS ws performe on two inepenent iologil replites. Inreses n ereses from LFQ n pint (LFQ + ibaq) were omine n sore if they ppere in either iologil replite. Proteins from the igly list were sore if t lest one peptie ws inrese in PTPN1-KD ells lone, erese in -KD ells lone or inrese in PTPN1-KD ells n erese in -KD ells, s inite in the figure n tle legens. Auto-uiquityltion ssys. prentl n ells were trnsfete with 3xFlg WT y using Fugene 6 (Promeg) n following the mnufturer s instrutions. Trnsfete ells were ple in normoxi for 24 h, n lyse with TNE lysis uffer, followe y nti-flg M2 grose o-immunopreipittion, s esrie ove. Auto-uiquityltion ssys were performe in uffer (3 µl, 1.5 es volume) ontining mm Tris-Cl ph 8., E1/UBE1 ( nm, Boston Biohem), E2/UBE2D2 (1 µm, Boston Biohem), uiquitin (2 µm, Boston Biohem), ATP (2 mm) n MgCl 2 (1 mm). After inution t C for 6 min, retions were terminte y the ition of SDS PAGE smple uffer, n resolve using 3 8% NATURE CELL BIOLOGY

14 M E T H O D S DOI: 1.138/n36 Tris-ette grient SDS PAGE gels, s esrie ove. Uiquitylte speies were visulize y immunolotting, using nti- rit polylonl ntioies, s inite. Bioinformti nlyses. Proteins showing 1.5-fol inrese uiquityltion in PTPN1-KD ells,.67-fol erese uiquityltion on -KD or tht were ffete oth y PTPN1-KD n -KD were ompre to fin ommon sets of overlpping proteins 6 y using the BinGO (v3..3) 61 plugin. The My 215 GO efinition file ws use s the seline, n eh high-level GO tegory (Biologil Proess, Cellulr Component, Moleulr Funtion) ws teste (hypergeometri test, Benjmini Hoherg FDR q<.5) inepenently. To ssess KEGG pthwys n INTERPRO omins enrihe in eh of the lists, the online tool DAVID 62 ws use (efult settings, kgroun humn genome). Sttistis n reprouiility. Smple sizes n sttistil tests for eh experiment re enote in the figure legens. Rw t from inepenent replite experiments re in Supplementry Tle 8. Eh ot lot n immunolot ws performe t lest twie if more thn one ell line ws stuie or t lest three times if only single line ws use. All xenogrfts represent one inepenent experiment with the inite iologil replites, n eh immunolot ontine multiple tumour lystes (iologil replites) from eh group. All metolomis t represent n=5 tehnil replites for eh group from single inepenent experiment. All immunohistohemil imges show smples from single mouse of eh group, n quntifition ws performe on ll iologil replites in the experiment, with the numer of t points initing the numer of inepenent iologil replites. Non-normlly (skewe) istriute t (Fig. 2) were normlize y log 2 - trnsformtion. The multilevel t-test ws implemente using the R pkge nlme ( The etween-group vrines were similr, n the t were normlly istriute. All nlyses n grphs were generte with GrphP Prism 5. A P vlue of <.5 ws onsiere signifint; preise P vlues n e foun in the figures. Dt vilility. The rw LC MS/MS metolomis t hve een eposite t Soure t for Figs 2, 3,, 5, n 6,e n Supplementry Figs 1,, 4,f, 5,, 6f n 7e,f hve een provie in Supplementry Tle 8 Sttisti Soure Dt. All other t supporting the finings of this stuy re ville from the orresponing uthor on request. 38. Wiesmnn, C. et l. Allosteri inhiition of protein tyrosine phosphtse 1B. Nt. Strut. Mol. Biol. 11, 73 7 (4). 39. Liu, W. et l. Ientifition of s suseptiility gene for moymoy isese n its possile role in vsulr evelopment. PLoS ONE 6, e242 (211). 4. Inger, D. et l. Syntheti nlogues of fumgillin tht inhiit ngiogenesis n suppress tumour growth. Nture 348, (199). 41. Bentires-Alj, M. & Neel, B. G. Protein-tyrosine phosphtse 1B is require for HER2/Neu-inue rest ner. Cner Res. 67, (7). 42. Rn, F. A. et l. Genome engineering using the CRISPR-Cs9 system. Nt. Protools 8, (213). 43. vn en Beuken, T. et l. Hypoxi-inue expression of roni nhyrse 9 is epenent on the unfole protein response. J. Biol. Chem. 284, (9). 44. Ael Rhmn, A. M., Ryzko, M., Pwling, J. & Dennis, J. W. Proing the hexosmine iosyntheti pthwy in humn tumor ells y multitrgete tnem mss spetrometry. ACS Chem. Biol. 8, (213). 45. Ael Rhmn, A. M. et l. Golgi N-glyn rnhing N- etylgluosminyltrnsferses I, V n VI promote nutrient uptke n metolism. Glyoiology, 2 24 (215). 46. Ael Rhmn, A. M., Pwling, J., Ryzko, M., Cuy, A. A. & Dennis, J. W. Trgete metolomis in ulture ells n tissues y mss spetrometry: metho evelopment n vlition. Anl. Chim. At 845, (214). 47. Wu, X. et l. Inrese BRAF heteroimeriztion is the ommon pthogeni mehnism for noonn synrome-ssoite RAF1 mutnts. Mol. Cell. Biol. 32, (212). 48. Gross, S. et l. Cner-ssoite metolite 2-hyroxyglutrte umultes in ute myelogenous leukemi with isoitrte ehyrogense 1 n 2 muttions. J. Exp. Me. 27, (21). 49. Wr, P. S. et l. The ommon feture of leukemi-ssoite IDH1 n IDH2 muttions is neomorphi enzyme tivity onverting α-ketoglutrte to 2- hyroxyglutrte. Cner Cell 17, (21).. Sinh, A., Ignthenko, V., Ignthenko, A., Meji-Guerrero, S. & Kislinger, T. Inepth proteomi nlyses of ovrin ner ell line exosomes revels ifferentil enrihment of funtionl tegories ompre to the NCI 6 proteome. Biohem. Biophys. Res. Commun. 445, (214). 51. Cox, J. & Mnn, M. MxQunt enles high peptie ientifition rtes, iniviulize p.p..-rnge mss uries n proteome-wie protein quntifition. Nt. Biotehnol. 26, (8). 52. Ueshi, N. D. et l. Methos for quntifition of in vivo hnges in protein uiquitintion following protesome n euiquitinse inhiition. Mol. Cell. Proteomis 11, (212). 53. Thompson, A. et l. Tnem mss tgs: novel quntifition strtegy for omprtive nlysis of omplex protein mixtures y MS/MS. Anl. Chem., (3). 54. Senko, M. W. et l. Novel prllelize qurupole/liner ion trp/oritrp triri mss spetrometer improving proteome overge n peptie ientifition rtes. Anl. Chem. 85, (213). 55. Ting, L., R, R., Gygi, S. P. & Hs, W. MS3 elimintes rtio istortion in isori multiplexe quntittive proteomis. Nt. Methos 8, 9 94 (211). 56. MAlister, G. C. et l. MultiNoth MS3 enles urte, sensitive, n multiplexe etetion of ifferentil expression ross ner ell line proteomes. Anl. Chem. 86, (214). 57. Eng, J. K., MCormk, A. L. & Ytes, J. R. An pproh to orrelte tnem mss spetrl t of pepties with mino i sequenes in protein tse. J. Am. So. Mss Spetrom. 5, (1994). 58. Elis, J. E. & Gygi, S. P. Trget-eoy serh strtegy for inrese onfiene in lrge-sle protein ientifitions y mss spetrometry. Nt. Methos 4, (7). 59. Huttlin, E. L. et l. A tissue-speifi tls of mouse protein phosphoryltion n expression. Cell 143, (21). 6. Shnnon, P. et l. Cytospe: softwre environment for integrte moels of iomoleulr intertion networks. Genome Res. 13, (3). 61. Mere, S., Heymns, K. & Kuiper, M. BiNGO: Cytospe plugin to ssess overrepresenttion of gene ontology tegories in iologil networks. Bioinformtis 21, (5). 62. Shermn, B. T. et l. DAVID Knowlegese: gene-entere tse integrting heterogeneous gene nnottion resoures to filitte high-throughput gene funtionl nlysis. BMC Bioinformtis 8, 426 (7). NATURE CELL BIOLOGY

15 SUPPLEMENTARY INFORMATION DOI: 1.138/n36 MDA-MB-361 Supplementry Figure 1 hptp1b kd mptp1b kd kd JIMT1 hptp1b kd kd 1% FBS Low Gluose (.5g/L) EGF (2ng/ml): pstat3 pakt (S473) AKT1 perk PTP1B RASGAP kd kd kd kd kd kd kd No Glutmine e f JIMT1 Control Control Supplementry Figure 1 PTP1B-knokown () in HER2 + rest ner (BC) ells oes not ffet prolifertion in vitro., Immunolot showing PTP effiieny n expression of WT mptp1b WT n tlytilly impire mutnt (RM) in HER2 + BC ells., Growth urves of Control n HER2 + BC ells in norml mei (DMEM or RMPI+1%FBS, s inite; see Methos). Dt points represent men vlues from three inepenent experiments one on ifferent ys; see Supplementry Tle 8 for rw t., Growth urves of the inite ells mintine in low serum (1% FBS), low gluose (.5g/L) or no glutmine onitions. Shown re t from three (low serum, low gluose) or two (low glutmine) inepenent experiments; see Supplementry Tle 8 for rw t., Immunolot showing EGF-inue signling events in Control n ells. A similr lk of effet of PTP1B-efiieny on ownstrem signling omponents ws seen using the other lines, s well s in response to multiple other gonists. e, Representtive imges (4x mgnifition) n quntifition of soft gr olonies forme y Control n HER2 + BC ells. Dt from two inepenent experiments re shown. f, Representtive imges (1x mgnifition) of olonies forme y ontrol n HER2 + BC ells in Mtrigel. Sle rs represent mm. Results represent men ± s.e.m.. Note tht PTP1B efiieny hs no onsistent effet on HER2 + rest ner ell prolifertion in 2D- or 3D-ultures. 1

16 S U P P L E M E N TA R Y I N F O R M AT I O N Supplementry Figure 2 H&E BrU (Prolifertion) EF5 (Hypoxi) CD31 MMTV-NeuNT; PTP1B WT 9 months 2x MMTV-NeuNT; PTP1B KO 1x H&E BrU * CD31 p= A2312 A3529 C2819 C296 Ptp1 -/- mie A2313 C2826 A2326 C2859 C Ptp1 +/+ mie A A C2819 C296 Ptp1 -/- mie 1. A2313 A C2826 Ptp1 +/+ mie.2 A2312 A3529 C C296 Ptp1 -/- mie A A2326 C2826 C C C2859 Positive Stining/Are (%) Ptp1 +/+ mie Positive Stining/Are (%). Are ( μm3 ) EF5 8. Positive Stining/Are (%) 5. Ptp1 +/+ mie A2312 A C2819 C296 Ptp1 -/- mie 1. A2313 A2326 C C2859 C C Hyperplsti Lesions Hype rplsti Lesions Supplementry Figure 2 Ptpn1-/-; MMTV-NeuNT mie exhiit more hypoxi hyperplsti lesions n elye tumourigenesis., Kpln-Meier urves showing perent survivl of Ptpn1+/+; MMTV-NeuNT (3) n Ptpn1-/-; MMTV-NeuNT (2) mie in mixe (129/B6/FVB) kgroun.. Numer of hyperplsti lesions per mmmry gln in Ptpn1+/+; MMTV-NeuNT (n=8) n Ptpn1-/-; MMTV-NeuNT mie t 9 months (n=1)., Representtive imges of hyperplsti lesions from Ptpn1+/+; MMTV-NeuNT n Ptpn1-/-; MMTV-NeuNT mie, stine for H&E, BrU (prolifertion), EF5 (hypoxi) n CD31 (ngiogenesis). Sle rs in 1X mgnifitions represent mm; sle rs in 2x mgnifition represent mm. Exmples of positive stining re inite y re rrows., Perentge of ells positive Hype rplsti Lesions T NT M Ptp TV 1 N / eu ; N M M Ptp TV 1 N +/+ eu ; M NT NT M Ptp TV 1 N / eu ; M M Ptp TV 1 N +/+ eu ; M M Ptp TV 1 N +/+ eu ; NT M Pt M p TV 1 N / eu ; N M M M Ptp TV 1 N +/+ eu ; NT M Pt M p TV 1 N / eu ; NT T.1 Hype rplsti Lesions for the inite stin in hyperplsti lesions from Ptpn1+/+; MMTV-NeuNT (n=3 lesions, otine from 4 mie) n Ptpn1-/-; MMTV-NeuNT (n=38 lesions, otine from 5 mie). Eh grph isplys iniviul t points from every mouse (inite y the olor oe), s well s the mein, interqurtile rnge (IQR) n whisker rs (1.5x IQR). Signifine ws etermine y using multi-level t-test (.k.., mixe effet/ hierrhil moel) tht onsiers the lesion mesurements from eh mouse seprtely efore ompring mouse level ggregte mesurements (*P<.5, preise vlues in figures). Note tht PTP1B efiieny oes not ffet the numer of hyperplsti lesions, ut is ssoite with inrese hypoxi. 2

17 SUPPLEMENTARY INFORMATION MDA-MB-361 MDA-MB-361 JIMT1 JIMT1 +m1b WT +m1b RM pakt (T38) pmek (S217/221) kd kd kd pakt (S473) perk (T22/Y24) ps6 (S235/236) kd kd kd pakt (S473) perk (T22/Y24) ps6 (S24/244) kd kd kd kd kd BrU (Prolifertion) CD31 (Angiogenesis) Ki67 (Cell Cyle) 11 Weeks 11 Weeks 11 Weeks JIMT1 JIMT1 8 Weeks 8 Weeks.4x 1x H&E.4x 1x +m1b WT BrU (Prolifertion) BrU (Prolifertion) CD31 (Angiogenesis) Ki67 (Cell Cyle) CD31 (Angiogenesis) * * p=.2 p=.39 JIMT1 Ki67 (Cell Cyle) EF5 (Hypoxi) e f Supplementry Figure 3 Chrteriztion of Control n rest ner xenogrfts., No pprent effet of PTP1B efiieny on reeptor tyrosine kinse signling. Immunolot shows levels of pakt (T38 n S473), pmek (S217/221), perk (T22/Y24), n ps6 (S24/244 or S235/236) in xenogrft lystes; totl levels serve s loing ontrols. Eh lne is from seprte tumour., Representtive imges of BrU, Ki67 n CD31 stining from, n + m1b WT xenogrfts t 11 weeks post-injetion., Representtive imges of H&E, BrU, CD31 n Ki67 from JIMT1 n JIMT1 xenogrfts t 8 weeks post-injetion. Insets n min imges in n represent.4x n 1x mgnifitions, respetively. Sle rs from.4x mgnifitions represent 1 mm; sle rs from 1x mgnifitions represent mm., Quntifition of BrU, CD31 n Ki67 stining from (n=6), (n=5), + mptpn1 WT (n=6), JIMT1 (n=6) n JIMT1 (n=6) tumours (from n ). Grphs represent men ± s.e.m., n were ompre y two-tile Stuent t-test (JIMT1) or one-wy ANOVA, followe y Bonferroni post-ho test (). e, f, Stter plot of EF5 stining vs tumour size from, JIMT1, n -inuile PTPN1-knokown xenogrfts (from Fig. 1). Note tht HER2 + tumours, lthough smller, isply s muh or inrese EF5 stining ompre with their lrger prentl ounterprts. 3

18 SUPPLEMENTARY INFORMATION.1% O 2 Hypoxi (hrs).1% O 2 Hypoxi (hrs) Supplementry Figure 4 Hrs 24 Hrs 48 Hrs Hrs 24 Hrs 48 Hrs Live Cells Apoptoti Cells Neroti Cells De Cells SytoxBlue - ; Annexin V - SytoxBlue - ; Annexin V + SytoxBlue + ; Annexin V - SytoxBlue + ; Annexin V + * * p=. p<.1 * p=.29 Neroti n De Cells SytoxBlue + ; Annexin V +/- p=.1 * * p<.1.1% O2 (hrs): um Chloroquine kd S6-p(S24/244) LC3-I 15kD LC3-II kd p=.19 * p=.22 *.1% O2 (hrs): um Chloroquine S6-p(S24/244) LC3-I LC3-II kd 15kD kd e +m1b WT.1% O 2 (hrs): HIF1α eif2α kd kd kd mptp1 kd PTP1B ERK-p PDH-p PDH kd kd kd kd kd f g % O (hrs): 8 PERK eif2α-ps51 eif2α kd kd kd hptp1b kd kd Supplementry Figure 4 PTP1B-efiient HER2 + BC ells unergo nonpoptoti ell eth in hypoxi (.1% O 2 ), ut tivte known hypoxi response pthwys normlly., Representtive flow ytometri plots of Sytox lue (DNA stin) n Annexin V stining of Control n HER2 + BC ells expose to.1% O 2 for the inite times., Quntifition of Annexin V n Sytox Blue popultions from (n=4 iologilly inepenent smples; lso see Supplementry Tle 8). Grphs inite men perentge of ells ± s.e.m. Sttistil signifine ws evlute y two-wy ANOVA, followe y Bonferroni post-ho test., No onsistent effet on mtor pthwy or utophgy in PTP1B-efiient HER2 + BC ells. Immunolots show utophgi flux (y LC3 stining) n mtor-epenent signling (y ps6 S24/244) in Control n HER2 + BC ells, following exposure to.1% O 2 for the inite times., Preoious HIF1 stiliztion in PTP1B-efiient HER2 + BC ells. Immunolots show HIF1 levels n ownstrem PDH phosphoryltion in Control n HER2 + BC ells following exposure to hypoxi (.1% O 2 ), s inite; these finings oul e expline y the inrese oxygen onsumption in PTP1B-efiient ells, resulting in erly HIF tivtion. e, Stter plot showing level of expression of 84 hypoxi genes (ssesse y qpcr rry) in the inite Control n HER2 + BC ells expose to.1% O 2 for 8 hrs ( n ) or 24 hrs ( n MDA-MB-361). Arry ws ssesse one for eh set of ell lines. f, Expression levels of known HIF1 trget genes VEGFA, GLUT1, CA9, PDK1 n REDD1 normlize to RPL13A from Control n HER2 + BC ells expose to.1% O 2 s inite. For, eh gene ws mesure in three iologilly inepenent replite experiments. For the other lines, t from single experiment re shown. For rw vlues, see Supplementry Tle 8. g, PTP1B-efiient HER2 + ells show preoious tivtion of UPR. Immunolot shows PERK tivtion, s ssesse y eif2 phosphoryltion, in Control n BC ells in response to exposure to hypoxi (.1% O 2 ), s inite. n eif2 serves s loing ontrols. 4

19 SUPPLEMENTARY INFORMATION +m1b WT.1% O 2 (hrs): kd Complex V: (C-V-) ATP5A kd Complex III: (C-III-Core 2) UQCRC2 kd Complex II: (C-II-3) SDHB 2kD Complex IV (C-IV-II) Cytohrome C oxise Suunit II 2kD SOD1 Mitotrker Green MDA-MB-361 Mitotrker CMX-ROS MDA-MB-361.1% O 2 (hrs): Glutminse Glutthione Synthetse Glutmte Dehyrogense Glutmte Cysteine Ligse kd kd kd kd kd kd Supplementry Figure 5 Mitohonril mss n levels of glutmte metolism enzymes re unffete y PTP1B efiieny., Immunolots show levels of the inite mitohonril proteins in Control n HER2 + BC ells uner normoxi or.1% O 2, s inite. SOD1 serves s loing ontrol., Totl n tive mitohonri in Control n ells were quntifie y stining with Mitotrker green or CMXROS, respetively, n flow ytometri nlysis. Grphs represent geometri men fluoresent intensity ± s.e.m. Dt points re from four iologilly inepenent experiments. See Supplementry 8 for rw t., Quntifition of mitohonril DNA (y qpcr) in Control n ells in normoxi or in.1% O 2 hypoxi. Dt re from one experiment; rw vlues re in Supplementry Tle 8., Immunolots show levels of glutmte metolism enzymes tht oul ffet -KG levels in Control n HER2 + BC ells; serves s loing ontrol. 5

20 SUPPLEMENTARY INFORMATION Supplementry Figure 6 Normoxi (24hrs).1% O 2 Hypoxi (24hrs) +m1b WT +m1b WT Normoxi (18hrs).1% O 2 Hypoxi (18hrs) * * Color Rnge Color Rnge Z-Sore Z-Sore Component 2 (13.%) - Normoxi +mptp1b WT.1% O 2 Hypoxi Component 1 (46.21%) e.1% O 2 Hypoxi Gluose Frutose-6-P Frutose-1,6-P G3P DHAP 3PG 2PG PEP Legen * 2-Fol Chnge of Compre to Prentl f +sicontrol: +siidh1: IDH kd kd IDH1 IDH2 Ativity Ativity.1% O 2 Hypoxi Normoxi Ltte Pyruvte Aetyl-CoA Component 2 (26.1%) 3 - Oxloette Mlte Fumrte Suinte Citrte Isoitrte α-ketoglutrte Suinyl-CoA Glutmte Glutmine IDH1 IDH2 Ativity Ativity Component 1 (33.89%) Supplementry Figure 6 PTP1B efiieny lters the metolite profile in n ells., Het mp n () prinipl omponents nlysis (PCA) showing levels of ~139 metolites (etermine y LC-MS/ MS; see Methos) in Control,, n +m1b PTP1B WT ells fter 24hr in normoxi (21% O 2 ) or hypoxi (.1% O 2 )., Het mp n () PCA showing levels of ~139 metolites, in Control n ells in normoxi (21% O 2 ) or hypoxi (.1% O 2 ) for 18hrs. Note the PTP1B-epenent erese in -KG in oth ell lines (re sterisk). e, Shemti showing >2-fol ifferenes in glyolyti n TCA metolites in Control n n ells expose to.1% O 2 hypoxi; t in normoxi re shown in Fig. 4. f, IDH tivity ws mesure in lystes of Control n n ells trnsfete with Control or IDH1 sirnas. Dt were erive from single experiment with three replite mesurements t eh time point. Rw t of inepenent repets re in Supplementry Tle 8. Ativity seen fter IDH1 knokown represents IDH2 tivity; the ifferene in tivity etween totl n IDH1 knokown ells represents IDH1 tivity. immunolot serves s loing ontrol. 6

21 SUPPLEMENTARY INFORMATION +Flg-m1B WT: +Flg-m1B CS/DA: ng/ml EGF (mins): EGFR kd Flg eif2α IP: Flg Lyste kd kd + Flg-mPtp1B WT + Flg-mPtp1B CSDA.1% O 2 Hypoxi (Hrs) Protein Size (kd) Hrs Hrs 1.5 Hrs 24 Hrs Hrs 1.5 Hrs 24 Hrs PTP1B kd kd ERBB2 138 kd RHG12 96 kd DHRS2 27 kd Flg-mPtp1B WT: +Flg-mPtp1 CS/DA: ARHGAP12 Flg IP: Flg kd kd +sicontrol: +siarhgap12: ARHGAP kd kd e +sicontrol: si: % O 2 (hrs): IOXI (um, 24hrs): HIF1α P564-OH HIF1α kd kd kd kd kd kd * p=.2 * p=.48 f +sicontrol: si: % O 2 (hrs): IOXI (um, 8hrs): HIF1α P564-OH HIF1α kd kd kd kd kd kd * p=.58 * p=.13 g h +shcontrol: #1 #2 # #1 #2 # sh: #6 #7 # #6 #7 #3 +shcontrol #1: sh #7: kD kd 46kD kd i j.1% O 2 (24hrs) k.1% O 2 (24hrs) l m +4uM PTP1Bi (24 Hrs) +sicontrol: si: pe Empty Vetor: pe HA-U: uM MG132 +um Chloroquine (3hrs): kd HA (HA-U) +sicontrol: +si: +pe- Empty Vetor: HA-U: um Chloroquine + 1uM MG132 (3hrs): kd HA (HA-U) pe- Empty Vetor: HA-U: IOXI (um, 24hrs): kd HA (HA-U) HA-Uiquitin IP LFQ+pINT 24 PTPN1-KD (69 ) KD PTPN1-KD (29 ) -KD 121 (333) DiGly (KGG) IP KGG 11 PTPN1-KD (383 ) KD PTPN1-KD (8 ) -KD 5 (28) Totl Proteins Ientifie: 5 Totl Proteins Ientifie: 16 PTPN1-KD Depenent : 41% 55% is Depenent PTPN1-KD Depenent : 24% 73% is Depenent Supplementry Figure 7 is puttive PTP1B sustrte n regultes hypoxi survivl n glol uiquityltion., PTP1B sustrtetrpping mutnt (CS/DA) ientifies known PTP1B sustrte, EGFR, in ells. Cell lines were strve for 16 hours, then re-stimulte with EGF (ng/ml), s inite. Flg-mPTP1B WT- n CS/DA-expressing ells were lyse n sujete to nti-flg immunopreipittions. Immune omplexes n totl ell lystes were immunolotte with nti-egfr or nti-flg ntioies., Numers of pepties (etermine y LC-MS/MS) from proteins oun to WT Flg-mPTP1B or Flg-mPTP1B CS/DA, expresse in BC ells in normoxi (21% O 2 ) or hypoxi (.1% O 2 )., ARHGAP12 immunolot of nti-flg o-immunopreipittes from, + Flg-mPTP1B WT- or CS/DA-expressing ells., Effet of ARHGAP12 knokown on Control n ell survivl fter 24hr exposure to normoxi or.1% O 2. Note epletion of ARHGAP12 t 72hr post-trnsfetion with ARHGAP12 sirnas. e,f, Immunolots showing HIF1 P564 hyroxyltion in Control n (n=3 iologilly inepenent smples) n (n=6 iologilly inepenent smples) ells, with or without -KD, in normoxi or.1% O 2. Grphs (men ± s.e.m.) were ompre two-wy ANOVA, followe y Bonferroni post-ho test (See Supplementry Tle 8). g, Immunolot of from Control or ells expressing or ontrol shrnas. h, Immunolot showing in xenogrfts (from Fig. 6g). i, Stter plot of EF5 stining vs tumour size from xenogrfts (from Fig. 6g-i). Immunolot of HA-uiquitin (HA-U) from ells trete with or without PTP1B inhiitor for 24 hrs (j) or Control n ells trnsfete with sicontrol or si n empty vetor or HA-U, expose to.1% O 2 for 24 hrs (k), n trete with or without protesoml (MG132) n lysosoml (hloroquine) inhiitors for 3 hrs (from Fig. 7, ). l, HA-U immunolots from Control n PTP1B-efiient ells trete with IOXI for 24hrs. n eif2 s loing ontrols. m, Venn igrm showing numer of proteins with 1.5-fol inrese uiquityltion upon PTPN1-KD lone,.67-fol erese uiquityltion upon -KD lone or tht re ffete reiprolly y PTPN1- n -KD, s revele y HA-U IP-MS or DiGly enrihment; see Supplementry Tle

22 SUPPLEMENTARY INFORMATION IP: Flg Blot: α IP: Flg Blot: αflg +Flg-mPtp1 +Flg-mPtp1 WT CS/DA.1% O 2 (hrs): kD 268kD 238kD 171kD 117kD kd kd kd kd kd kd Fig. 6 FlgmPTP1B α py (4G1) +shcontrol: +shptp1b: 46kD 268kD 238kD 171kD 117kD 46kD 268kD 238kD 171kD 117kD IP: IgG IP: G1 +shcontrol: shptp1b: kD 268kD 238kD 171kD 117kD 71kD 46kD 268kD 238kD 171kD 117kD IP: IgG Fig. 6 IP: 4G1 Supplementry Figure 8 MDA-MB-361 +shcontrol: shptp1b: kD 268kD 238kD 171kD 117kD 71kD 46kD 268kD 238kD 171kD 117kD IP: IgG IP: 4G1 kd 71kD 71kD 71kD IP: Flg Fig. 6 - N 3 VO 4 +N 3 VO 4 Lyste +Flg-m1B WT: Flg-m1B DA: Flg-m1B CS/DA: sicontrol: si: Fig. 6 MDA-MB MDA-MB sicontrol: si: kD 268kD 238kD α 46kD 268kD 238kD 46kD 268kD 238kD α 171kD 171kD 117kD 171kD 117kD 117kD +sicontrol: +si: MDA-MB MDA-MB kd kd kd kd kd kd αflg kd kd kd Flg-mPTP1B α kd kd kd kd e kd IP: Flg IP: Flg Fig. 7g IP: Flg +Empty Vetor: +3xFlg- WT: Empty Vetor: +3xFlg- WT: Empty Vetor: +3xFlg- WT: shcontrol: +shptpn1: shcontrol: +shptpn1: shcontrol: +shptpn1: U (n) 46kD 46kD 268kD 238kD 268kD 238kD 171kD 46kD 268kD 238kD 171kD kd 117kD 171kD kd kd 117kD kd 71kD 117kD 71kD Blot: Blot: α Blot: αflg Pre- U Assy Post- U Assy Supplementry Figure 8 Unproesse lots of key figures., Immunolots from Fig 6 showing tht interts with PTP1B sustrtetrpping mutnt (CS/DA)., Immunolots from Fig.6 showing oimmunopreipittion of with Flg-mPtp1B WT or ifferent sustrte-trpping mutnts in the sene n presene of vnte, generl ompetitive inhiitor of protein-tyrosine phosphtses., Immunolots from Fig. 6 showing phospho-tyrosine levels of immunopreipittes from Control n, n MDA-MB-361 ells., Immunolots showing levels in Control n HER2 + BC ells trnsfete with sicontrol or si (from Fig. 6). e, Immunolot showing utouiquityltion tivity of Flg- immunopreipittes from Control n ells (from Fig. 7g). Re oxes inite roppe portions tht pper in the min figures. 8