Food & Function Accepted Manuscript

Transcription

1 Food & Function Accepted Mnuscript This is n Accepted Mnuscript, which hs een through the Royl Society of Chemistry peer review process nd hs een ccepted for puliction. Accepted Mnuscripts re pulished online shortly fter cceptnce, efore technicl editing, formtting nd proof reding. Using this free service, uthors cn mke their results ville to the community, in citle form, efore we pulish the edited rticle. We will replce this Accepted Mnuscript with the edited nd formtted Advnce Article s soon s it is ville. You cn find more informtion out Accepted Mnuscripts in the Informtion for Authors. Plese note tht technicl editing my introduce minor chnges to the text nd/or grphics, which my lter content. The journl s stndrd Terms & Conditions nd the Ethicl guidelines still pply. In no event shll the Royl Society of Chemistry e held responsile for ny errors or omissions in this Accepted Mnuscript or ny consequences rising from the use of ny informtion it contins.

2 Pge 1 of 46 Sustined exposure to diets with n unlnced mcronutrient proportion lters key genes involved in energy homeostsis nd oesity-relted metolic prmeters in rts Ruén Díz-Rú 1, Estefní Grcí-Ruiz 1, Antoni Cimri 1,2, Andreu Plou 1, Pul Oliver 1 1 Lortory of Moleculr Biology, Nutrition nd Biotechnology, Universitt de les Illes Blers nd CIBER de Fisioptologí de l Oesidd y Nutrición (CIBERon), Plm de Mllorc, Spin; 2 Centre Tecnològic de Nutrició i Slut (CTNS), TECNIO, CEICS, Reus, Spin Address correspondence to: Prof. Andreu Plou, Lortory of Moleculr Biology, Nutrition nd Biotechnology, Universitt de les Illes Blers. Cr. Vlldemoss Km 7.5. E Plm de Mllorc, Spin. Phone: Fx: E- mil: ndreu.plou@ui.es Running title. Unlnced intke of mcronutrients in rts 1

3 Pge 2 of 46 Astrct We hve investigted the effects of long term intke of two unlnced diets (rich in ft HF or protein HP ) dministered in isocloric conditions to control lnced diet (pir-feeding) to dult rts. Isocloric intke of HF diet did not ffect ody weight ut incresed diposity, liver-ft deposition, nd induced insulin resistnce. Gene expression chnges in liver nd dipose tissue (incresed lipolytic nd decresed lipogenic gene expression) could try to compenste for incresed diposity. HP diet decresed cloric intke, ody weight, size of sucutneous dipocytes, nd circulting cholesterol. Higher insulin levels pprently not relted to insulin resistnce were oserved. Chnges t gene expression level reflected n dpttion to lower diet crohydrte content nd to the use of mino cids s energy source. Kidney size ws incresed in HP-fed nimls ut serum cretinine ws not ffected. Circulting TNFlph levels were higher in oth dietry models. Thus, long-term increse in dietry ft proportion produces ltertions relted to metolic syndrome even in the sence of incresed ody weight, wheres n increse in diet protein content reduces ody weight ut lters metolic prmeters nd kidney size which could e linked to incresed risk of suffering different pthologies. Key words. High-ft diet, high-protein diet, isocloric diets, energy homeostsis 2

4 Pge 3 of 46 Introduction Energy homeostsis regultion nd ody weight mintennce is of high relevnce, s incresed diposity is linked to oesity nd relted diseses 1, 2. Diet mcronutrient composition is known to influence energy homeostsis, food intke nd ody weight in rts nd humns 3, nd n unlnced proportion of diet mcronutrients hs een relted to severl metolic disorders 4. There re still discrepncies in the literture regrding the effects of dietry mcronutrient composition on energy homeostsis nd ody weight control, s well s on the helth effects of diets with n unlnced proportion of mcronutrients, minly due to the durtion of the experiments nd the numer of prmeters mesured nd nlyzed 5. Ft intke hs deep impct on energy metolism 6. Prticulrly, the intke of niml ft is incresing in western diets 7 nd this type of ft is ssocited to incresed diposity, incresed cloric intke, nd to the development of disorders relted to metolic syndrome, such s insulin resistnce, hypertriglyceridemi nd hypercholesterolemi mong others 8, 9. On the other hnd, protein intke is lso incresing, especilly due to the populrity of high protein diets to decrese nd control ody weight 10. An incresing ody of evidence indictes tht diets rich in proteins my improve iomrkers of metolic helth (insulin sensitivity, lood lipid profile) 7, 11. However, these diets hve lso een relted to ltertions of metolic prmeters in rt nd humn studies. For exmple, long-term protein intke hs een suspected to promote insulin resistnce, development nd progression of renl disese nd to increse urinry clcium excretion which could e linked to possile one resorption 12, 13, 14. The im of this study ws to estimte the metolic consequences of long-term intke of high ft or high protein diets in dult mle Wistr rts y nlyzing wide rnge of 3

5 Pge 4 of 46 prmeters relted to ody weight control nd metolic syndrome. We designed n isoenergetic pir-feeding experiment to ensure equl cloric intke etween the control nd experimentl groups, enling us to nlyze the influence of high ft diet in sence of relted overeting tht would hppen in d liitum feeding conditions 15. Adult nimls were fed with the different diets for 4 months, which represents qurter of their life spn; it would e difficult to perform controlled study on n equivlent period in humns. 4

6 Pge 5 of 46 Methods nd Mterils Ethicl pprovl. All experimentl procedures followed in this study were reviewed nd pproved y the Ethicl Committee of the University of the Bleric Islnds nd guidelines for the use nd cre of lortory nimls of the University were followed. Animls. The experiments were conducted with 2-month-old mle Wistr rts (Chrles River Lortories Espñ, SA, Brcelon, Spin) pir-fed with different experimentl diets for 4 months. We chose 2-month-old rts to egin the experiment ecuse our ojective ws to nlyze the effect of the intke of unlnced diets during dulthood. Animls were single-housed t 22 C with period of light/drk of 12 hours nd were divided into three groups: control group (n=7), high-ft group (HF, n=7) nd highprotein group (HP, n=6). Control nimls were fed normolipidic diet (D12450B, Reserch Diets) contining 70% of energy (Kcl) from crohydrte, 10% from ft nd 20% from protein. HF nimls were fed high-ft diet (D12492, Reserch Diets) contining 20% of energy from crohydrte, 60% from ft (40% sturted nd 60% unsturted ft) nd 20% from protein. HP nimls were fed high-protein diet (Reserch Diets) contining 45% of energy from crohydrtes, 10% from ft nd 45% from proteins (minly csein). Diets were purchsed from Brogrden (Gentofte, Denmrk). During the experimentl tril, food ws dministered isocloriclly. The HF nd the HP groups received n equl mount of Kcl to the mount consumed y the control group the dy efore. We proceeded s follows: nimls in the control group hd free ccess to food nd their food intke ws dily recorded in order to clculte their exct energy (Kcl) consumption. The mount of food (grms) dministered to the HF nd the HP groups ws clculted to contin the sme Kcl s those ingested y the control group the dy efore. The energy density of the diets used for clcultion ws: control: 3.85; HF: 5.24 nd HP: 3.85 Kcl per grm. When present, residul food in 5

7 Pge 6 of 46 ech cge ws weighed, discrded, nd replced with fresh diet every 24 h. Food ws dministered lwys t the sme hour (13:00h) nd ws ville to the nimls over 24-h period. Food intke of ll groups ws recorded dily to clculte the dily cloric intke nd cumultive cloric intke throughout the experiment; ody weight ws recorded three times week. One week prior to scrifice nimls were sumitted to nocturnl 14-h fsting to collect serum in fsted conditions to nlyze the HOMA-IR score. Animls were scrificed in the fed stte y decpittion t the eginning of the light cycle (8:00-10:00h) nd truncl lood ws collected from the neck, stored t room temperture for 1 h nd centrifuged t 1000 g for 10 min t 4ºC to collect serum. Lst mel ws dministered t 13:00h the dy efore the scrifice (this pttern of food dministrtion ws conducted during the 4 months of the experiment); this lst mel ws isocloric etween the different groups (control: 69.8 ± 3.4 Kcl; HF: 65.7 ± 2.9 Kcl nd HP 68.7 ± 2.7 Kcl). Liver, skeletl muscle, kidney, hypothlmus nd different white dipose tissue (WAT) depots, oth viscerl (epididyml, mesenteric nd retroperitonel) nd sucutneous (inguinl), s well s the interscpulr rown dipose tissue (BAT) were rpidly removed, weighed nd frozen in liquid nitrogen nd stored t -70 C until RNA, DNA, protein, lipid, tricylglycerol, nd glycogen nlysis or quntifiction. In ddition, stomch content ws quntified in the different niml groups to discrd possile interferences in the results due to the lck of food (fsting) on the dy of the scrifice. All the nimls presented food in the stomch in the moment of the scrifice. Adiposity. Adiposity ws determined y n diposity index computed for ech rt s the sum of epididyml, inguinl, mesenteric nd retroperitonel white dipose tissue depot weights nd expressed s percentge of totl ody weight. In ddition, ody composition ws mesured 15 dys efore the scrifice using n EchoMRI-700 (Echo 6

8 Pge 7 of 46 Medicl Systems, LLC., TX, USA) without nesthesi. Direct mesurements of ft nd len mss (in grms) were tken from the nlyzer, nd expressed s percentge of totl ody weight. Quntifiction of protein lipid levels. Totl protein nd lipid levels were determined in liver nd muscle y the methods of Brdford 16 nd Folch 17, respectively. Tricylglycerol determintion. Tricylglycerol (TG) content ws mesured in liver nd muscle lipid extrcts s previously descried 18 using the Serum Triglyceride Determintion Kit (Sigm Aldrich, Mdrid, Spin). Quntifiction of DNA content. DNA content ws nlyzed in the different WAT depots studied (epididyml, inguinl, mesenteric nd retroperitonel). For quntifiction, mg of the different dipose depots were homogenized in 3 volumes of PBS, using polytron homogenizer, nd then centrifuged t 500 g for 10 min; the superntnt ws collected nd used for DNA quntifiction y fluorescence with multireder Mithrs LB 940 (Berthold Technologies GmH, Bd Wildd, Germny) using the 3,5 diminoenzoic cid method 19. Histologicl nlysis. Tissue smples (inguinl nd retroperitonel WAT, nd liver) were fixed y immersion in 4% prformldehyde in 0.1 M sodium phosphte uffer, ph 7.4, overnight t 4 C, dehydrted in grded series of ethnol, clered, nd emedded in prffin locks for light microscopy. Adipocyte re ws mesured in the inguinl nd retroperitonel WAT s selected depots. Five-micrometer-thick sections of tissues were cut with microtome nd mounted on slides. The re of dipocytes ws mesured in hemtoxylin/eosin stined sections. Imges from light microscopy were digitlized nd n re of t lest 100 cells of ech section ws determined using Axio Vision softwre (Crl Zeiss Imging Solutions, Brcelon, Spin). Presence of stetosis ws visully nlyzed in stined liver sections. 7

9 Pge 8 of 46 Quntifiction of heptic glycogen levels. For heptic glycogen isoltion, g of liver from ech smple ws digested in 1 ml of 30% KOH t 100 C for 10 min, glycogen ws precipitted overnight t 20 C with 2 ml of 100% ethnol, collected y centrifugtion (t 3000 rpm nd 4 C, s for the next centrifugtions, for 30 min), dissolved in 1 ml of 8% trichlorocetic cid (TCA) nd then centrifuged for 15 min. The superntnt ws stored (4 C), wheres the pellet ws dissolved in 1 ml of 8% TCA nd centrifuged for 15 min, nd the resulting superntnt ws dded to the stored one. Glycogen ws gin otined from the superntnt y precipittion with 4 ml of 96% cold ethnol followed y centrifugtion (15 min). The pellet ws then dissolved in 1 ml of wter. Glycogen concentrtion ws mesured with the nthrone regent s previously descried 20. Quntifiction of serum prmeters of interest. Blood glucose ws mesured using n Accu-Chek Glucometer (Roche Dignostics, Brcelon, Spin). ELISA kits were used to mesure serum levels of insulin (DRG Instruments, Mrurg, Germny), leptin (R&D Systems, MN, USA) nd TNF-lph (R&D Systems Europe, Aingdon, UK). Circulting ghrelin ws mesured with n enzyme immunosorent ssy kit (Phoenix Europe GmH, Krlsruhe, Germny). Commercil enzymtic colorimetric kits were used for the determintion of tricylglycerols (Sigm Dignostics, St Louis, MO, USA), free ftty cids (Wko Chemicls GmH, Neuss, Germny), et-hydroxyutyrte levels (β-hba Procedure No. 310-UV, Sigm Dignostics), totl cholesterol (cholesterol-esterse nd cholesterol-oxidse/peroxidse, BioSystems, Brcelon, Spin), ure (BUN-UV, Biosystems, Brcelon, Spin) nd cretinine (lkline picrte, BioSystems, Brcelon, Spin). HOMA-IR nlysis. Insulin resistnce ws ssessed y the homeosttic model ssessment for insulin resistnce (HOMA-IR) in rts sumitted to overnight (14 h) 8

10 Pge 9 of 46 fsting (n=6-7 for ll groups). HOMA-IR score ws clculted from fsting insulin nd glucose concentrtions using the formul of Mtthews et l. 21. HOMA-IR = fsting glucose (mmol/l) x fsting insulin (mu/l)/22.5. Rel-time reverse trnscription-polymerse chin rection (RT-PCR) nlysis. Gene expression of key genes involved in energy homeosttic control ws determined in different tissues (liver, muscle, hypothlmus nd dipose tissue) y rel time RT- PCR. Totl RNA ws extrcted using Tripure regent (Roche, Brcelon, Spin) ccording to the instructions provided y the supplier nd ws then purified using E.Z.N.A. Totl RNA Kit I (Omeg Bio-Tek, Norcross, GA, USA) nd treted with DNse I (Omeg Bio-Tek, Norcross, GA, USA). Isolted RNA ws quntified using the NnoDrop ND-1000 spectrophotometer (NdroDrop Technologies, Wilmington, DE, USA) nd its integrity nd purity confirmed using grose gel electrophoresis μg of totl RNA (in finl volume of 5 μl) ws dentured t 65 ºC for 10 min nd then reverse trnscried to cdna using murine leukemi virus reverse trnscriptse (from Applied Biosystem, Mdrid, Spin) in finl concentrtion of 2 U/μL t 20 ºC for 15 min, 42 ºC for 30 min, with finl step of 5 min t 95 ºC in n Applied Biosystems 2720 Therml Cycler (Applied Biosystem, Mdrid, Spin). PCRs were performed using diluted (1/20 for liver, muscle, WAT nd BAT; nd 1/5 for hypothlmus) cdna templte, forwrd nd reverse primers (in finl concentrtion of 0.4 μm ech), nd 5 μl of 2x Power SYBER Green PCR Mster Mix (Applied Biosystems, CA, USA) which includes AmpliTq Gold DNA Polymerse, in totl volume of 11 μl. PCR prmeters were followed: 10 min t 95ºC, followed y totl of 40 temperture cycles (15 s t 95ºC nd 1 min t 60ºC). Primers for the different genes nlyzed were designed using Primer3Plus 22 nd re descried in Tle 1. All primers were otined from Sigm Genosys (Sigm Aldrich Químic SA, Mdrid, Spin). In order to verify 9

11 Pge 10 of 46 the purity of the products nd the specificity of the mplifiction, melting curve ws produced fter ech run ccording to the mnufcturer's instructions. Specificity of the PCR mplifiction ws lso vlidted using grose gel electrophoresis. The quntifiction cycle (Cq) ws clculted y the instrument's softwre (StepOne Softwre v2.0) nd the reltive expression of ech mrna ws clculted s percentge of control rts, using the 2 ΔΔCt method 23. PCR efficiency ws lwys etween We tested four different reference genes (β-ctin, Lrp10, Gdi1 nd 18S rrna). At lest two of these genes were nlyzed in ech tissue; we present dt otined fter normliztion using the reference gene with the lowest gene expression vrition for ech tissue. β-ctin, well-known reference gene ws selected for muscle, hypothlmus nd WAT. β-ctin ws lso used in liver, except for the mino cid metolism genes which were nlyzed from different RT product thn the rest of the genes nd for which Gdi1 which we hve previously identified s good constitutive gene sed on microrry studies 24, resulted more dequte. Lrp10 ws used in BAT ecuse it is etter constitutive in this tissue nd it hs een descried s good choice for expression studies in dipose tissue 25. Western lot nlysis of ATGL, ACC nd phosphoacc. ATGL, ACC nd phosphoacc protein levels were determined y western lot in selected inguinl nd retroperitonel WAT s selected depots. Tissue ws homogenized t 4 ºC in 1:3 (w:v) in RIPA uffer contining Hlt Protese nd Phosphtse Inhiitor Cocktil (Thermo Fisher, Rockford, USA) using Polytron homogenizer (VWR). Homogente ws centrifuged t 700 g for 10 min t room temperture nd superntnt used for totl protein ATGL, ACC nd phospho-acc nlysis. Totl protein content ws mesured using the BCA protein ssy kit (Pierce, Rockford, IL, USA). Western lot ws performed using 60 microgrms of totl protein per lne in 4 15% Criterion 10

12 Pge 11 of 46 TGX Precst Gel (BioRd, Mdrid, Spin), nd then trnsferred to nitrocellulose memrne. The primry ntiodies used were the following: monoclonl rit nti- ATGL (Cymn Chemicl, Ann Aror, MI, USA), monoclonl rit nti-acc (Cell Signling, Inc., CA, USA) nd monoclonl rit nti-phosphoacc (Cell Signling, Inc., CA, USA) ntiodies diluted 1:1000 in TBS-T; memrnes were incuted during one hour for ATGL nd phosphoacc nd overnight for ACC. Memrnes were lso incuted with nti-β-ctin ntiody to ensure equl loding (from Cell Signling, Inc., CA, USA). Specific infrred (IR)-dyed secondry nti-igg ntiodies (LI-COR Biosciences, Nersk, USA) were used. For IR detection, memrnes were scnned in Odyssey Imger (LI-COR); the nds were quntified using the softwre Odyssey V3.0 (LI-COR). Sttisticl nlysis. All dt re expressed s the men ± SEM. Differences etween groups were nlyzed using Student s t test or one-wy ANOVA. One-wy ANOVA followed y lest significnt difference (LSD) post hoc comprison ws used to compre the effect of the different diets (control, HF nd HP), nd Student s t test to directly compre the effect of the HF or HP diets vs the control diet. Effect of fsting ws nlyzed using Student s t test. All the nlyses were performed with SPSS for windows (version 15.0, SPSS, Chicgo, IL, USA). Threshold of significnce ws defined t p<0.05 nd is indicted when different. 11

13 Pge 12 of 46 Results Body weight, diposity nd food intke As shown in Tle 2, high-ft pir-feeding did not ffect ody weight; nimls of the HF group presented the sme ody weight s controls. However HF-fed nimls hd greter ft mss compred to control nimls; diposity index, clculted from tissue weights fter the scrifice, ws lso higher in the rts fed with HF diet. In these HFfed nimls there ws n increse in the size of interscpulr BAT nd of two of the viscerl WAT depots studied: epididyml nd retroperitonel, ut not of the mesenteric depot. HF diet did not ffect the size of the sucutneous dipose depot (inguinl); however, there ws greter dipocyte re nd lower DNA content (used s n indictor of prolifertive ctivity) in this depot in nimls fed HF diet, suggesting incresed hypertrophy. No difference ws oserved in ccumulted cloric intke during the experimentl period (Tle 2) etween the HF nd the control groups. Concerning the HP group, nimls presented lower ody weight in comprison to control nimls (Tle 2). However, there ws no chnge in ody ft mss or in the diposity index in nimls of the HP group in comprison to controls. No chnge ws oserved either in the size of the WAT depots; however, nd contrry to wht ws oserved in the HF group, decrese ws oserved in the re of the dipocytes of the inguinl dipose depot (Tle 2). Animls fed with the HP diet showed lower ccumulted energy intke during the whole experimentl period (Tle 2). Liver nd muscle prmeters Liver of the nimls fed HF diet hd lower size nd lower glycogen content, ut higher content in totl lipids, tricylglycerols nd totl protein in comprison to controlfed nimls (Tle 3). In ccordnce with the greter lipid content, histologicl nlyses 12

14 Pge 13 of 46 reveled the presence of heptic stetosis in the HF-fed nimls (dt not shown). In nimls of the HP group, no chnge ws evident for glycogen, lipid, tricylglycerol or protein content in liver or for liver size (Tle 3). No evidence of heptic stetosis ws oserved in HP nimls. In muscle, n incresed tricylglycerol content ws oserved in the nimls fed with HF diet (Tle 3). Kidney prmeters Kidney weight ws incresed in the HP group; the greter size of this orgn ws even more evident when representing the results s percentge of totl ody weight (Tle 2). In ccordnce with higher protein content in the diet, ure levels in serum were incresed in the HP, wheres there were decresed in the HF group (Tle 4). Serum cretinine levels, used s possile indictor of kidney function, did not chnge s result of the intke of HF or HP diets (Tle 4). Serum prmeters relted to energy/glucose homeostsis nd diposity Mesured serum prmeters re represented in Tle 4. HF diet did not ffect circulting insulin levels ut resulted in tendency to incresed levels of circulting glucose in fed conditions (p=0.07, Student s t test, vs. control group) nd in lower insulin sensitivity s indicted y higher HOMA-IR. On the other hnd, HP diet did not ffect circulting glucose levels in fed nimls, ut insulin levels were incresed; in this cse no chnge ws oserved in the HOMA index. Serum leptin levels were not ffected y the intke of the HF or HP diets nd decresed with fsting in ll groups. HF diet intke produced decrese in serum tricylglycerol levels, wheres free ftty cid levels were not ffected y the intke of HF or HP diet. Interestingly, totl cholesterol ws decresed in HP-fed rts. We lso nlyzed et-hydroxyutyrte levels, which ws only present in detectle mounts in the HF group. Levels of the orexigenic signl ghrelin were higher in the HF nd HP nimls in the fed stte. Serum 13

15 Pge 14 of 46 TNF-lph levels, mesured s mrker of inflmmtion were incresed in oth HF nd HP groups. Effect of HF nd HP diet on mrna nd protein expression of key energy homeostsis-relted genes in different tissues Liver In liver (Figure 1), HF diet feeding produced decrese in mrna levels of genes involved in ftty cid synthesis: Acc1, Fsn nd Srep1; nd n increse in mrna levels of Cpt1 (liver isoform), key gene involved in ftty cid oxidtion. Interestingly, we lso oserved n incresed expression of Slc272 tht codes for ftty cid trnsporter. HP diet feeding did not ffect the expression of genes relted to ftty cid metolism. In reltion to the crohydrte metolism, the HF diet produced decresed expression of the glycolytic gene Pklr. Additionlly, oth diets incresed the expression of genes involved in mino cid metolism: Slc431 which codes for n mino cid trnsporter; Got1 (incresed only in the HP group) nd Gpt, oth coding for key trnsminses; nd the key ure cycle gene Cps1. Muscle As shown in Figure 1, dietry tretment produced decrese in gene expression levels of two key lipogenic genes studied, Fsn in the cse of the HF diet nd Srep1 in the cse of the HP diet. Besides, decresed expression ws lso oserved for the genes involved in ftty cid oxidtion: Ucp3 in the HF group nd Cpt1 (muscle isoform) nd Ucp3 in the HP group. 14

16 Pge 15 of 46 Hypothlmus In hypothlmus (Figure 1c), HF-feeding produced n incresed expression of the orexigenic gene Agrp nd decresed expression of the norexigenic gene Crt. HPfeeding did not significntly ffect mrna expression of the peptides studied. Adipose tissue Depot-specific differences were evident for the studied genes nd proteins in the different dipose tissues. As shown in Figures 2 nd 3, HF diet feeding produced decrese in the expression of key genes involved in ftty cid synthesis: Acc1 nd Fsn, oth in BAT (Figure 2) nd in the different WAT (Figure 3) depots studied. ACC protein levels, nlyzed in the inguinl nd retroperitonel WAT depots, were lso decresed while the phosphorylted ACC (inctive form)/totl ACC rtio ws incresed, ut only in the inguinl depot (Figure 4). On the other hnd, the HF diet produced n increse in the expression of genes relted to ftty cid oxidtion: Cpt1 in BAT, Atgl in the inguinl nd mesenteric WAT, nd Cpt1 in the retroperitonel WAT. Cpt1 ws mesured in dipose tissue ecuse it is the predominnt isoform expressed in this tissue 26. At protein level we nlyzed ATGL expression in two dipose depots nd it followed the sme regultory pttern thn mrna: incresed ATGL levels were oserved in the inguinl dipose depot while no chnge ws evident in the retroperitonel one (Figure 4). We oserved n increse in mrna levels of the min effector of BAT thermogenesis, UCP1, in the HF group, lthough it did not rech sttisticl significnce due to vriility etween nimls (p= 0.1, Student s t test). No chnge ws oserved in BAT in the expression of Adr3 or Pgc1α, involved in thermogenic response nd UCP1 expression respectively. HF diet produced n increse in the expression of the dipogenic gene Pprg in the inguinl WAT. 15

17 Pge 16 of 46 HP diet lso decresed the expression of genes involved in ftty cid synthesis, Acc1 nd Fsn, in BAT, nd Fsn in the inguinl nd retroperitonel WAT, ut incresed the expression of Acc1 in the WAT depots studied. However, this incresed Acc1 expression ws trnslted into higher protein levels in none of the two dipose depots nlyzed, inguinl or retroperitonel, nd tendency (p=0.08, Student s t test) to higher phosphorylted ACC/totl ACC rtio ws oserved in retroperitonel dipose depot (Figure 4). Concerning genes involved in ftty cid oxidtion, n pprently controversil effect ws lso found, s HP diet incresed Atgl expression in the inguinl (lso t protein levels) nd retroperitonel WAT ut decresed Cpt1 mrna levels in the different WAT depots. Gene expression of the dipogenic Pprg ws incresed in the inguinl nd retroperitonel depots, ut decresed in the mesenteric WAT of HP-fed rts. In BAT, HP diet produced decrese in expression levels of Ucp3, gene involved in ftty cid oxidtion. 16

18 Pge 17 of 46 Discussion Mcronutrient composition hs deep impct in energy metolism with coherent dptive physiologicl response in the selected orgns nd tissues. However there re still discrepncies regrding the metolic effects, especilly in the long term, of diets with n unlnced mcronutrient proportion 5. We performed this study to explore whether or not the intke of unlnced diets rich in ft or proteins offered in isocloric mounts in comprison to control diet might e detrimentl to helthy nimls when dministered over long period of time. In our study, the intke of n isocloric HF-diet with 60% energy from ft, dministered for 4 months, did not ffect ody weight. However, HF-fed nimls showed round 25% incresed ft mss content nd diposity index. The lck of overweight ut incresed diposity is consistent with other experiments dministering HF diets in isocloric conditions 27, 28. However, Lom et l. 29 hve descried overweight using pir-feeding experiment with similr experimentl design to ours. The difference cn e due to the fct tht they used HF diet which contined minly sturted ftty cids provided y hydrogented coconut oil, while we used diet with ft provided y lrd (with pproximtely 40% sturted nd 60% unsturted ft), nd it is well known tht the type of ft diet consumed cn ffect lipid metolism in different mnner 30. In spite of incresed diposity, we did not oserve ny difference in serum leptin levels in comprison to control nimls, in greement with other uthors using HF diet in isocloric conditions 31, 32. It is well documented tht the oesity derived from high intke of ft in d liitum conditions origintes overweight which is linked to insulin resistnce nd relted metolic disorders in different niml model nd humn studies 8, 33. Our dt show tht the intke of n isocloric pir-fed HF diet, despite cusing no overweight, is lso 17

19 Pge 18 of 46 inducing the development of insulin resistnce nd other metolic ltertions relted to metolic syndrome s discussed next. HF-fed nimls presented higher HOMA index nd higher glucose levels in feeding conditions, even when the mount of crohydrtes provided y the diet ws much lower thn the control diet (20% vs 70% totl energy); suggesting n ltertion of glucose metolism nd insulin signling due to ft intke, in greement with wht hs recently een descried y other uthors with similr diet nd conditions 27. HF-fed nimls lso presented incresed lipid nd tricylglycerol content in liver nd incresed serum levels of the inflmmtory mrker TNF-lph, ll of them prmeters relted to metolic syndrome. Metoliclly, HF-fed nimls were in fsting-like sitution ecuse of sustined decresed crohydrte intke, which is evidenced y the lower levels of heptic glycogen nd y the presence of circulting et-hydroxyutyrte. The HF diet produced high impct on mrna expression of regultory genes involved in energy homeostsis mintennce which would e intended to mintin glycemi, to use ftty cids from diet s energy source, s well s to try to compenste incresed diposity. In ccordnce with low input of diet crohydrtes, we oserved decresed expression of the key glycolytic gene Pklr in liver, in greement with wht hs previously een reported for HF diets dministered d liitum 34. We lso found incresed liver expression of genes involved in mino cid uptke (Slc431) nd hndling (Gpt nd Cps1) which could reflect incresed mino cid metolism to mintin glucose homeostsis y gluconeogenesis; however, circulting levels of ure, indictor or protein ctolism, were not incresed in the HF rts. Importnt chnges were lso oserved in lipid metolism. In generl terms, in the different tissues nlyzed (liver, skeletl muscle nd dipose tissue) HF feeding induced reduced mrna expression of key genes involved in lipid synthesis pthwys (Fsn, Srep nd Acc1). The decresed 18

20 Pge 19 of 46 lipogenic cpcity ws confirmed in the dipose tissue y decrese in ACC protein levels nd lso y n increse in the phosphorylted (inctive) ACC/totl ACC rtio oserved in the inguinl WAT depot. De novo lipogenesis hs een repetedly demonstrted to e reduced during d liitum high ft feeding 35, ut dt regrding isocloric feeding re very scrce. Decresed lipogenesis in liver would e relted to reduced very low-density lipoprotein production rte which would explin the decrese in circulting tricylglycerols detected in HF-fed nimls. Moreover, nimls of the HF group showed n incresed expression of ftty cid oxidtion genes in liver nd in rown (BAT) nd white dipose tissue (WAT), s descried for HF diets dministered d liitum 36. Lipolytic genes with incresed expression were: Cpt1 (Cpt1 in liver nd Cpt1 in BAT nd retroperitonel WAT) nd Atgl (in inguinl nd mesenteric WAT depots). Incresed mrna levels correlted with incresed protein levels for ATGL, studied s representtive of lipolysis; s hppened with mrna levels, we oserved incresed ATGL expression in the inguinl ut not in the retroperitonel depot. WAT depot-specific differences oserved in gene expression regultion, minly in lipolysis, could e due to hormonl nd/or signling differences (e.g. mount of et-drenergic receptors) etween ft depots 37, 38. We lso report incresed liver expression of Slc272, which codes for FATP2, ftty cid trnsporter tht hs een relted to heptic stetosis 39. This incresed Slc272 expression in liver oserved in HF-fed nimls could e relted to incresed ftty cid uptke, which correltes with the greter liver lipid nd tricylglycerol content nd with the signls of heptic stetosis oserved y histologicl nlysis in our nimls. In muscle, tissue with n importnt contriution to energy wste, we do not oserve n incresed expression of Cpt1 nd we even oserve decrese in the expression of Ucp3, lso relted to ftty cid oxidtion. This could suggest decresed lipolytic cpcity in this tissue under HF diet, s suggested 19

21 Pge 20 of 46 y other uthors 40 nd thus recircultion of the flux of ft excess to dipose tissue depots. In ddition, tricylglycerol levels in muscle were incresed. Decresed lipolysis nd Ucp3 gene expression in muscle under conditions of HF diets hs lso een relted to n increse in insulin resistnce 41, 42. One powerful mechnism suggested to compenste diet-induced oesity in rodents consists of incresing energy expenditure through dptive thermogenesis 43. Ad liitum intke of HF diets hs een relted to BAT hypertrophy nd to n incresed expression in this tissue of uncoupling protein 1 (UCP1), the min effector of dpttive thermogenesis 44, 43, however, the effect of isocloric HF diets on BAT thermogenic potentil is less studied. In our HF pir-fed nimls, we oserved n incresed size of BAT, nd non-significnt increse in Ucp1 mrna expression. Other group hs previously reported lck of effect of isocloric HF feeding on UCP1 expression nd thermogenic cpcity 28. High cloric intke nd HF diet intke independently of cloric intke re known to stimulte sympthetic nervous system ctivity which controls UCP1-medited thermogenesis 28. Thus, proly, the fct tht the HF diet ws dministered in isocloric conditions without incresed cloric intke produced not so potent UCP1 induction. However, we cnnot discrd n effect on thermogenesis, s it hs een reported tht isocloric HF feeding in rts induces BAT thermogenesis y ugmenting the ctivtion of UCP1 rther thn its expression 45. Isocloric HF-feeding lso ffected the expression of hypothlmic neuropeptides involved in the control of food intke. Although dily cloric intke ws not ffected, HF diet produced n increse in mrna expression of the orexigenic Agrp nd decrese in the expression of the norexigenic Crt gene; no chnge ws oserved in the expression of the orexigenic Npy or in the norexigenic Pomc gene. Moreover, serum levels of the orexigenic signl ghrelin were lso incresed in HF-fed rts. The higher AgRP/CART rtio nd higher sl circulting ghrelin levels could contriute to 20

22 Pge 21 of 46 overfeeding nd oesity if nimls were given free ccess to food. Interestingly, longterm intke of HF diet in d liitum conditions in rts hs een descried to hve n opposite effect, producing decrese in plsm ghrelin levels 46 proly to counterct the positive energy lnce. We lso nlyzed the effects of long-term HP diet intke. Animls fed with this diet presented 9% lower ody weight in comprison to control nimls. However, we did not oserve ny chnge in diposity, lthough there ws decrese in dipocyte re in the sucutneous WAT depot, which ws not trnslted into lower size of this depot. No chnge ws oserved either in the circulting levels of the diposity signl leptin mesured in d liitum conditions. Other uthors hve previously reported lower ody weight nd diposity in nimls fed HP diet which hs een ttriuted, in prt, to lower cloric intke 47. In fct, our HP-fed nimls showed lower, voluntry cumultive cloric intke fter 4 months of experiment, which could e explined y the greter sensory-specific stiety of proteins compred with crohydrtes 48. Circulting levels of the orexigenic hormone ghrelin were incresed in the nimls of the HP group. Ghrelin is responsive to short ut lso to long-term nutritionl sttus, nd its levels increse with fsting nd weight loss 49. It hs een descried tht individuls who hve lost weight y mens of chronic cloric restriction hve elevted levels of this hormone 50. Thus, high ghrelin levels in HP-fed nimls could e reflecting the long-term cloric restriction with lower cumultive intke during the 4 months of the experiments. One of the suggested nd controversil mechnisms to tke prt in weight reduction due to the intke of HP diets is the incresed energy expenditure through dptive thermogenesis 51. It hs een reported tht BAT thermogenesis ctivtion is dependent on the protein content in the diet 52 ; we do not oserve ny effect in mrna expression 21

23 Pge 22 of 46 of UCP1 or of its trnscriptionl coctivtor PGC1α using HP diet with 45% energy from protein. Weight loss is normlly ssocited with n improvement in insulin resistnce nd serum prmeters relted to metolic syndrome, irrespectively of the type of diet 53. We oserve decrese in circulting cholesterol levels in our HP-fed nimls tht could e relted to the weight loss, while tricylglycerol levels were not ffected. Regrding glucose metolism, lthough HOMA-IR nd glucose levels remined unchnged, higher insulin levels were required to mintin glycemi in HP-fed nimls. It hs een previously shown tht long-term protein intke is ssocited with higher insulin relese nd hs lso een suspected to promote insulin resistnce 12. When considering the effect of HP diets on insulin resistnce it my e importnt to tke into considertion the source of protein. The protein in our diet comes minly from csein, which hs een demonstrted to hve more negtive impct on insulin sensitivity when compred to proteins from other sources such s cod nd soy proteins 54. Remrkly, we oserved n increse in serum TNF-lph levels in the HP group which could indicte proinflmmtory effect of the HP diet used in our study nd, thus, higher risk of developing metolic complictions. In fct, TNF-lph serum levels hve een relted to insulin resistnce nd metolic syndrome 55. However, lso in this cse, protein source could e relevnt, s peptides derived from csein digest re known to enhnce immune system 56. As expected, we oserved incresed liver expression of genes involved in mino cid uptke nd hndling (Cps1, Got1, Gpt nd Slc431) which correlted with higher serum levels of ure in the HP-fed group, reflecting n incresed oxidtion of dietry mino cids. Metolic dpttion to HP intke is chrcterized y down regultion of lipogenesis from glucose 47. Our results show decresed mrna expression of 22

24 Pge 23 of 46 lipogenic genes in muscle (Srep1), WAT (Fsn) nd BAT (Fsn nd Acc1), possily s result of decresed crohydrte intke due to incresed protein proportion in diet 57. However, pprently contrdictory, the expression of lipogenic gene Acc1, coding for the enzyme involved in mlonyl-coa synthesis from cetyl-coa, rose in WAT in nimls of the HP group. This incresed Acc1 expression could e originted y the excess cetyl-coa generted y the ctolism of the excess mino cids 58, nd it is not necessrily trnslted into incresed protein levels or ctivity. In fct, ACC protein levels mesured in WAT were not incresed nd even tendency to higher rtio etween the phosphorylted (inctive) form nd totl protein ws oserved in the retroperitonel dipose depot which grees with the expected inhiition of lipogenesis in the HP fed nimls. Surprisingly, we did not oserve ny chnge in gene expression of lipogenic or lipolytic enzymes in liver, lthough other uthors hve reported reduction in heptic lipogenesis in nimls fed with HP diets mesuring prmeters including ftty cid synthse ctivity 47. With respect to genes involved in lipolysis, we oserved incresed ATGL expression in the inguinl (mrna nd protein) nd retroperitonel (only mrna) WAT depots, correlting with the smller dipocyte dimeter in the former. In contrst, the key gene relted to ftty cid oxidtion, Cpt1, decresed its expression in muscle nd in the different WAT depots nlyzed in the nimls of the HP group, proly due to the fct tht these nimls otin energy minly y oxidtion of dietry mino cids. In ccordnce with the lower crohydrte levels in the HP diet, we lso oserve decresed expression of the glycolytic gene Pfk. Finlly, HP diets hve een relted to renl ltertions 13. In this sense the intke of HP diet produced n increse in the weight of kidney in our nimls, which hs een previously descried in humns 59. It hs een demonstrted tht high-protein diets produce greter renl complictions in dietic thn in non-dietic nimls 60. Here in 23

25 Pge 24 of 46 helthy nimls, in spite of greter kidney size we did not oserve ny difference in serum cretinine, commonly used s n indictor of renl function. However, n incresed kidney size is present in different renl ltertions like dietic renl hypertrophy nd tuuloinsterstitil injury, mong others 61,62, nd for tht reson it could e detrimentl effect of the HP diet, prticulrly in the fce of compromised kidney function in dietic ptients. In conclusion, long-term intke of unlnced diets with n excess of ft or protein hve n impct on metolic nd moleculr prmeters relted to ody weight control nd diposity (see Figure 5). Thus, cre hs to e tken when ltering the recommended mcronutrient proportions in diet. A reduction in diet crohydrtes or d hits consisting of eting ft-rich foods, cn led to disproportion in ft intke which, even if not ssocited to overweight when ingested clories re controlled, cn e ccompnied y metolic syndrome-relted ltertions. Although there re some recent reserch descriing the development of insulin resistnce in nimls fed n isocloric HF diet 27, our study hs more glol pproch. The intke of clorie-controlled highft diets cn increse the incidence of non-oese individuls with n incresed ft content, the so clled thin-outside-ft-inside or metoliclly-oese norml-weight. Thus, it would e importnt to estlish nlyticl mesures to identify these individuls s helth preventive strtegy, s they cn e t incresed risk of metolic disese. On the other hnd, unlnced diets with n incresed proportion of proteins, lthough reduce ody weight nd decrese circulting cholesterol, increse serum insulin nd TNF-lph levels, nd produce incresed kidney size which could indicte higher risk of developing insulin resistnce, pthologies relted to incresed inflmmtion, or renl complictions. For this reson we do not discrd tht diets rich in proteins could hve 24

26 Pge 25 of 46 dverse effects in non-helthy nd more susceptile individuls, s individuls with incresed ody weight, those who usully follow these diets. 25

27 Pge 26 of 46 Acknowledgements. We thnk Enzo Ceresi for technicl ssistnce in the morphologicl nlysis. CIBER de Fisioptologí de l Oesidd y Nutrición is n inititive of the ISCIII. Finncil support. This work ws supported y the Spnish Government (Ministerio de Educción y Cienci, BIOBESMARKERS -AGL nd EPIMILK - AGL ) nd y the EU FP7 projects (BIOCLAIMS -FP nd DIABAT -HEALTH-F ). Lortory of Moleculr Biology, Nutrition nd Biotechnology is memer of the Europen Reserch Network of Excellence NuGO (The Europen Nutrigenomics Orgniztion, EU Contrct: FOOD-CT NUGO). RDR nd EGR re recipients of fellowship from the Spnish Government nd from the University of the Bleric Islnds, respectively. Conflict of interest. None Authorship. Author s responsiilities were s follows: AP, PO, RDR nd AC developed the experimentl design; RDR nd EGR did the mjor prt of the experimentl work; PO nd AC collorted in the niml studies; PO, AP, RDR nlyzed nd discussed the results; RDR nd PO wrote the mnuscript nd AP, AC nd EGR prticipted in criticl revising of the mnuscript. All the uthors red nd pproved the finl mnuscript. 26

28 Pge 27 of 46 References 1. J. Glgni nd E. Rvussin, Int. J. Oes. (Lond), 2008, 32 Suppl 7, S J. O. Hill, E. L. Melnson nd H. T. Wytt, J. Nutr., 2000, 130, 284S-288S. 3. A. Astrup, T. Meinert Lrsen nd A. Hrper, Lncet, 2004, 364, R. M. Kruss, R. H. Eckel, B. Howrd, L. J. Appel, S. R. Dniels, R. J. Deckelum, J. W. Erdmn, Jr., P. Kris-Etherton, I. J. Golderg, T. A. Kotchen, A. H. Lichtenstein, W. E. Mitch, R. Mullis, K. Roinson, J. Wylie-Rosett, S. St Jeor, J. Suttie, D. L. Trile nd T. L. Bzzrre, Circultion, 2000, 102, I. Aete, A. Astrup, J. A. Mrtinez, I. Thorsdottir nd M. A. Zulet, Nutr. Rev., 2010, 68, S. J. Wkil nd L. A. Au-Elheig, J. Lipid Res., 2009, 50 Suppl, S L. Cordin, S. B. Eton, A. Sestin, N. Mnn, S. Lindeerg, B. A. Wtkins, J. H. O'Keefe nd J. Brnd-Miller, Am. J. Clin. Nutr., 2005, 81, R. Buettner, K. G. Prhofer, M. Woenckhus, C. E. Wrede, L. A. Kunz- Schughrt, J. Scholmerich nd L. C. Bollheimer, J. Mol. Endocrinol., 2006, 36, L. Hooper, C. D. Summerell, R. Thompson, D. Sills, F. G. Roerts, H. J. Moore nd G. Dvey Smith, Cochrne Dtse Syst. Rev., 2012, 5, CD L. Schwingshckl nd G. Hoffmnn, Nutr. J., 2013, 12, M. Nokes, J. B. Keogh, P. R. Foster nd P. M. Clifton, Am. J. Clin. Nutr., 2005, 81, T. Linn, B. Sntos, D. Gronemeyer, S. Aygen, N. Scholz, M. Busch nd R. G. Bretzel, Dietologi, 2000, 43,

29 Pge 28 of S. P. Jurschek, L. J. Appel, C. A. Anderson nd E. R. Miller, Am. J. Kidney Dis., 2013, 61, J. E. Kerstetter, A. M. Kenny nd K. L. Insogn, Curr. Opin. Lipidol., 2011, 22, S. E. l Fleur, M. C. Luijendijk, A. J. vn Rozen, A. Klseek nd R. A. Adn, Int. J. Oes. (Lond), 2011, 35, M. M. Brdford, Anl. Biochem., 1976, 72, J. Folch, M. Lees nd G. H. Slone Stnley, J. Biol. Chem., 1957, 226, A. Cimri, P. Oliver nd A. Plou, J. Nutr. Biochem., 2012, 23, J. M. Kissne nd E. Roins, J. Biol. Chem., 1958, 233, S. Seifter, S. Dyton nd et l., Arch. Biochem., 1950, 25, D. R. Mtthews, J. P. Hosker, A. S. Rudenski, B. A. Nylor, D. F. Trecher nd R. C. Turner, Dietologi, 1985, 28, A. Untergsser, H. Nijveen, X. Ro, T. Bisseling, R. Geurts nd J. A. Leunissen, Nucleic Acids Res., 2007, 35, W K. J. Livk nd T. D. Schmittgen, Methods, 2001, 25, A. Cimri, P. Oliver, J. Keijer nd A. Plou, OMICS, 2010, 14, B. G. Grielsson, L. E. Olofsson, A. Sjogren, M. Jerns, A. Elnder, M. Lonn, M. Rudemo nd L. M. Crlsson, Oes. Res., 2005, 13, V. Esser, N. F. Brown, A. T. Cown, D. W. Foster nd J. D. McGrry, J. Biol. Chem., 1996, 271, P. S. Jco, T. M. de Meneses Fujii, M. Ymd, M. C. Borges, L. C. Pntleo, P. Borelli, R. Fock nd M. M. Rogero, Cell. Biochem. Funct., 2013, 31,

30 Pge 29 of M. J. Betz, M. Bielohuy, B. Murcher, W. Aplnlp, H. H. Muller, K. Pieper, J. Rmisch, M. H. Tschop, F. Beuschlein, M. Bidlingmier nd M. Slwik, PLoS One, 2012, 7, e A. Lom, J. A. Mrtinez, D. F. Grci-Diz, L. Pternin, A. Mrti, J. Cmpion nd F. I. Milgro, Mol. Genet. Met., 2010, 101, P. Yqoo, E. J. Sherrington, N. M. Jeffery, P. Snderson, D. J. Hrvey, E. A. Newsholme nd P. C. Clder, Int. J. Biochem. Cell Biol., 1995, 27, S. C. Woods, R. J. Seeley, P. A. Rushing, D. D'Alessio nd P. Tso, J. Nutr., 2003, 133, T. Strouini, D. Perre, A. Perels, C. Lipi, I. Donts, M. Trpli, N. Ktsilmros nd P. Glnopoulou, Eur. Cytokine Netw., 2008, 19, A. M. Lottenerg, S. Afonso Md, M. S. Lvrdor, R. M. Mchdo nd E. R. Nkndkre, J. Nutr. Biochem., 2012, 23, K. Chokklingm, K. Jewell, L. Norton, J. Littlewood, L. J. vn Loon, P. Mnsell, I. A. Mcdonld nd K. Tsintzs, J. Clin. Endocrinol. Met., 2007, 92, G. Shilleer, J. Hornford, J. M. Forden, N. C. Wong nd D. C. Lu, J. Lipid Res., 1990, 31, G. Vil, H. Duouchud, K. Couturier, C. Cottet-Rousselle, N. Tleux, A. Athis, A. Glinier, L. Csteill nd X. M. Leverve, J. Heptol., 2011, 54, F. Giorgino, L. Lviol nd J. W. Eriksson, Act Physiol. Scnd., 2005, 183, S. Cinti, Prostglndins Leukot. Essent. Ftty Acids, 2005, 73,

31 Pge 30 of J. Krmmer, M. Digel, F. Ehehlt, W. Stremmel, J. Fullekrug nd R. Ehehlt, Int. J. Med. Sci., 2011, 8, P. M. Bdin, I. K. Vil, K. Louche, A. Mirl, M. A. Mrques, V. Bourlier, G. Tvernier, D. Lngin nd C. Moro, Endocrinology, 2013, 154, Z. Guo nd L. Zhou, Metolism, 2004, 53, M. Nen, J. Hoeks, E. Moonen-Kornips, D. vn Beurden, J. J. Briede, M. K. Hesselink, J. F. Gltz nd P. Schruwen, FEBS Lett., 2011, 585, B. Cnnon nd J. Nedergrd, Physiol. Rev., 2004, 84, P. Roc, A. M. Rodriguez, P. Oliver, M. L. Bonet, S. Quevedo, C. Pico nd A. Plou, Pflugers Arch., 1999, 438, E. M. Mills, K. L. Wever, E. Armson, M. Pfeiffer nd J. E. Sprgue, Br. J. Phrmcol., 2007, 151, T. Hndjiev-Drlensk nd N. Boydjiev, J. Physiol. Biochem., 2009, 65, L. Pichon, J. F. Huneu, G. Fromentin nd D. Tome, J. Nutr., 2006, 136, K. Vndewter nd Z. Vickers, Physiol. Behv., 1996, 59, D. L. Willims, H. J. Grill, D. E. Cummings nd J. M. Kpln, Endocrinology, 2003, 144, B. Otto, U. Cuntz, E. Fruehuf, R. Wwrt, C. Folwczny, R. L. Riepl, M. L. Heimn, P. Lehnert, M. Fichter nd M. Tschop, Eur. J. Endocrinol., 2001, 145, K. J. Acheson, A. Blondel-Lurno, S. Oguey-Arymon, M. Beumont, S. Emdy-Azr, C. Ammon-Zufferey, I. Monnrd, S. Pinud, C. Nielsen-Moennoz nd L. Bovetto, Am. J. Clin. Nutr., 2011, 93,

32 Pge 31 of A. Notsch, K. J. Petzke, M. K. Millrose nd S. Klus, Eur. J. Nutr., 2011, 50, N. Tjik, S. A. Keshvrz, F. Msoudkir, M. Djlli, H. H. Sdrzdeh- Yegneh, M. R. Eshrghin, M. Chmry, Z. Ahmdivnd, T. Yzdni nd M. H. Jvnkht, J. Endocrinol. Invest., 2013, 36, C. Lvigne, A. Mrette nd H. Jcques, Am. J. Physiol. Endocrinol. Met., 2000, 278, E Y. S. Moon, D. H. Kim nd D. K. Song, Metolism, 2004, 53, T. Kwhr, D. Ktym nd H. Otni, Biosci. Biotechnol. Biochem., 2004, 68, E. J. Prks, Proc. Nutr. Soc., 2002, 61, N. Chotechung, D. Azzout-Mrniche, C. Bos, C. Chumontet, N. Gusseres, T. Steiler, C. Gudichon nd D. Tome, Am. J. Physiol. Endocrinol. Met., 2009, 297, E W. F. Mrtin, L. E. Armstrong nd N. R. Rodriguez, Nutr. Met. (Lond), 2005, 2, R. L. Meek, R. C. Leoeuf, S. A. Sh, C. E. Alpers, K. L. Hudkins, S. K. Cooney, R. J. Andererg nd K. R. Tuttle, Nephrol. Dil. Trnsplnt., T. Nkym, T. Kosugi, M. Gersch, T. Connor, L. G. Snchez-Lozd, M. A. Lnsp, C. Roncl, S. E. Perez-Pozo, R. J. Johnson nd T. Nkgw, Am. J. Physiol. Renl Physiol., 2010, 298, F D. C. Hn, B. B. Hoffmn, S. W. Hong, J. Guo nd F. N. Ziydeh, Am. J. Physiol. Renl Physiol., 2000, 278, F

33 Pge 32 of 46 Tle legends Tle 1. Primers used for rel time RT-PCR mplifiction. Nucleotide sequences, product size -P- (p) nd gene ccession numers re indicted. The position of the primers reltive to the coding sequence (indicted s suscripts), their loction y exon (indicted etween prentheses) s well s nneling temperture -AT- (ºC) re lso provided. For genes relted to ftty cid synthesis: Acc1: cetyl-coenzyme croxylse lph; Fsn: ftty cid synthse; Pprg: peroxisome prolifertor-ctivted receptor gmm nd Srep-1: sterol regultory element-inding protein 1. For genes relted to ftty cid oxidtion: Adr3: et-3 drenergic receptor; Atgl: dipose triglyceride lipse; Cpt1: crnitine plmitoyltrnsferse-1; Cpt1: crnitine plmitoyltrnsferse-1; Pgc1α: Peroxisome prolifertor-ctivted receptor gmm coctivtor 1-lph; Ucp1: uncoupling protein 1 nd Ucp3: uncoupling protein 3. For ftty cid trnsport: Slc272: solute crrier fmily 27 (ftty cid trnsporter), memer 2. For genes relted to crohydrte metolism: Pepck: phosphoenolpyruvte croxykinse; Pfkl: phosphofructokinse; Pklr: pyruvte kinse. For genes relted to mino cid metolism: Cps1: crmoyl phosphte synthetse 1; Got1: glutmic-oxlocetic trnsminse 1 nd Gpt: glutmic-pyruvte trnsminse nd Slc431 solute crrier fmily 43. For genes relted to food intke: Agrp: gouti relted protein; Crt: cocine nd mphetmine regulted trnscript; Ghsr: ghrelin receptor; Npy: neuropeptide y; Lepr: leptin receptor; Pomc: proopiomelnocortin nd Socs3: suppressor of cytokine signling 3. Reference genes: Act: ctin et; Gdi1: gunosine diphosphte dissocition inhiitor 1 nd Lrp10: low-density lipoprotein receptor-relted protein

34 Pge 33 of 46 Tle 2. Body weight, diposity-relted prmeters, food intke, DNA content, kidney weight nd kidney/ody weight rtio of mle Wistr rts fed with control, high ft (HF) or high protein (HP) diet from the ge of 2 until the ge of 6 months. Food in HF nd HP groups ws offered in isocloric mounts to the control group nd wter ws offered d liitum. The diposity index ws computed s the sum of epididyml, inguinl, mesenteric nd retroperitonel white dipose tissue depot weights nd expressed s percentge of totl ody weight. Ft nd len mss were mesured using n EchoMRI nd re expressed s percentge of totl ody weight. Adipocyte re ws mesured using specific softwre. DNA content in different dipose tissues ws mesured y fluorescence. One kidney per niml ws considered. Kidney/ody weight rtio represents the weight of the kidney expressed s percentge of totl ody weight. BAT: interscpulr rown dipose tissue; EWAT: epididyml white dipose tissue; IWAT: inguinl WAT; MWAT: mesenteric WAT nd RWAT: retroperitonel WAT. Results represent men ± SEM (n=7 in control nd HF groups nd n=6 in HP group). Sttistics: D, effect of the type of diet (one-wy ANOVA, p<0.05, nd indicted when different). Vlues not shring common letter (,, c) re significntly different (one-wy ANOVA, p<0.05). Letter is used to indicte the higher vlues. No letters = no sttisticl difference., different vs control group (Student s t test, p<0.05). Tle 3. Liver nd muscle prmeters nlyzed in the sme nimls nd conditions descried in Tle 2. Glycogen, lipid nd protein content were mesured y using the nthrone, Folch nd Brdford methods respectively. Tricylglycerol (TG) content ws mesured using colorimetric kit. Results represent men ± SEM (n=7 in control nd HF groups nd n=6 in HP group). Sttistics: D, effect of the type of diet (one-wy ANOVA, p<0.05). Vlues not shring common letter (, ) re significntly different 33

35 Pge 34 of 46 (one-wy ANOVA, p<0.05). Letter is used to indicte the higher vlues. No letters = no sttisticl difference. different vs control group (Student s t test, p<0.05). Tle 4. Serum prmeters nlyzed in the sme nimls descried in Tle 2. Some of the prmeters were lso nlyzed in fsting conditions (nocturnl 14-h fsting). Fed nd fsted dt correspond to serum from the sme set of nimls which ws collected with one week of difference. Insulin, leptin nd TNF-lph levels were mesured y ELISA kits. Ghrelin levels were mesured n enzyme immunosorent ssy kit. Circulting levels of tricylglycerols, free ftty cids, et-hydroxyutyrte, totl cholesterol, ure nd cretinine were determined using commercil enzymtic colorimetric kits. HOMA-IR ws computed using the formul of Mtthews et l. 21. Glucose ws mesured using glucometer. Results represent men ± SEM (n=7 in control nd HF groups nd n=6 in HP group). Sttistics: D, effect of the type of diet (one-wy ANOVA, p<0.05). Vlues not shring common letter (,, c) re significntly different (one-wy ANOVA, p<0.05). Letter is used to indicte the higher vlues. No letters = no sttisticl difference., different vs control group (Student s t test, p<0.05). * Effect of fsting (fsted vs fed nimls) (Student s t test, p<0.05). 34

36 Pge 35 of 46 Figure legends Figure 1. mrna levels of key energy homeostsis-relted genes in liver (), muscle () nd hypothlmus (c) nlyzed in mle Wistr rts fed with control, high ft (HF) or high protein (HP) diet from the ge of 2 until the ge of 6 months. Food in HF nd HP groups ws offered in isocloric mounts to the control group nd wter ws offered d liitum. mrna expression levels in the different tissues were mesured y rel time RT-PCR. Results represent men ± SEM (n=7 in control nd HF groups nd n=6 in HP group) of rtios of specific mrna levels to β-ctin (used s reference gene), except for the mino cid metolism genes whose dte were normlized using Gdi1. Dt of the control group ws set to 100% nd the rest of the vlues re referred to this. Sttistics: Vlues not shring common letter (, ) re significntly different (one-wy ANOVA, p<0.05). Letter is used to indicte the higher vlues. No letters = no sttisticl difference., different vs control group (Student s t test, p<0.05). Figure 2. mrna levels of key energy homeostsis-relted genes in rown dipose tissue (BAT) depots nlyzed in the sme nimls nd conditions descried in Figure 1. mrna expression levels in BAT ws mesured y rel time RT-PCR. Results represent men ± SEM (n=7 in control nd HF groups nd n=6 in HP group) of rtios of specific mrna levels to Lrp10 (used s reference gene). Dt of control group ws set to 100% nd the rest of the vlues re referred to this. Sttistics: Vlues not shring common letter (, ) re significntly different (one-wy ANOVA, p<0.05). Letter is used to indicte the higher vlues. No letters = no sttisticl difference., different vs control group (Student s t test, p<0.05). Figure 3. mrna levels of key energy homeostsis-relted genes in different white dipose tissue, iwat (), mwat (), rwat (c) depots nlyzed in the sme nimls nd conditions descried in Figure 1. mrna expression levels in the different white 35

37 Pge 36 of 46 dipose tissues were mesured y rel time RT-PCR. iwat: inguinl WAT; mwat: mesenteric WAT nd rwat: retroperitonel WAT. Results represent men ± SEM (n=7 in control nd HF groups nd n=6 in HP group) of rtios of specific mrna levels to β- ctin (used s reference gene). Dt of control group ws set to 100% nd the rest of the vlues re referred to this. Sttistics: Vlues not shring common letter (, ) re significntly different (one-wy ANOVA, p<0.05). Letter is used to indicte the higher vlues. No letters = no sttisticl difference., different vs control group (Student s t test, p<0.05). Figure 4. ATGL, ACC, phosphoacc protein levels nd phosphoacc/acc rtio in inguinl nd retroperitonel WAT in the sme nimls nd conditions descried in Figure 1. Protein levels were mesured y western lot. Representtive nds otined in the western lot re shown; sixty microgrms of protein ws loded per lne. Results represent men ± SEM (n=7 in control nd HF groups nd n=6 in HP group) of rtios of specific protein levels to β-ctin, (loding control). For protein levels, dt of control group ws set to 100% (for protein levels) or one (for phosphoacc/acc rtio) nd the rest of the vlues re referred to this. Sttistics: Vlues not shring common letter (, ) re significntly different (one-wy ANOVA, p<0.05). Letter is used to indicte the higher vlues. No letters = no sttisticl difference., different vs control group (Student s t test, p<0.05 or indicted when different). Figure 5. Scheme of the metolic effects of the intke of unlnced high ft or high protein diets dministered in isocloric conditions to dult Wistr rts from the ge of 2 until the ge of 6 months. 36

38 Pge 37 of 46 Tle 1. Primers used for rel time RT-PCR mplifiction Forwrd primer (5 to 3 ) Reverse primer (5 to 3 ) P (p) AT (ºC) Gene ccession numer Gene Ftty cid synthesis Acc TGCAGGTATCCCCACTCTTC (e8) TTCTGATTCCCTTCCCTCCT (e9) NM_ Fsn CGGCGAGTCTATGCCACTAT (e6) ACACAGGGACCGAGTAAT (e8) NM_ Pprg AGAGCCTTCAAACTCCCTCA (e3) GAGACATCCCCACAGCAAG (e4) NM_ Sref CCCACCCCCTTACACACC (e3) GCCTGCGGTCTTCATTGT (e4) NM_ Ftty cid oxidtion Adr CCTTCAACCCGCTCATCTAC (e1) TGGGAAATGGACGCTCAC (e2) NM_ Atgl TGTGGCCTCATTCCTCCTAC (e4) AGCCCTGTTTGCACATCTCT (e5) NM_ Cpt GCTCGCACATTACAAGGACAT (e14-15) TGGACACCACATAGAGGCAG (e16) NM_ Cpt GCAAACTGGACCGAGAAGAG (e8) CCTTGAAGAAGCGACCTTTG (e10) NM_ Pgc1α CATTTGATGCACTGACAGATGGA (e3) CCGTCAGGCATGGAGGAA (e3) NM_ Ucp GGGCTGATTCCTTTTGGTCT (e1) GGTGGTGATGGTCCCTAAGA (e2) NM_ Ucp GGAGGAGAGAGGAAATACAGAGG (e4) CCAAAGGCAGAGACAAAGTGA (e6) NM_ Ftty cid trnsport Slc CTGAAAAAGGAGGGCGTGT (e1) TATGTAGACTGCGGGTGTGG (e2) NM_ Crohydrte metolism Pepck CATTCAACGCCAGGTTCC (e3) AGAGGTCCCCATCCGTGT (e4) NM_ Pfkl AGGGCTGTGACTCGTATGG (e2) GTTGGCTGGCTTGATGTTCT (e3) NM_ Pklr CTGCGGAGAAGGTTTTCTTG (e7) ATACAGTCAGCCCCATCCAG (e8) NM_ Amino cid metolism Cps1 Got1 Gpt Slc AGGTCTTGGGAACATCGGTC (e15) GACCACAGTCTCAACCACGA (e2) 36-55ACTTTCCCATTCCCAGCCCT(e1) GAGGGGACTGACGGCTTTATT (e6-7) ATGGTGTCTGCTGCCTTCAA (e16) ACACCCCCAACCCGATTCT (e2-3) ACCTTTCCCTTCAGCCCATT (e1) AGGCTCCACAGGAAAATGGG (e8) NM_ NM_ NM_ NM_ Food intke Agrp AGAGTTCTCAGGTCTAAGTCT (e3-4) CTTGAAGAAGCGGCAGTAGCACGT (e5) NM_ Crt AGAAGAAGTACGGCCAAGTCC (e2) CACACAGCTTCCCGATCC (e3) NM_ Ghsr TCAGCCAGTACTGCAACCTG (e2) GGAGAGATGGGATGTGCTGT (e2) NM_ Npy TGGACTGACCCTCGCTCTAT (e2) GTGTCTCAGGGCTGGATCTC (e3) NM_ Lepr AGCCAAACAAAAGCACCATT (e6) TCCTGAGCCATCCAGTCTCT (e7) NM_ Pomc CCTGTGAAGGTGTACCCCAATGTC (e3) CACGTTCTTGATGATGGCGTTC (e3) NM_ Socs ACTGAGCCGACCTCTCTCCT (e1) CCCCTCTGACCCTTTCTTTG (e1) NM_ Reference genes Act Gdi TACAGCTTCACCACCACAGC (e4) GACTCTCTGAACCGTCATCAA (e9) TCTCCAGGGAGGAAGAGGAT (e4) CCGCACAAGGCAAATACATC (e10) NM_ NM_ Lrp TCCCCTTTCTTCTCCTCCTC (e1) TTACCGTCTGTTCCTTGCTG (e3) NM_

39 Pge 38 of 46 Tle 2. Body weight, diposity-relted prmeters, food intke, DNA content, kidney weight nd kidney/ody weight rtio of mle Wistr rts fed with control, high ft (HF) or high protein (HP) diet from the ge of 2 until the ge of 6 months control group HF group HP group ANOVA Body weight (g) 500 ± ± ± 12 D Adiposity index (% of ft) 8.43 ± ± ± 1.07 Ft mss (%) 17.8 ± ± ± 1.7 D Len mss (%) 68.2 ± ± ± 2.1 D Accumulted cloric intke (Kcl) ± ± ± 495 D Dily food intke (Kcl) 73.2 ± ± ± 3.4 Weight of dipose tissues (g) BAT 0.54 ± ± ± 0.03 c D EWAT 12.8 ± ± ± 1.7 D IWAT 9.78 ± ± ± 0.96 MWAT 6.44 ± ± ± 1.80 RWAT 12.2 ± ± ± 2.1 D Adipocyte re (µm 2 ) IWAT 4473 ± ± ± 290 c D RWAT 5881 ± ± ± 706 DNA content (µg/g tissue) EWAT 5.29 ± ± ± 0.76 IWAT 42.9 ± ± ± 5.9, D MWAT 9.97 ± ± ± 1.5 RWAT 7.35 ± ± ± 0.80 Weight of kidney (g) 1.32 ± ± ± 0.04 D Kidney/ody weight rtio (%) 0.27 ± ± ± 0.01 D 38

40 Pge 39 of 46 Tle 3. Liver nd muscle prmeters nlyzed in the sme nimls nd conditions descried in Tle 2 control group HF group HP group ANOVA Liver weight (g) 13.9 ± ± ± 0.3 D Liver glycogen content (mg glycogen/ g tissue) 25.3 ± ± ± 3.9, Lipid content (mg lipid/g tissue) Liver 42.6 ± ± ± 1.3 D Muscle 14.8 ± ± ± 0.7 TG content (mg TG/ g tissue) Liver 22.7 ± ± ± 6.8 D Muscle 54.5 ± ± ± 6.8 Protein content (mg protein/g tissue) Liver 16.3 ± ± ± 0.4 D Muscle 43.1 ± ± ±

41 Pge 40 of 46 Tle 4. Serum prmeters nlyzed in the sme nimls descried in Tle 2 control group HF group HP group ANOVA Glucose (mg/dl) Feeding 97.1 ± ± ± 3.0 D Fsting 80.5 ± 4.3 * 86.4 ± 1.4 * 87.8 ± 4.0 Insulin (µg/l) Feeding 1.23 ± ± ± 0.27 D Fsting 0.36 ± 0.08 * 0.82 ± ± 0.16 * D HOMA index 2.17 ± ± ± 0.65 D Leptin (pg/µl) Feeding 9.27 ± ± ± 0.86 Fsting 5.78 ± 0.61 * 6.66 ± 0.51 * 4.43 ± 0.54 * TNF-lph (pg/ml) 2.64 ± ± ± 5.7 Ghrelin (ng/ml) 1.75 ± 0.12 c 3.40 ± ± 0.48 Tricylglycerols 7.08 ± ± ± 1.02 (mg/ml) Free ftty cids (µm) 0.62 ± ± ± 0.05 Bet hydroxiutyrte ± D (µmol/ml) Totl Cholesterol 1.54 ± ± ± 0.16 (mg/dl) Ure (mg/dl) 5.08 ± ± 0.27 c 8.10 ± 0.68 Cretinine (mg/dl) 0.81 ± 0.09, 1.12 ± ± 0.07 D 40

42 % RNA expression of control group % RNA expression of control group % RNA expression of control group Pge 41 of 46 Figure 1 ) Liver Control High ft High protein ) Muscle Ftty cid synthesis c) Hypothlmus Ftty cid oxidtion Ftty cid trnsport Crohydrte metolism Acc1 Fsn Pprg Srep Atgl Cpt1 Slc272 Pepck Pfk Pklr Cps1 Got1 Gpt Slc431 Ftty cid synthesis,, c Ftty cid oxidtion Amino cid metolism Fsn Srep Cpt1 Ucp3 Orexigenic genes, c,, Anorexigenic genes 50 0 Agrp Ghsr Npy Socs3 Crt Lepr Pomc 41

43 % RNA expression of control group Pge 42 of 46 Figure 2 Control High ft High protein Ftty cid synthesis Ftty cid oxidtion Acc1 Fsn Pprg Srep1 Adr3 Atgl Cpt1 Pgc1 Ucp1 Ucp3 42

44 % RNA expression of control group % RNA expression of control group % RNA expression of control group Pge 43 of 46 Figure 3 ) Inguinl WAT Control High ft High protein Ftty cid synthesis Ftty cid oxidtion , ) Mesenteric WAT c) Retroperitonel WAT Acc1 Fsn Pprg Srep1 Atgl Cpt1 Ftty cid synthesis Acc1 Fsn Pprg Srep1 Atgl Cpt1 c Ftty cid synthesis Ftty cid oxidtion Ftty cid oxidtion c 0 Acc1 Fsn Pprg Srep1 Atgl Cpt1 43

45 % protein levels of control group % protein levels of control group % protein levels of control group Rtio phosphoacc/acc % protein levels of control group % protein levels of control group % protein levels of control group Rtio phosphoacc/acc Pge 44 of 46 Figure 4 ) Inguinl WAT Control High ft High protein ATGL -ctin 1 ) Retroperitonel WAT ATGL -ctin ATGL ACC phosphoacc phosphoacc/acc ACC -ctin phospoacc -ctin ATGL ACC phosphoacc phosphoacc/acc ACC -ctin phospoacc -ctin p=

46 Pge 45 of 46 Figure 5 Isocloric high ft diet High protein diet Ft s min mcronutrient source of energy (60% Kcl vs 10% in control diet) Incresed protein content (45% Kcl vs 20% in control diet) Liver Muscle WAT BAT Adiposity Lipogenic cpcity Lipolytic cpcity Glycolysis Ft deposition Insulin resistnce Metolic syndrome Inflmmtion Cumultive intke Lipogenic cpcity (muscle, WAT nd BAT) Lipolytic cpcity (WAT) Insulin levels Amino cid metolism (liver) Inflmmtion Body weight Cholesterol levels Ure / kidney size Incresed metolic prmeters of helth risk 45

47 Pge 46 of 46 Tle of content Highlight Chronic intke of diets with high proportion of ft or protein dministered in isocloric conditions to control lnced diet is ssocited to chnges in metolic prmeters relted to diposity nd helth. 46