Genomic complexity and AKT-dependence in serous ovarian cancer

Transcription

1 Genomic complexity and KT-dependence in serous ovarian cancer Hanrahan et al.- Supplementary Text and Figures Corresponding uthor: David B. Solit, Memorial Sloan-Kettering Cancer Center, Human Oncology and Pathogenesis Program, 275 York venue, Box 2, NY, NY 65. Phone: ; Fax: ; SUPPLEMENTRY METHODS Haplotype nalysis of Ovarian Cancer Cell Lines To exclude the potential for prior contamination or misidentification, all cell lines were subject to a MS-based genetic fingerprinting assay designed to screen 42 highly variable single nucleotide polymorphisms, covering all chromosomes as previously described (). The panel of 22 ovarian cancer cells lines were screened against each other and 247 other cell lines and tumors samples of varied lineages to ensure distinct identities. nimal Studies 6-8 week old nu/nu athymic female mice (Harlan Labs) were maintained in ventilated cages. Experiments were performed in accordance with approved ICUC protocols and animals were treated humanely in compliance with institutional guidelines. Tumors were generated by implanting x 7 cancer cells in a : mixture with media and groh factor-reduced Matrigel (BD Biosciences) into the right flank (2uL/mouse). Mice with well-established tumors were selected and randomized approximately 7-34 days postimplantation (size 5-2 mm 3 ), prior to treatment. The first treatment was then given (indicated as day on graphs) and tumor size was subsequently monitored and recorded every 3-4 days as indicated on the graph. KTi/2 was prepared in 25% hydroxypropyl

2 β-cyclodextrin ph 4-5, and administered subcutaneously at mg/kg once per day, M-F as previously determined (2). MK226 was formulated in 3% captisol and given orally at either 24mg/kg or 5mg/kg once per day, M-W-F based on unpublished dose response experiments and previous reports (3). PD3259 was formulated in.5% hydroxypropyl methylcellulose +.2% Tween 8 and administered by oral gavage at 2.5mg/kg, daily, M-F (). Control mice received a vehicle solution based on the formulation of KTi/2 or MK226, depending on which drug was used in the experiment. Tumors were measured by caliper and volume calculated such that mm 3 = π/6 x large diameter x (smaller diameter) 2. Significant p values <.5 were determined by unpaired, two-tailed student t-tests. n= mice per group for IGROV xenograft experiments +/- KTi/2 and MK226 (Supp. Fig. S2). n= 5 mice per group for OVCR5 xenograft combination experiment (Supp. Fig. S4). This OVCR5 xenograft combination study was repeated with analogous results. Tumors were excised and snap frozen in liquid nitrogen, homogenized in 2% SDS lysis buffer and processed for immunoblotting or fixed in 4%PF and processed for immunohistochemical studies. Lentiviral short hairpin infections OVCR-5 cells were infected with lentiviral, short hairpin constructs targeted to KT3 acquired from Dr. Hakim Djaballah and the High Throughput Sequencing Core Facility at MSKCC (shkt3: CCGGGCTGCTCTGTCTTCTTTCTCGGTTGTGCGTGCGCTTTTT; shkt3-6: CCGGGTCTGGCGTGTTTCTCGGTTCTCTTGCCGTTTCTTTTT) or a scrambled sequence (shrn control vector from Sigma-ldrich, SCH2: CCGGCCGTGGGCCCCTCGGTTGGTGCTCTTCTCTTGTTGTTTTT). Stable lines were

3 selected in puromycin for 2 weeks and subsequently tested for KT3 knockdown. OVCR-5 cell lines stably expressing shkt3 constructs or 6 or the scrambled control (OVCR5+ shkt3, +shkt3-6, +shscrmbled) were used for further analysis. SUPPLEMENTRY REFERENCES. Janakiraman M, Vakiani E, Zeng Z, Pratilas C, Taylor BS, Chitale D, et al. Genomic and biological characterization of exon 4 KRS mutations in human cancer. Cancer Res 2;7: She QB, Chandarlapaty S, Ye Q, Lobo J, Haskell KM, Leander KR, et al. Breast tumor cells with PI3K mutation or HER2 amplification are selectively addicted to kt signaling. PLoS One 28;3:e Chandarlapaty S, Sawai, Scaltriti M, Rodrik-Outmezguine V, Grbovic-Huezo O, Serra V, et al. KT inhibition relieves feedback suppression of receptor tyrosine kinase expression and activity. Cancer Cell 2;9: Wolf CR, Hayward IP, Lawrie SS, Buckton K, McIntyre M, dams DJ, et al. Cellular heterogeneity and drug resistance in two ovarian adenocarcinoma cell lines derived from a single patient. Int J Cancer 987;39: Langdon SP, Lawrie SS, Hay FG, Hawkes MM, McDonald, Hayward IP, et al. Characterization and properties of nine human ovarian adenocarcinoma cell lines. Cancer Res 988;48:

4 Supplementary Table S Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancer Supplementary Table S. Identity scores for haplotype mapping of ovarian cancer cell lines. 22 ovarian cancer cell lines were subjected to haplotype analysis to distinguish unique cell lines. ll redundant cell lines had a Bonferroni correction of less than 9E signifying that the cell lines are genetically identical with an insignificant probability that they matched by chance (see Supplementary Methods). One pair of cells lines, PEO and PEO-4, were derived from the ascites of a single patient s poorly differentiated ovarian adenocarcinoma before and after acquisition of chemotherapy resistance, respectively (4, 5). This pair serves as an internal control for the analysis. Five additional cell lines mapped as genetically overlapping suggesting either prior cross contamination or mislabeling and were thus excluded from further analysis. The remaining 7 unique cell lines used for further analysis are listed, with genotypes, in Supplementary Table S2.

5 Supplementary Table S2 Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancer Cell Line PIK3C KT-3 PTEN ERBB H,N,KRS BRF MEK RB BG E545K SKOV-3 H47R amp OVCR-3 KT2:amp 278 K28- R3del IGROV KT2: V98 Y55C SKOV-6 KT2: V98 R3 R233 loss SKOV-8 KRS: amp OVCR-5 KRS: G2V ES V6E D67N OV-9 N486- P49del SKOV-433 W274G del COV-3 W274G loss OV847 KRS: P2H loss PEO-4 loss SK774 PEO TOV2d Supplementary Table S2. Mutational and copy-number analysis of 7 ovarian cancer cell lines. Mutational and copy-number analyses were performed on 7 unique ovarian cancer cell lines (see methods). Four genetically distinct groups were identified: cells with ) PI3k/KT pathway alterations (red), 2) RS/RF pathway aberrations (blue), 3) RB loss (green), 4) those wild-type for all the preceding genetic changes (black).

6 Supplementary Figure S Hanrahan et al.-genomic complexity and KT-dependence in ovarian cancer 3 ERBB2 amplification in SKOV-3 B KT2 amplification in OVCR-3 Copy number (log2) 2 Copy number (log2) 3 2 ERBB2 chr7: Chromosome 7 position (mb) KT2 chr9: Chromosome 9 position (mb) Supplementary Fig. S. Representative probe-level copy-number data for the ERBB2 and KT2 genes in two ovarian cancer cell lines. -B, Probe-level data (blue dots) and segmented data (red lines) from gilent 244K arrays identifying representative copy-number gains of ERBB2 and KT2 in SKOV-3 and OVCR-3 cells, respectively. The vertical green line crosses the x-axis at the chromosomal position of the gene. Y-axis indicates log2 copy-number expression.

7 Supplementary Figure S2 Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancer B IGROV (PTEN Y55C) xenograft IGROV xenograft IGROV xenograft V KTi/2 V MK p-kt S473 p-kt T38 KT Vehicle h KTi/2 6h C IGROV (PTEN Y55C) xenograft Vehicle KTi/2 mg/kg 5days/wk 5 H&E IGROV (PTEN Y55C) xenograft Vehicle MK226 24mg/kg MWF p-kt S473 Tumor Volume (mm 3 ) st dose p<. Tumor Volume (mm 3 ) st dose p< Days fter st Treatment Days fter st Treatment Supplementary Fig. S2. KT inhibition suppresses the groh of PTEN-mutant ovarian xenografts., Mice bearing established IGROV (PTEN-mutant) xenografts were treated with KTi/2 (mg/kg daily M-F), MK226 (MK; 24mg/kg 3days/week, M-W- F) or vehicle control (V), then euthanized 6h after the last administration of drug. The expression of phosphorylated KT (S473 and T38) was measured by immunoblot. B, Mice bearing IGROV xenografts were treated with one dose of vehicle (hr) or KTi- /2 (6hr; mg/kg), euthanized, and tumors excised and embedded in paraffin. H&E and immunohistochemical staining for p-kt (Ser473) are shown for representative tumors from vehicle and KTi/2 treated mice. C, Mice with established IGROV xenografts were treated as in (). Data points represent mean tumor volume +/- S.E (asterisks indicates significant tumor suppression vs. vehicle at time of sacrifice).

8 Supplementary Figure S3 Hanrahan et al.- Genomic complexity and KT-dependence in serous ovarian cancer OVCR-5 control no DN sintp sikt sikt2 sikt3 sikt+2 sikt+2+3 KT KT2 KT3 B IGROV % cells in sub-g phase 64h control no DN sintp sikt sikt2 sikt3 sikt+2 sikt+2+3 % cells in G phase 64h control no DN sintp sikt sikt2 sikt3 sikt+2 sikt+2+3 Supplementary Fig. S3. Efficiency of KT3 knockdown in OVCR5 cells and consequence of KT isoform knockdown in IGROV cells., Control sirn (sintp) or sirn against individual KT isoforms, alone or in combination, was transfected into OVCR-5 cells and incubated for 64h as in IGROV cells in Fig. 3D. Cell lysates were subject to immunoblotting with isoform specific KT antibodies. sirn transfection resulted in isoformspecific and efficient (>9%) knockdown of KT isoforms, including KT3. Therefore, although we view sikt3 transfection in IGROV cells in Fig. 3D as a control, we postulate that sikt3 may be functioning to abrogate any residual KT3 protein that may be below our threshold of detection. B, In IGROV cells, sirn was transfected as in Fig. 3D for 64h. Isoform-selective knockdown of KT, or combinations that included sikt, resulted in a cytostatic response as depicted by significant accumulation of cells in G phase (asterisks indicates p <., n > 3; same experiments as in Fig. 3D). No accumulation of cells in sub- G was observed following any single- or combination- of KT isoform knockdown.

9 Supplementary Figure S4 Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancer B OVCR-5 (KRS G2V) OVCR-5 (KRS G2V) % cells in sub-g at 72hr % cells in sub-g at 64hr DMSO PD9 5nM MK226 µm ZVD 2µM QVD 2µM PD + MK PD + MK + ZVD PD + MK + QVD Cl. caspase-3 DMSO nodn MK226 µm sintp sikrs sintp + MK sikrs + MK KRS p-erk Cl. PRP ERK p-kt S473 p-kt S473 p-erk KT ctinin p-s6 S24/244 C OVCR-5 (KRS G2V) xenograft Vehicle MK226 5mg/kg MWF PD9 2.5mg/kg M-F MK226 + PD9 7 6 V MK MK + PD PD 6hr p-kt S473 Tumor Volume (mm 3 ) st dose p<.4 p<.43 p-kt T38 KT p-erk ERK Days fter st Treatment Supplementary Fig. S4. Combined inhibition of KT and MEK in KRS-mutant, KT3 expressing OVCR-5 cells and xenografts., Induction of apoptosis in OVCR-5 cells at 72hr following combined treatment with 5nM PD9 and μm MK226 was inhibited by co-treatment with 2μM of the pan-caspase inhibitor ZVD-FMK or QVD-OPH as measured by FCS analysis. Treatment with ZVD/QVD also inhibited PD+MK treatment-induced cleaved PRP and cleaved caspase-3 at 72hr. sterisks indicate p<.28 vs. PD+MK treatment, n=3. B, Control sirn (sintp) or sirn against KRS were transfected into OVCR-5 cells, co-treated with μm MK226 and incubated for 64hr. Cells were collected for FCS analysis or subject to immunoblotting with the indicated antibodies. sterisk indicates significant increase [p=.3] vs. sikrs alone, n=3 each in duplicates). C, Mice bearing established OVCR-5 (KRS G2V) xenografts were treated with MK226 (MK; 5mg/kg, 3day/week, M-W-F), PD9 (2.5mg/kg, daily, M-F), the combination, or vehicle control (V). Data points represent mean tumor volume +/- S.E (asterisks indicate significant tumor suppression vs. vehicle at time of sacrifice). C right panel, Mice from (C) were treated as indicated, then euthanized 6h after the last administration of drug. The expression of phosphorylated KT (S473 and T38) and ERK and total KT/ERK were measured by immunoblot.

10 Supplementary Figure S5 Hanrahan et al.- Genomic complexity and KT-dependence in serous ovarian cancer % cells in sub-g at 72hr OVCR-5 parental OVCR-5 +shscrmbled OVCR-5 +shkt3 OVCR-5 +shkt3-6 DMSO PD9 5nM KTi/2 µm KTi/2 + PD9 Supplementary Fig. S5. Consequences of stable KT3 knockdown in RasG2V mutant OVCR-5 cells. Lentiviral short hairpin constructs targeting KT3 (shkt3) or a scrambled sequence (shscrmbled) were used to generate OVCR-5 stable cells lines with KT3 knockdown. Induction of apoptosis was only observed in OVCR-5 expressing the shkt3 construct, when they were co-treated with KTi/2 (um) and PD9 (5nM) (asterisks indicates significant increase in subg compared to OVCR-5+shSCRMBLED line, p=.442, n=6). Similar results were seen with a second shkt3 construct, shkt3-6. These data recapitulate the increase in cell death observed following combined treatment of OVCR-5 parental cells with MK226 and PD9 (Fig. 4C) and suggest that KT3 plays a role in survival in ovarian cancer cells that express high levels of KT3.

11 Supplementary Figure S6 Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancer 2. BRF missense mutation nonsense mutation 2. KT2.5.5 log 2 mrn expression Het loss Diploid Gain Copy-number status p-value =.56e mp Het loss Diploid Gain Copy-number status p-value = 2.693e-42 mp B 7.5mb on chr 7q 6mb on chr 9q 36 ovarian TCG samples BRF focally amplified KT2 focally amplified Supplementary Fig. S6. Copy-number and mrn expression for BRF and KT2 in 36 ovarian tumors from the TCG dataset., log2 mrn expression was assessed as a function of DN copy-number calls (homozygous deletion, hemizygous loss, diploid, gain, high-level amplification) across all samples for the BRF and KT2 genes. P-values were generated using NOV analysis. B, Copy-number heatmaps demonstrating the focality of amplifications for BRF and KT2 loci for all samples in ovarian TCG dataset.

12 Supplementary Figure S7 Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancer RB NF log 2 mrn expression missense mutation nonsense mutation frameshift missense mutation nonsense mutation frameshift Homo del Hemi loss Diploid Gain Copy-number status p-value =.969e mp Homo del Hemi loss Diploid Gain Copy-number status p-value = 6.367e mp B.3mb on chr 3q 36 ovarian TCG samples 3mb on chr 7q RB focally deleted NF focally deleted Supplementary Fig. S7. Copy-number and mrn expression for RB and NF in 36 ovarian tumors from the TCG dataset., log2 mrn expression was assessed as a function of DN copy-number calls (homozygous deletion, hemizygous loss, diploid, gain, high-level amplification) across all samples for the RB and NF genes. P-values were generated using NOV analysis. B, Copy-number heatmaps demonstrating the focality of deletions for RB and NF loci for all samples in ovarian TCG dataset.

13 Supplementary Table S3 Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancer TCG log2 PTEN PTEN GISTIC score RE score PTEN Other tumor mrn IHC score for PTEN for PTEN genotype genotype identification # expression TCG3-95 TCG3-72 TCG3-8 TCG359 TCG3-758 TCG3-725 TCG3492 TCG3-9 N N N KT amp, RB del PTEN hemizygous KT amp, RB mt PIK3C amp PTEN hemizygous/r233fs22 PTEN hemizygous TCG3497 TCG3-924 TCG3488 TCG3-893 TCG3-89 TCG348 TCG3-724 TCG3-96 N PTEN hemizygous PTEN hemizygous PTEN hemizygous PTEN hemizygous PIK3C amp RB del PIK3C amp RB del BRF amp BRF amp PIK3C amp PIK3C amp TCG345 TCG3-87 TCG3-899 TCG3-75 TCG3-795 TCG3-93 TCG3-923 TCG3-889 TCG3-92 TCG3-885 TCG3-9 TCG347 TCG3-76 TCG3-755 TCG3-77 TCG3-726 TCG3485 TCG355 TCG3494 TCG34 TCG344 TCG3-793 TCG3495 TCG3-92 TCG35 TCG3-883 TCG3-85 TCG3-799 TCG3-727 TCG3-99 TCG3-89 TCG3-894 TCG3-73 TCG3477 TCG349 TCG3-897 N PTEN hemizygous PTEN hemizygous PTEN hemizygous PTEN hemizygous PIK3C amp PTEN hemizygous PTEN hemizygous RB del PTEN hemizygous PIK3C amp PTEN hemizygous KRS amp PTEN hemizygous PTEN hemizygous PTEN hemizygous PIK3C amp KRS amp, KT2 amp RB del KRS amp KRS amp KRS amp KRS amp RB del PTEN gain PTEN gain PTEN gain PTEN gain PTEN gain KRS amp, KT2 amp PTEN gain PTEN gain PTEN gain Supplementary Table S3. PTEN IHC scores, copy-number calls, mrn expression and PTEN/other genotypes for 52 ovarian tumors. Immunohistochemical (IHC) staining for PTEN was performed on 52 ovarian tumors. PTEN IHC was scored as,, or staining. GISTIC and RE scores for PTEN, log2 PTEN mrn expression and PTEN and other genotypes (see Supp. Fig. S8 for a more detailed genomic fingerprint of the status of other genes of interest) were determined as part of TCG project (see Methods). PTEN genotype calls are based on GISTIC scores as categorized in Fig. 6B. Copy-number analysis clearly indicated deletion of PTEN, however this sample was unable to be incorporated into GISTIC, RE or mrn expression analyses.

14 Supplementary Figure S8 Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancert 5 of 36 cases with corresponding IHC data Somatic Mutation mplification Homozygous Deletion Up-Regulation Epigenetic Silencing PIK3C KT KT2 KT3 PTEN ERBB KRS HRS NRS NF BRF MP2K RB BRC BRC2 TP53 Supplementary Fig. S8. Genomic fingerprint for 5 ovarian tumors from TCG dataset. Heatmap depicts compiled mutational, copynumber and mrn expression analysis for 5 ovarian tumors subjected to further immunohistochemical analysis of PTEN (see Supplementary Table S3).

15 Supplementary Figure S9 Hanrahan et al.-genomic complexity and KT-dependence in serous ovarian cancer B log2 PTEN PRR score.. p-kt S473 IHC score log2 p-kt S473 RPP score. Homo del Hemi loss Diploid/ Gain PTEN genotype calls by GISTIC. Homo del Hemi loss Diploid/ Gain PTEN genotype calls by GISTIC. Supplementary Fig. S9. PTEN and p-kt S473 RPP expression data from a subset of ovarian TCG samples., log2 PTEN reverse-phase protein array (RPP) scores from 29 of the 52 TCG samples used in the IHC analysis plotted as a function of GISTIC-based copy-number calls at the PTEN locus. Similar to the PTEN IHC data (Fig. 6C, Supp. Table 3), PTEN expression by RPP correlates with PTEN homozygous deletion, while significantly higher levels of PTEN protein were found in the PTEN hemizygous loss and PTEN diploid/gain cohorts. Symbols represent average PTEN RPP score +/- S.E for each group. Green asterisk indicates p=.2 between PTEN hemi loss and diploid gain groups. Black asterisk indicates p=.4 vs. PTEN homozygous deleted group. B, log2 p-kt S473 reverse-phase protein array (RPP) scores from 29 of the 52 TCG samples used in the IHC analysis plotted as a function of GISTIC-based copy-number calls at the PTEN locus. Similar to the p-kt S473 IHC data (in black, left y-axis, as seen in Fig. 6D), high p-kt S473 expression by RPP (in red, right y- axis) correlates with PTEN homozygous deletion, while significantly lower levels of KT phosphorylation were found in the PTEN hemizygous loss and PTEN diploid/gain cohorts. Symbols represent average p-kt IHC or RPP score +/- S.E for each group. Black asterisks indicate p=.477 (hemi loss) and p=.5 (diploid/gain) as compared to PTEN homozygous deleted group. Red asterisks indicate p=.267 (hemi loss) and p=.34 (diploid/gain) as compared to PTEN homozygous deleted group.