Co-expressed Cyclin D variants cooperate to regulate proliferation of germline nuclei in. Accession number
|
|
|
- Madison Martha Hunter
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY MATERIAL Co-expressed Cyclin D variants cooperate to regulate proliferation of germline nuclei in a syncytium. Subramaniam et al. Table S1. Cyclin accession numbers Gene Human Cyclin D1a Mouse Cyclin D2 Mouse Cyclin D2SV O.dioica Cyclin Db α O.dioica Cyclin Db β O.dioica Cyclin Db Υ O.dioica Cyclin Db δ Accession number NP_ NP_ AK CBZ41121 CBZ41122 CBZ41123 CBZ41124 The human Cyclin D1b protein sequence was obtained from Lu et al 1 Table S2. Primer sequences for qpcr Target Transcript Primer Name Primer Sequence (5 to 3 ) Cyclin Da CCQ73F ACATGGAGCTGCTGATCCTGTTGA CCQ74R ACATCAGCGTACGTAGAAGCGTGA Cyclin Db CCQ385F AGAGATCAAACGCGCTTATTGGAG CCQ386R CTGCGCTGGATCTTTGAGACTTTG Cyclin Db / CCQ77F GTCTCAAAGATCCAGCGCAGGTAA CCQ78R AAACAAGGCACGTGAGCGCATAAG Cyclin Db / CCQ344F ACATGCTGGAGGAGCTTCTTCCTT CC220R CCTGGAAGAGTTGAACAGGACTG Cyclin Dc CCQ69F TGACCACACAACTACAGCATCCGA CCQ70R CTGCAGTAACAACAGCAGGCGAAA Cyclin Dd CCQ87F TCCTGTCTATATCTGGCCGCGAAA CCQ88R GGGCTTGGCAGAAGAGAAGAATGA EF1 CCQ43F AGGTCATCCCTGAACTTAACGGCA CCQ44R GGCAGATTTGATGGCAGCGTTGAT
2 Table S3. Primer sequences for cloning. Construct Primer Primer Sequence (5 to 3 ) Cyclin Dbβ ORF Dbβ_OF GATATCTAATACGACTCACTATAGGGAGAGCCACCATGGAAGCTACACACGAATTCA Dbβ_OR CTCCAGATTACTGTAATGGCCCGAACATGGATCCGCTGCC Cyclin Dbβ UTR Dbβ_UF TGTACAAGTAGAACGGCTTTTTATCCTGATTTTTAGAA Dbβ_UR TTTTTGAAATAAATAAATAGAATACATTTTTTAAACGCCCGGG CKIa ORF CKIa_OF GATATCTAATACGACTCACTATAGGGAGAGCCACCATGAAATCGGGCGGGAATTCG CKIa_OR GGCAGCGGATCCATGGTGGCCGACGAGCGA CKIa UTR CKIa_UF TGTACAAGTAGAACTTTTGGCAGCTCCATATTATATTGTACTGCTGTTCTAC CKIa_UR TCGCATATGCGTTATGCGATTTTAACCCTTCCCGGG
3
4 Figure S1. Multiple sequence alignment of Cyclin Ds and their splice variants. O. dioica Cyclin Dd, and Cyclin Db splice variants aligned with human and mouse Cyclin D splice variants using MUSCLE. 2 Dark shading indicates identical amino acids and grey shading represents similar amino acids. Altered C-terminal end amino acid sequences resulting from alternative splicing are indicated in red. CDK6 (red box) and CKI (p27/p21) interaction regions (blue box) are indicated. 3 Conserved residues for Cyclin Dependent Kinase Activator (CAK) binding on odcyclin D variants are marked with asterisks below the corresponding aligned sequences. Hs, Human; Mm, Mouse; Od, Oikopleura dioica.
5 Figure S2. CREB binding sites upstream of the Oikopleura dioica cyclin Db start site. The upstream sequence of cyclin Db was extracted from the O. dioica genome.4 Predicted consensus O. dioica CREB binding sites in this region were identified using JASPAR ( and the site sequence logo (A) was created in web logo ( These sites are indicated by yellow boxes in (A) and yellow highlighted sequences in (B).
6 References 1. Lu FM, Gladden AB, Diehl JA. An alternatively spliced cyclin D1 isoform, cyclin D1b, is a nuclear oncogene. Cancer Res 2003; 63: Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 2004; 32: Zwicker J, Brüsselbach S, Jooss KU, Sewing A, Behn M, Lucibello FC, et al. Functional domains in cyclin D1: prb-kinase activity is not essential for transformation. Oncogene 1999; 18: Denoeud F, Henriet S, Mungpakdee S, Aury JM, Da Silva C, Brinkmann H, et al. Plasticity of animal genome architecture unmasked by rapid evolution of a pelagic tunicate. Science 2010; 330:
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
Regulation of cell cycle. Dr. SARRAY Sameh, Ph.D
Regulation of cell cycle Dr. SARRAY Sameh, Ph.D Control of cell cycle: Checkpoints Are the cell cycle controls mechanisms in eukaryotic cells. These checkpoints verify whether the processes at each phase
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS Summary of the regulation of cyclin/cdk complexes during celll cycle Cell cycle phase Cyclin-cdk complex inhibitor activation Substrate(s) G1 Cyclin D/cdk 4,6
Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6
Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early
supplementary information
supplementary information DOI: 10.1038/ncb1109-1275 Figure S1 Predicted Cyclin-binding elements in CDK and CDKL proteins. Protein sequences were aligned with Clustal2. The predicted Cyclin-binding domain
Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes
Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes Question No. 1 of 10 1. Which of the following statements about gene expression control in eukaryotes is correct? Question #1 (A)
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
Regulators of Cell Cycle Progression
Regulators of Cell Cycle Progression Studies of Cdk s and cyclins in genetically modified mice reveal a high level of plasticity, allowing different cyclins and Cdk s to compensate for the loss of one
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Rajesh Kannangai Phone: ; Fax: ; *Corresponding author
Amino acid sequence divergence of Tat protein (exon1) of subtype B and C HIV-1 strains: Does it have implications for vaccine development? Abraham Joseph Kandathil 1, Rajesh Kannangai 1, *, Oriapadickal
Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway
Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway S1 Oleksi Petrenko and Ute M. Moll Figure S1. MIF-Deficient Cells Have Reduced Transforming Ability (A) Soft
A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus
Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Supplementary materials
Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial
Supplemental Material for:
Supplemental Material for: Transcriptional silencing of γ-globin by BCL11A involves long-range interactions and cooperation with SOX6 Jian Xu, Vijay G. Sankaran, Min Ni, Tobias F. Menne, Rishi V. Puram,
Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain.
Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm 10 nm
Lesson 5 Proteins Levels of Protein Structure
Lesson 5 Proteins Levels of Protein Structure Primary 1º Structure The primary structure is simply the sequence of amino acids in a protein. Chains of amino acids are written from the amino terminus (N-terminus)
Comparative Phylogenetic Analysis of E6 and E7 Proteins of Different 42 Strains of HPV Sangeeta Daf*, Lingaraja Jena, Satish Kumar
ORIGINAL ARTICLE Comparative Phylogenetic Analysis of E6 and E7 Proteins of Different 42 Strains of HPV Sangeeta Daf*, Lingaraja Jena, Satish Kumar Abstract Simultaneous phylogenetic analysis of E6 and
The pi-value distribution of single-pass membrane proteins at the plasma membrane in immune cells and in total cells.
Supplementary Figure 1 The pi-value distribution of single-pass membrane proteins at the plasma membrane in immune cells and in total cells. The PI values were measured for the first 10 amino acids in
Mouse Clec9a ORF sequence
Mouse Clec9a gene LOCUS NC_72 13843 bp DNA linear CON 1-JUL-27 DEFINITION Mus musculus chromosome 6, reference assembly (C57BL/6J). ACCESSION NC_72 REGION: 129358881-129372723 Mouse Clec9a ORF sequence
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4)
Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4) Vahagn Stepanyan Department of Biological Sciences, Fordham University Abstract: Alternative splicing is an
Review II: Cell Biology
Review II: Cell Biology Rajan Munshi BBSI @ Pitt 2006 Department of Computational Biology University of Pittsburgh School of Medicine May 24, 2006 Outline Cell Cycle Signal Transduction 1 Cell Cycle Four
Conditional and reversible disruption of essential herpesvirus protein functions
nature methods Conditional and reversible disruption of essential herpesvirus protein functions Mandy Glaß, Andreas Busche, Karen Wagner, Martin Messerle & Eva Maria Borst Supplementary figures and text:
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene
Gene Finding in Eukaryotes
Gene Finding in Eukaryotes Jan-Jaap Wesselink jjwesselink@cnio.es Computational and Structural Biology Group, Centro Nacional de Investigaciones Oncológicas Madrid, April 2008 Jan-Jaap Wesselink jjwesselink@cnio.es
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Design of isolated protein and RNC constructs, and homogeneity of purified RNCs. (a) Schematic depicting the design and nomenclature used for all the isolated proteins and RNCs used
Relative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
Designer Affinity Reagents. Brian Kay
Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm x 10
Karyotype analysis reveals transloction of chromosome 22 to 9 in CML chronic myelogenous leukemia has fusion protein Bcr-Abl
Chapt. 18 Cancer Molecular Biology of Cancer Student Learning Outcomes: Describe cancer diseases in which cells no longer respond Describe how cancers come from genomic mutations (inherited or somatic)
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
Clustered mutations of oncogenes and tumor suppressors.
Supplementary Figure 1 Clustered mutations of oncogenes and tumor suppressors. For each oncogene (red dots) and tumor suppressor (blue dots), the number of mutations found in an intramolecular cluster
基醫所. The Cell Cycle. Chi-Wu Chiang, Ph.D. IMM, NCKU
基醫所 The Cell Cycle Chi-Wu Chiang, Ph.D. IMM, NCKU 1 1 Introduction to cell cycle and cell cycle checkpoints 2 2 Cell cycle A cell reproduces by performing an orderly sequence of events in which it duplicates
Molecular Biology (BIOL 4320) Exam #2 May 3, 2004
Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good
Determination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
Apoptosis Oncogenes. Srbová Martina
Apoptosis Oncogenes Srbová Martina Cell Cycle Control point Cyclin B Cdk1 Cyclin D Cdk4 Cdk6 Cyclin A Cdk2 Cyclin E Cdk2 Cyclin-dependent kinase (Cdk) have to bind a cyclin to become active Regulation
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
UNC-Duke Biology Course for Residents Fall Cell Cycle Effects of Radiation
UNC-Duke Biology Course for Residents Fall 2018 1 Cell Cycle: Sequence of changes in a cell starting with the moment the cell is created by cell division, continuing through the doubling of the DNA and
Prof. R. V. Skibbens
Prof. R. V. Skibbens December 2, 2011 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality The Cell Cycle clock goes in only one direction S-phase cells
OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies
OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies 2017 Contents Datasets... 2 Protein-protein interaction dataset... 2 Set of known PPIs... 3 Domain-domain interactions...
Evidence for an Alternative Glycolytic Pathway in Rapidly Proliferating Cells. Matthew G. Vander Heiden, et al. Science 2010
Evidence for an Alternative Glycolytic Pathway in Rapidly Proliferating Cells Matthew G. Vander Heiden, et al. Science 2010 Introduction The Warburg Effect Cancer cells metabolize glucose differently Primarily
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
BCHM3972 Human Molecular Cell Biology (Advanced) 2013 Course University of Sydney
BCHM3972 Human Molecular Cell Biology (Advanced) 2013 Course University of Sydney Page 2: Immune Mechanisms & Molecular Biology of Host Defence (Prof Campbell) Page 45: Infection and Implications for Cell
Supplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
Mechanisms of alternative splicing regulation
Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
The Emergence of Alternative 39 and 59 Splice Site Exons from Constitutive Exons
The Emergence of Alternative 39 and 59 Splice Site Exons from Constitutive Exons Eli Koren, Galit Lev-Maor, Gil Ast * Department of Human Molecular Genetics, Sackler Faculty of Medicine, Tel Aviv University,
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Contents. 2 Statistics Static reference method Sampling reference set Statistics Sampling Types...
Department of Medical Protein Research, VIB, B-9000 Ghent, Belgium Department of Biochemistry, Ghent University, B-9000 Ghent, Belgium http://www.computationalproteomics.com icelogo manual Niklaas Colaert
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
MODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
p53 and Apoptosis: Master Guardian and Executioner Part 2
p53 and Apoptosis: Master Guardian and Executioner Part 2 p14arf in human cells is a antagonist of Mdm2. The expression of ARF causes a rapid increase in p53 levels, so what would you suggest?.. The enemy
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Danish Research Institute of Translational Neuroscience DANDRITE, Nordic-EMBL Partnership
Supplementary Information for Tuning of the Na,K-ATPase by the beta subunit Florian Hilbers 1,2,3, Wojciech Kopec 4, Toke Jost Isaksen 3,5, Thomas Hellesøe Holm 3,5, Karin Lykke- Hartmann 3,5,6, Poul Nissen
VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Nature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish
SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,
Prof. R. V. Skibbens
Prof. R. V. Skibbens September 8, 2017 BioScience in the 21 st Century Cell Cycle, Cell Division and intro to Cancer Cell growth and division What are the goals? I Cell Cycle what is this? response to
General Biology. Overview: The Key Roles of Cell Division The continuity of life is based upon the reproduction of cells, or cell division
General Biology Course No: BNG2003" Credits: 3.00 " " " 8. The Cell Cycle Prof. Dr. Klaus Heese Overview: The Key Roles of Cell Division The continuity of life is based upon the reproduction of cells,
Supplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
islets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
Identification of non-ser/thr-pro consensus motifs for Cdk1 and their roles in mitotic regulation of C2H2 zinc finger proteins and Ect2
SUPPLEMENTARY INFORMATION Identification of non-ser/thr-pro consensus motifs for Cdk1 and their roles in mitotic regulation of C2H2 zinc finger proteins and Ect2 Kazuhiro Suzuki, Kosuke Sako, Kazuhiro
Intrinsically Disordered Proteins. Alex Cioffi June 22 nd 2013
Intrinsically Disordered Proteins Alex Cioffi June 22 nd 2013 Implications in Human Disease Adenovirus Early Region 1A (E1A) and Cancer α-synuclein and Parkinson s Disease Amyloid β and Alzheimer s Disease
Supplementary figure legends
Supplementary figure legends SUPPLEMENTRY FIGURE S1. Lentiviral construct. Schematic representation of the PCR fragment encompassing the genomic locus of mir-33a that was introduced in the lentiviral construct.
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Ras V12 expression in the entire eye-antennal disc does not cause invasive tumours. a, Eye-antennal discs expressing Ras V12 in all cells (marked with GFP, green) overgrow moderately
Hands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
Nature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
A homologous mapping method for threedimensional reconstruction of protein networks reveals disease-associated mutations
Huang et al. BMC Systems Biology 2018, 12(Suppl 2):13 https://doi.org/10.1186/s12918-018-0537-2 RESEARCH A homologous mapping method for threedimensional reconstruction of protein networks reveals disease-associated
To test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department
Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause
33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
Signal-Transduction Cascades - 2. The Phosphoinositide Cascade
Signal-Transduction Cascades - 2 The Phosphoinositide Cascade Calcium ion as a second messenger Tyrosine kinase and receptor dimerization scribd.com Faisal Khatib JU The Phosphoinositide Cascade Used by
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Materiale per uso didattico 1
BCII - Perroteau - shuttling citoplasma nucleus 1 ERK regulation by scaffolds and anchors 2 Materiale per uso didattico 1 ERK Pathway regulation by feedback loops and phosphatases 3 ERK has more
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Utilization of HIV-1 envelope V3 to identify X4- and R5-specific Tat and LTR sequence signatures.
Thomas Jefferson University Jefferson Digital Commons Department of Medicine Faculty Papers Department of Medicine 5-3-2016 Utilization of HIV-1 envelope V3 to identify X4- and R5-specific Tat and LTR
The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/8/e1500296/dc1 Supplementary Materials for Transcriptional regulation of APOBEC3 antiviral immunity through the CBF- /RUNX axis This PDF file includes: Brett
U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.
Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the