RNAi-mediated downregulation of NOB1 suppresses the growth and colony-formation ability of human ovarian cancer cells

Transcription

1 Med Oncol (2012) 29: DOI /s ORIGINAL PAPER RNAi-mediated downregulation of NOB1 suppresses the growth and colony-formation ability of human ovarian cancer cells Yang Lin Shuai Peng Hansong Yu Hong Teng Manhua Cui Received: 12 October 2010 / Accepted: 27 December 2010 / Published online: 2 February 2011 Ó Springer Science+Business Media, LLC 2011 Abstract Nin one binding protein (NOB1p), encoded by the NOB1 gene, is a crucial molecule in the maturation of the 20S proteasome and protein degradation. The present study evaluates whether NOB1 is an appropriate molecular target for cancer gene therapy. In two ovarian cancer cell lines, SKOV3 and HEY, NOB1 expression was knocked down by a lentiviral short hairpin RNA (shrna) delivery system. The RNA interference (RNAi)-mediated the downregulation of NOB1 expression markedly reduced the proliferative and colony-formation ability of ovarian cancer cells. Additionally, NOB1 shrna-expressing lentivirus-treated ovarian cancer cells tended to arrest in the G0/ G1 phase. These results suggested that NOB1 may act as an oncogenic factor in ovarian cancer and could be a potential molecular target for ovarian cancer gene therapy. Keywords shrna NOB1 Ovarian cancer Lentivirus Cellular proliferation Introduction Protein degradation is an important process tightly regulated by a diverse group of proteases. [1]. The degradation Yang Lin and Shuai Peng contributed equally to this work. Y. Lin H. Teng M. Cui (&) Department of Gynaecology and Obstetrics, The Second Hospital of Jilin University, No. 257 Ziqiang Street, Nanguan District, Changchun, Jilin Province, China manhuacui@163.com S. Peng H. Yu College of Food Science and Engineering, Jilin Agricultural University, Jilin, China of a protein via the ubiquitin proteasome pathway (UPP) involves two successive steps: (1) the covalent linkage of multiple ubiquitin molecules to the substrate and (2) the degradation of the polyubiquitinated protein by the 26S proteasome complex with the release of free and reusable ubiquitin [2]. The 26S proteasome is a biological macromolecule consisting of two parts: the 19S regulatory particle (RP or PA700), which confers ATP dependency and ubiquitinated substrate specificity on the enzyme, and the 20S proteasome (CP), which forms the proteolytic core [3]. Numerous studies have shown that the ubiquitin (Ub) pathway plays a critical role in regulating essential cellular processes, such as gene transcription and signal transduction [4]. The Ub pathway also takes part in the modulation of protein turnover in the cell cycle; thus, this process is commonly mutated and is involved in cancer development, especially in malignant tumors [3, 5]. NOB1 was first identified in Saccharomyces cerevisiae as an essential gene encoding the Nin one binding protein (NOB1p), which can interact with Rpn12p, as demonstrated previously by a two-hybrid assay [6]. The nuclear protein NOB1p serves as a chaperone to join the 20S proteasome with the 19S regulatory particle in the nucleus and facilitates the maturation of the 20S proteasome. Therefore, the function of NOB1p is necessary for UPPmediated proteolysis [7]. A recent study in chronic myeloid leukemia (CML) reveals that NOB1, along with five other genes, can be used as a diagnostic marker discriminating chronic phase (CP) from blast crisis (BC) CML [8]. Also, our previous investigation on ovarian cancer indicated that the expression levels of NOB1 in ovarian cancer tissues were remarkably higher in contrast to those of controls (data not shown), indicating that NOB1 may act as an oncogenic factor in ovarian cancer.

2 312 Med Oncol (2012) 29: To test our hypothesis, we applied RNA interference (RNAi) technology to knock down the expression of NOB1 in two ovarian cancer cell lines, and we then investigated the proliferation, cell cycle and colony-formation capacity in both cell lines. Our data revealed that the inhibition of NOB1 significantly decreased proliferation in both cell lines, providing us with a future target for therapy. Materials and methods Lentiviral vector production Small interfering RNA (sirna) targeting NOB1 sequence (AAGGTTAAGGTGAGCTCATCG) and non-silencing sequence (AATTCTCCGAACGTGTCACGT) were transformed into short hairpin RNA (shrna) (stem loop stem structure) and were cloned into plv-thm-lentiviral vectors with BamHI/EcoRI sites. Then, the recombined plv- THM-lentiviral vector and two-helper vector system (GeneChem Co. LTD., Shanghai, China) were transfected into HEK293T cells via Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) to generate lentivirus. After 3 days of incubation, the lentivirus from culture medium was collected and concentrated with Centricon-plus-20 (Millipore, Billerica, MA, USA). Cell culture and infection SKOV3 and HEY cells were received from the American Type Culture Collection (ATCC). Cells were grown in DMEM (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), 2 mm L-glutamine and 1% penicillin/streptomycin at 37 C with 5% CO 2. For lentivirus infection, SKOV3 and HEY cells were cultured in 6-well plates. Then, NOB1 shrna-expressing lentivirus (sh-nob1) or nontargeting shrna-expressing lentivirus (control) was added, with a multiplicity of infection (MOI) of 10 in SKOV3 cells and 20 in HEY cells. After 72 h of infection, cells were observed under fluorescence microscopy (MicroPublisher 3.3RTV; Olympus, Tokyo, Japan). Quantitative real-time PCR SKOV3 and HEY cells were cultured in 6-well plates and were then infected with lentivirus for 72 h. Total RNA was isolated from cultured cells by Trizol reagent (Invitrogen, Carlsbad, CA, USA). cdna was synthesized from total RNA with random primers following the manufacturer s protocol (MBI Fermantas, Vilnius, Lithuania). Two sets of primers were used for PCR. Primers were designed by Beacon Designer 7 software (Premier Biosoft International, Palo Alto, CA, USA) as follows: Actin-F, 5 0 -CGGCATTG TCACCAACTG-3 0, Actin-R, 5 0 -CGCTCGGTCAGGATCT TC-3 0 ; NOB1-F, 5 0 -ATCTGCCCTACAAGCCTAAAC-3 0, NOB1-R, 5-TCCTCCTCCTCCTCCTCAC-3 0. The SYBR Green Real-Time PCR assay kit (TAKARA, Otsu, Japan) was used, and quantitative real-time PCR (qrt-pcr) was performed according to the ABI manufacturer s protocols (Perkin Elmer Corp./Applied Biosystems, Foster City, CA, USA). Fluorescence was analyzed by using the Light Cycler Software version 3.5 (Roche Diagnostics, Meylan, France). All samples were examined in triplicate. Western blot analysis Total protein was isolated from whole cells using ice-cold protein lysis buffer (1% Triton X-100; 50 mm Tris HCl, ph 7.4; 150 mm NaCl; 0.1% SDS; 1 mm PMSF; 1 mm EDTA). This was followed by 30 min of incubation on ice and centrifugation at 10,000 9 g for 10 min at 4 C. Protein concentration was determined by BCA protein assay (Pierce, Rockford, IL, USA). Protein extracts were separated on a SDS-polyacrylamide gel, blotted onto a nitrocellulose membrane and incubated with anti-nob1p antibody (Abcam, Cambridge, UK) or anti-actin antibody (Santa Cruz, CA, USA). Western blotting was developed using horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and was detected with enhanced chemiluminescence reagent (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Methylthiazoletetrazolium cell proliferation assay Cells infected with NOB1 shrna lentivirus (sh-nob1) or non-silencing shrna lentivirus (control), along with nontreated cells, were seeded in a 96-well plates at a density of 2,000 cells per well. At indicated time points, 20 ll methylthiazoletetrazolium (MTT) solution (5 mg/ml) was added into each well. After 4 h of incubation at 37 C, 150 ll dimethyl sulfoxide (DMSO) was added to dissolve the crystals. After 10 min at room temperature, the absorbance was recorded at 570 nm. BrdU incorporation assay Cells infected with sh-nob1 or control, along with nontreated cells, were cultured in 96-well plates with 2,000 cells per well. A 5-bromodeoxyuridine (BrdU) incorporation assay was performed by using the BrdU Cell Proliferation Assay kit (Chemicon, Temecula, CA, USA). Briefly, 20 ll of 1/500 diluted BrdU was added, and the

3 Med Oncol (2012) 29: assay was incubated for 8 h. Then, 100 ll of 1/200 diluted anti-brdu and peroxidase-conjugated goat anti-mouse IgG antibodies were used successively, according the manufacturer s instructions. The plates were washed, and then 100 ll TMB Peroxidase Substrate was added. Plates were read at a dual wavelength of 450/550 nm, and the growth rate of cells was calculated by the following equation: Growth rate ¼ ðod 48h OD 24h Þ=OD 24h : FACS analysis Cells were cultured in 6-well plates and were then treated with sh-nob1 or control. At the indicated time point, cells were collected by centrifugation at g for 5 min, were washed twice with PBS, and were fixed in ethanol. Then, cells were rehydrated and resuspended in PBS containing RNase-A (100 lg/ml) on ice. After an additional incubation at room temperature for 30 min, cells were stained with propidium iodide (PI) and were then analyzed by BD FACS Calibur Flow Cytometer (BD Biosciences, San Diego, CA, USA). Colony-formation assay Three groups of cells (sh-nob1, control and non-infected cells) were plated in 6-well plates at a concentration of 200 cells per well. Cells were allowed to grow for 14 days to form colonies. At the indicated time point, cells were washed twice with PBS, treated with Giemsa for 10 min, washed three times with ddh 2 O, and then photographed with a digital camera. The number of colonies ([50 cells/ colony) were counted under fluorescence microscopy (MicroPublisher 3.3RTV; Olympus, Tokyo, Japan). Statistical analysis The data shown are presented as the mean ± standard deviation (SD) of three independent experiments. Statistical significance was determined with Student s t test. A P value of less than 0.05 was considered significant. Results Knockdown of NOB1 by shrna lentivirus system in ovarian cancer cells To investigate the role of NOB1 in ovarian cancer, shrna targeting NOB1 or non-silencing sequences were cloned into plv-thm-lentiviral vector, respectively. Then, NOB1 shrna lentivirus or non-silencing shrna lentivirus expressing GFP were generated and infected into two ovarian cancer cell lines, SKOV3 and HEY cells. As shown in Fig. 1a, the infection efficiency of lentivirus was greater than 80% after 72 h of infection. The qrt-pcr assay suggested that NOB1 mrna level was reduced by about 70% in both cell lines treated with NOB1 shrna lentivirus, as compared with the control group (Fig. 1b). We also determined the level of NOB1p protein in cells after 72 h of lentivirus infection via western blot analysis. In SKOV3 and HEY cell lines, the protein expression of NOB1p was significantly reduced by about 50% through NOB1 shrna lentivirus treatment (Fig. 1c). NOB1 is important for ovarian cancer cell growth To further assess the role of NOB1 in regulating ovarian cancer cell proliferation, MTT assays were performed on both SKOV3 and HEY cells following lentivirus infection for 72 h. Figure 2a shows that there were no statistically significant differences in viability between control cells and non-infected cells, indicating that the lentiviral system itself had no cytotoxic effect on cells, whereas the viability of HEY cells was markedly inhibited by NOB1 knockdown (P \ 0.05 compared to control). In another ovarian cancer cell line, SKOV3, the inhibitory effect of sh-nob1 on cell proliferation can be observed beginning on day 2; it became more obvious on days 4 and 5 (P \ 0.05 compared with the control). Moreover, BrdU incorporation assays also revealed that the inhibition of NOB1 expression significantly reduced the growth rate of SKOV3 and HEY ovarian cancer cells during the 48-h incubation period (P \ 0.05 compared with the control, Fig. 2b). These findings sustained the notion that the knockdown of NOB1 greatly diminished cell proliferative ability. Knockdown of NOB1 repressed cell colony formation We then studied the colony-formation capacity of SKOV3 cells treated by NOB1 shrna lentivirus. HEY cells were not used in this experiment because they could only form small colonies, as compared with SKOV-3 cells. Three groups of SKOV3 cells (sh-nob1, control and non-infected cells) were allowed to grow for 14 days to form colonies. As shown in Fig. 3a and b, NOB1 knockdown resulted in a nearly 0.3-fold decrease in the number of colonies, as compared with the two control groups (P \ 0.01), whereas no obvious difference in the number of colonies was found between control lentivirus-infected cells and non-infected cells. Inhibition of NOB1 induced G0/G1 arrest Knowing that the inhibition of NOB1 in both SKOV3 and HEY cells markedly slows cell proliferation, we further

4 314 Med Oncol (2012) 29: Fig. 1 NOB1 silencing efficiency by shrna lentivirus. a Lentivirus infection in ovarian cancer cell lines. Fluorescence photomicrographs of ovarian cells infected by lentivirus. Pictures were taken 72 h after infection at a magnification of b Identification of NOB1 knockdown efficiency using shrna lentivirus by real-time PCR in SKOV3 and HEY cells. c Identification of NOB1 knockdown efficiency using shrna lentivirus by western blot analysis. Reduced NOB1p protein levels in SKOV3 and HEY cells are shown. Actin was used as a loading control. (control: non-silencing shrna lentivirus; sh-nob1: NOB1 shrna lentivirus). * P \ 0.05 compared with the control Fig. 2 NOB1 is important for ovarian cancer cell proliferation. a NOB1 silencing by shrna lentivirus resulted in growth inhibition as detected by MTT assay in SKOV3 and HEY cells. Cells infected with NOB1 shrna lentivirus (sh-nob1) or non-silencing shrna lentivirus (control) for 72 h, along with non-treated cells, were seeded in a 96-well plates, and cell viability was determined at indicated time points. b NOB1 silencing by shrna lentivirus led to ovarian cell growth inhibition as detected by a BrdU incorporation assay. The growth rates in SKOV3 and HEY cells were calculated. All assays were performed in triplicate. * P \ 0.05 compared with the control employed cell-cycle analysis to uncover the mechanism governing the inhibitory effect of sh-nob1 on cell proliferation. As shown in Fig. 4, in SKOV3 cells, an obvious increase in G1-phase cell population (P \ 0.01) was observed in the sh-nob1 group accompanied by a slight decrease in the S-phase cell population, as compared with the two control groups. Moreover, HEY cells were slow to progress through the cell cycle, having a marked G0/G1 phase delay. Our results revealed that sh-nob1 exerted an inhibitory effect on ovarian cell proliferation via G0/G1

5 Med Oncol (2012) 29: cell-cycle arrest, indicating that NOB1 may promote cancer cell growth. Discussion Fig. 3 NOB1 silencing repressed ovarian cancer cell colony formation. a Photomicrographs of Giemsa-stained colonies of SKOV3 cells growing in 6-well plates for 14 days after infection. b The number of cells in each colony of SKOV3 cells was counted. Cell number in sh- NOB1 group was significantly reduced, as compared with the control group (* P \ 0.05) The cellular proteome is in a dynamic state consisting of synthesis and degradation. Degradation of extracellular proteins is mainly mediated non-specifically by the lysosomes or released proteases, while the proteolysis of intracellular protein, including nuclear proteins, is catalyzed by the ubiquitin proteasome pathway [9]. NOB1p is a nuclear protein involved in protein degradation and controlled proteolysis. NOB1p regulates the maturation of the 20S proteasome and is then degraded to complete 26S proteasome biogenesis [7]. In light of the important role of NOB1 and the critical function of ubiquitin-dependent proteolysis in universal biological processes, we assumed that NOB1 may influence oncogenesis through UPP-mediated protein degradation. A number of studies have underscored the link between UPP and cancer. Decades ago, a number of oncogene and suppressor gene products were found to be targets of ubiquitination. For example, nuclear oncoproteins, such as c-myc, c-fos, p53 and E1A, are among the most rapidly degraded intracellular proteins. In vitro studies show that Fig. 4 NOB1 silencing induced a G0/G1 arrest in ovarian cancer cells. a FACS histograms and cell-cycle analysis of SKOV3 and HEY cells following non-silencing shrna or NOB1 shrna lentivirus infection. b Quantification of the percentage of cells in cell-cycle phases G1, S, and G2/M. In the sh-nob1 group, an obvious increase in the G1-phase cell population and a significant decrease in the S-phase cell population was observed, as compared with the control group (* P \ 0.05)

6 316 Med Oncol (2012) 29: the ubiquitin system can mediate the degradation of these oncoproteins [10 12]. Also, a number of oncogenic mutations and suppressor gene disruptions have been shown to affect ubiquitination and proteasomal degradation [5]. In colorectal cancer, mutations at several points of the b-catenin gene disrupt its ubiquitination and degradation, leading to the accumulation of b-catenin in the cells [13]. Moreover, a clinical study investigating mantle cell lymphoma (MCL) shows that MCLs have normal p27 Kip-1 mrna expression but increased p27 Kip-1 protein degradation activity via the proteasome pathway, which is associated with a decreased overall survival in patients [14]. Therefore, the ubiquitin system may mediate the degradation of cancer-related genes that are important in tumorigenesis. However, the specific functions of the proteins in UPP, especially the roles of NOB1 in ovarian cancer, are still unclear. In this study, we presumed that NOB1 may act as an oncogenic factor in ovarian cancer development. Given the prevalence and availability of RNAi technology in cancer research or cancer therapy [15], we used a lentivirus shrna system that can effectively knock down the expression of NOB1 at both the RNA and protein levels. As shown in Fig. 1, qrt-pcr and western blot analysis showed sufficient silencing of NOB1, thus ensuring the credibility of the subsequent assays. Predictably, reduced expression of NOB1 in both ovarian cell lines greatly decreased cancer cell proliferation, as confirmed by MTT and BrdU cell proliferation assays (Fig. 2). We also proved that knockdown of NOB1 notably inhibited the colonyformation capacity of SKOV3 cells (Fig. 3). However, HEY cells did not easily form colonies in this assay, as reported previously [16]; thus, they were omitted. Together, these results indicate that NOB1 is important for ovarian cancer cell growth in the short or relative long term. We then applied a cell-cycle analysis by FACS, attempting to uncover the mechanism by which sh-nob1 controls ovarian cell growth. Intriguingly, our data reveal that sh-nob1 had an inhibitory effect on ovarian cancer cell growth via G0/G1 arrest (Fig. 4). In addition, the present study provided new evidence pertinent to the role and function of UPP-related proteins in cancer research. In this study, however, we did not discover exactly how NOB1 influences cancer cell proliferation. We inferred that the dysregulation of NOB1 may affect the Ub pathway and degradation of certain proteins that govern cell cycling, such as p27 Kip-1 or other cell-cycle regulators. For example, the levels of p27 Kip-1 are largely controlled by post-transcriptional ubiquitin-mediated degradation [17]. Therefore, aberrant regulation of NOB1 may eventually influence the levels of p27 Kip-1 and may disrupt cell growth control. To test this hypothesis, further research examining the interaction between NOB1p and its downstream target proteins is needed. Conclusion The present study proved for the first time that RNAimediated knockdown of NOB1 suppresses the growth and colony-formation ability of ovarian cancer cells. In addition, NOB1 inhibition arrests the cell cycle in the G0/G1 phase. Our data indicated that NOB1 may serve as an oncogene in ovarian cancer development. Therefore, NOB1 has considerable potential to be a new therapeutic target for the treatment of ovarian cancer. Acknowledgments The authors are thankful for financial support from the National Natural Science Foundation of China ( ) and Jilin Science and Technology Funds ( , and ). References 1. Simpson MV. The release of labeled amino acids from the proteins of rat liver slices. J Biol Chem. 1953;201: Glickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev. 2002;82: Ferrell K, Wilkinson CR, Dubiel W, Gordon C. Regulatory subunit interactions of the 26S proteasome, a complex problem. Trends Biochem Sci. 2000;25: Hershko A, Ciechanover A. The ubiquitin system. Annu Rev Biochem. 1998;67: Mani A, Gelmann EP. The ubiquitin-proteasome pathway and its role in cancer. J Clin Oncol. 2005;23: Tone Y, et al. Nob1p, a new essential protein, associates with the 26S proteasome of growing saccharomyces cerevisiae cells. Gene. 2000;243: Tone Y, Toh EA. Nob1p is required for biogenesis of the 26S proteasome and degraded upon its maturation in Saccharomyces cerevisiae. Genes Dev. 2002;16: Oehler VG, et al. The derivation of diagnostic markers of chronic myeloid leukemia progression from microarray data. Blood. 2009;114: Bader N, Jung T, Grune T. The proteasome and its role in nuclear protein maintenance. Exp Gerontol. 2007;42: Rogers S, Wells R, Rechsteiner M. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science. 1986;234: Ciechanover A, Finley D, Varshavsky A. Ubiquitin dependence of selective protein degradation demonstrated in the mammalian cell cycle mutant ts85. Cell. 1984;37: Ciechanover A, et al. Degradation of nuclear oncoproteins by the ubiquitin system in vitro. Proc Natl Acad Sci USA. 1991;88: Sparks AB, Morin PJ, Vogelstein B, Kinzler KW. Mutational analysis of the APC/beta-catenin/Tcf pathway in colorectal cancer. Cancer Res. 1998;58: Chiarle R, et al. Increased proteasome degradation of cyclindependent kinase inhibitor p27 is associated with a decreased

7 Med Oncol (2012) 29: overall survival in mantle cell lymphoma. Blood. 2000;95: Izquierdo M. Short interfering RNAs as a tool for cancer gene therapy. Cancer Gene Ther. 2005;12: Xu Y, Fang XJ, Casey G, Mills GB. Lysophospholipids activate ovarian and breast cancer cells. Biochem J 1995;309: Shirane M, et al. Down-regulation of p27(kip1) by two mechanisms, ubiquitin-mediated degradation and proteolytic processing. J Biol Chem. 1999;274: