SUPPLEMENTARY MATERIAL. Bimodal distribution of motility and cell fate in Dictyostelium discoideum
|
|
|
- Amos Armstrong
- 5 years ago
- Views:
Transcription
1 doi: /ijdb ps SUPPLEMENTRY MTERIL corresponding to: imodal distribution of motility and cell fate in ictyostelium discoideum PVN GOURY-SISTL, VIYNN NNJUNIH and GOPL PNE *ddress correspondence to: Gopal Pande. M, Hyderabad India. Phone: Fax: The complete paper associated with this Supplamentary Material can be found at: ccepted: 22 ecember Final, author-corrected PF published online: 16 January Edited by: Mieke Van Lijsebettens.
2 Supplementary Movies for this paper are available at: Supplementary Movie M1: Time lapse movies of. discoideum cells (20X) in nutrient medium, during early starvation and in replaced nutrient medium. Supplementary Movie M2: Time lapse movie of both linear moving and wriggling cells. White circle represents linear cell and black circle represents wriggling cell. Supplementary Movie M3: Time lapse movies of.discoideum cells at a higher magnification (40X) in nutrient medium, during early starvation and in replaced nutrient medium. E F G H I Supplementary Fig. S1. imodal distribution of cell motility in X2, Polysphondylium pallidum and Trishanku (tri ) cells under different nutrient conditions. istribution of the speed of X2, Polysphondylium pallidum and Trishanku (tri - ) cell motility under nutrient conditions (,,G), during starvation (,E,H) and after replacement of the nutrient medium (,F, I). Note the distinct bimodal distribution of the speed of cell motility during starvation in X2 cells () (n=125). n represents the number of cells in each condition. uring nutrient rich conditions, bimodality was not distinct. The results for these were obtained from the cell motility analyses for X2 shown in Fig. 1. bout 45 cells in each condition were analysed for the variation in cell motility.
3 E Supplementary Fig. S2. Images and tracks from cell motility movies of. discoideum (X2). (-) ell motility tracks of X2 cells in nutrient, starvation and replaced nutrient medium respectively. Images are taken from the final frame of the corresponding movie. The corresponding speed (mm) values are given along with the tracks. (,E) ell motility track overlays of calcium sorted slow and fast cells. Scale bar, 20 mm.
4 Supplementary Fig. S3. Mean square displacement. Mean square displacement of cells during nutrient condition (), starvation () and replaced nutrient medium ().
5 Supplementary Fig. S4. Images and tracks from Fluo-3 labelled and unlabelled cell motility movies of. discoideum (X2). (-) Fluo-3 labelled and unlabelled cells. () The tracks of Fluo-3 labelled cells (Track No: 1-4) that were longer and unlabelled cells showed wriggling type of motility (Track No: 5-8). Supplementary Fig. S5 (Left). verage number of pseudopods/turn in X2 cells. The representative tracks for Fast and Slow cells are shown in (,). () The average number of pseudopods/turn in both Fast and Slow category of cells. n represents the number of cells analysed. Supplementary Fig. S6 (Right). Localization of PIP2 and F-actin in the starved X2 cells. Fluorescent images of PIP2 (green) () and F-actin by Rhodamine Phalloidin staining (red) () in the starved cells of X2 strain. The phase contrast and the merged images are shown in (,) respectively. The arrow in () points to the co-localization of PIP2 and F-actin. Scale bar, 20 mm.
6 E F G Supplementary Fig. S7. imensions of.discoideum cells under different nutrient conditions. imensions of cells stained with ctin/pi3kinase and ctin/pten in nutrient medium (,), Starvation (,E) and in replaced nutrient medium (,F). nterio-posterior axes lengths of X2 cells under different nutrient conditions (G). n indicates the number of cells analysed under each condition.
7 SUPPLEMENTRY TLE 1 ISPLEMENT OF INIVIUL X2 ELLS UNER IFFERENT NUTRIENT ONITIONS Nutrient medium ell No Total istance moved (µm) isplacement from origin (µm) Starvation ell No Total istance moved (µm) isplacement from origin (µm) Replaced Nutrient medium ell No Total istance moved (µm) isplacement from origin (µm) ata has been taken from the Movie shown in Supplementary Movie M1 and represents the movement during first 10 minutes of the movie.
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
CD4 and CD8 T cells show a similar accumulation in the tumor stroma.
Fig S1 CD4 Fibronectin EpCM CD8 CD4 and CD8 T cells show a similar accumulation in the tumor stroma. Fluorescently-labeled CD4 (CMFD, green) and CD8 (Hoechst, yellow) T cells were added to a human lung
Supplementary Figure S1 (a) (b)
Supplementary Figure S1: IC87114 does not affect basal Ca 2+ level nor nicotineinduced Ca 2+ influx. (a) Bovine chromaffin cells were loaded with Fluo-4AM (1 μm) in buffer A containing 0.02% of pluronic
Tanimoto et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Tanimoto et al., http ://www.jcb.org /cgi /content /full /jcb.201510064 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Method for aster 3D tracking, extended characterization of
J. Cell Sci. 129: doi: /jcs : Supplementary information
Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.
ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo
Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina
syx M18 M13 M18 M13 E *** M18 M13
syx D syx M13 F % with cluster 8 6 4 G 3 rnd Syx rnd M13 ** rnd M13 H E % with anule 8 6 4 bg syx rnd F cell S a c Supplementary Fig 1. Quantification of membrane protein clusters beneath anules. TIRF-M
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
d e f Spatiotemporal quantification of subcellular ATP levels in a single HeLa cell during changes in morphology Supplementary Information
Ca 2+ level (a. u.) Area (a. u.) Normalized distance Normalized distance Center Edge Center Edge Relative ATP level Relative ATP level Supplementary Information Spatiotemporal quantification of subcellular
Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii
Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii María Lázaro-Díez, Itziar Chapartegui-González, Santiago Redondo-Salvo, Chike Leigh, David Merino, David San Segundo, Jesús
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B
SUPPLEMENTARY INFORMATION
Supplementary Information included with Nature MS 2008-02-01484B by Colantonio et al., entitled The dynein regulatory complex is required for ciliary motility and otolith biogenesis in the inner ear. This
Influenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking
Additional data for Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking Fabien Pinaud 1,3, Xavier Michalet 1,3, Gopal Iyer 1, Emmanuel
SUPPLEMENTARY INFORMATION. Supplementary Figures
SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure 1: Characterization of CerTN-L15 expressed in Arabidopsis roots. a. Ratiometric images of CerTN-L15 in roots under osmotic stress Ratiometric
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome
CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and
SUPPLEMENTAL FIGURES FIGURE S1. Detection of MCs. A, Schematic representation of T cells stimulated on anti- CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and microclusters.
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Gilberti et al. SUPPLEMENTAL FIGURE LEGENDS: Figure S1: The effect of pharmacological inhibitors on particle uptake. The data presented in Figure 1
Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module
Supplementary Information Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module O Neil Wiggan, Bryce Schroder, Diego Krapf, James R. Bamurg and Jennifer G. DeLuca
N-Cadherin Locks Left-Right Asymmetry by Ending the Leftward Movement of Hensen s Node Cells
Developmental Cell, Volume 30 Supplemental Information N-Cadherin ocks eft-ight Asymmetry by Ending the eftward Movement of Hensen s Node Cells aquel V. Mendes, Gabriel G. Martins, Ana M. Cristovão, and
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2610 Figure S1 FSMCs derived from MSLN CLN transgenic mice express smooth muscle-specific proteins. Beta-galactosidase is ubiquitously expressed within cultured FSMCs derived from MSLN
Supplementary table and figures
3D single molecule tracking with multifocal plane microscopy reveals rapid intercellular transferrin transport at epithelial cell barriers Sripad Ram, Dongyoung Kim, Raimund J. Ober and E. Sally Ward Supplementary
In Vivo Imaging of Virological Synapses
In Vivo Imaging of Virological Synapses Xaver Sewald 1, David G. Gonzalez 2, Ann M. Haberman 2, and Walther Mothes 1 * 1 Department of Microbial Pathogenesis, Yale University School of Medicine, New Haven,
A Precise Bicoid Gradient is Nonessential During Cycles for Precise Patterning in the Drosophila Blastoderm
Supporting Information for A Precise Bicoid Gradient is Nonessential During Cycles 11-13 for Precise Patterning in the Drosophila Blastoderm Elena M. Lucchetta, Meghan E. Vincent and Rustem F. Ismagilov*
Supplementary figure 1
Supplementary figure 1 (A) Quantitative analysis of F-actin signal intensity in NIH3T3 cells treated with PTD4-myc- RBD. NIH3T3 cells were treated with PTD4-myc-RBD as described. Please note the increase
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Nature Methods: doi: /nmeth.4257
Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.
Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
Supplemental Data Figure S1 Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells.
Supplemental Data Figure S1. Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells. (A) Specific lysis of IFN-γ-treated SKBR-3 cells in the absence
Title: Vectorization of biomacromolecules into cells using extracellular vesicles with enhanced internalization induced by macropinocytosis
Scientific Reports Supplementary information Title: Vectorization of biomacromolecules into cells using extracellular vesicles with enhanced internalization induced by macropinocytosis Authors: Ikuhiko
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).
Supplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted
John Nguyen, Nozomi Nishimura, Robert Fetcho, Costantino Iadecola, Chris B. Schaffer
Supplemental figures and text for Occlusion of cortical ascending venules causes blood flow decreases, reversals in flow direction, and vessel dilation in upstream capillaries John Nguyen, Nozomi Nishimura,
Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
Supplements. Figure S1. B Phalloidin Alexa488
Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with
Supplementary Information
Supplementary Information Intrinsic Photosensitivity Enhances Motility of T Lymphocytes by Phan X. Thieu, Barbara Jaruga, Sandeep C. Pingle, Bidhan C. Bandyopadhyay, & Gerard P. Ahern Supplementary Figure
Capu and Spire Assemble a Cytoplasmic Actin Mesh
Developmental Cell 13 Supplemental Data Capu and Spire Assemble a Cytoplasmic Actin Mesh that Maintains Microtubule Organization in the Drosophila Oocyte Katja Dahlgaard, Alexandre A.S.F. Raposo, Teresa
Cofilin is one crucial mediator of actin cytoskeletal dynamics
Chronophin coordinates cell leading edge dynamics by controlling active cofilin levels Violaine Delorme-Walker a,b, Ji-Yeon Seo a,b, Antje Gohla c, Bruce Fowler a,b, Ben Bohl a,b, and Céline DerMardirossian
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Supplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Beck et al., http://www.jcb.org/cgi/content/full/jcb.201011027/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Membrane binding of His-tagged proteins to Ni-liposomes.
Vesicular Trafficking of Semaphorin 3A is Activity- Dependent and Differs Between Axons and Dendrites
Traffic 6; 7: 6 77 Blackwell Munksgaard Copyright # Blackwell Munksgaard 6 doi:./j.6-854.6.44.x Vesicular Trafficking of Semaphorin A is Activity- Dependent and Differs Between Axons and Dendrites Joris
Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
SUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
SUPPLEMENTAL MATERIALS
Supplementary Methods SUPPLEMENTAL MATERIALS Supplementary References Supplementary Video Legends Supplementary Figures and Legends SUPPLEMENTARY METHODS Additional animals and cell lines used for the
Afferent lymph-derived T cells and dendritic cells use different CCR7-dependent routes for lymph node entry and intranodal migration
Braun et al. Supplementary Information 1 Supplementary Information Afferent lymph-derived T cells and dendritic cells use different CCR7-dependent routes for lymph node entry and intranodal migration Asolina
Astrocyte signaling controls spike timing-dependent depression at neocortical synapses
Supplementary Information Astrocyte signaling controls spike timing-dependent depression at neocortical synapses Rogier Min and Thomas Nevian Department of Physiology, University of Berne, Bern, Switzerland
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
Reactive Oxygen Species Regulate Protrusion Efficiency by Controlling Actin Dynamics
Reactive Oxygen Species Regulate Protrusion Efficiency by Controlling Actin Dynamics Nicolas Taulet, Violaine D. Delorme-Walker, Céline DerMardirossian* Department of Immunology and Microbial Science,
Supplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale
Supplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale (b) show stronger immunolabeling for CB 1 than those in
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
Microtubule Teardrop Patterns
Supporting Information Microtubule Teardrop Patterns Kosuke Okeyoshi 1, Ryuzo Kawamura 1, Ryo Yoshida 2, and Yoshihito Osada 1 * 1 RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198,
supplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
PHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE.
SUPPLEMENTARY FIGURES, TABLES AND VIDEOS PHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE. Clément Ricard 1,2,3,4, Aurélie Tchoghandjian 2,4, Hervé Luche 5, Pierre
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
Supplementary Figures for
mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/6/e1700338/dc1 Supplementary Materials for HIV virions sense plasma membrane heterogeneity for cell entry Sung-Tae Yang, Alex J. B. Kreutzberger, Volker Kiessling,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3443 In the format provided by the authors and unedited. Supplementary Figure 1 TC and SC behaviour during ISV sprouting. (a) Predicted outcome of TC division and competitive Dll4-Notch-mediated
SUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its
Supplementary Information Dramatic increase in SHP2 binding activity of Helicobacter pylori Western CagA by EPIYA-C duplication: its implications in gastric carcinogenesis Lisa Nagase, Takeru Hayashi,
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Morgan M. Stanton, Byung-Wook Park, Diana Vilela, Klaas Bente, Damien Faivre*, Metin Sitti*, and Samuel Sánchez*
Supporting Information Magnetotactic Bacteria Powered Biohybrids Target E. coli Biofilms Morgan M. Stanton, Byung-Wook Park, Diana Vilela, Klaas Bente, Damien Faivre*, Metin Sitti*, and Samuel Sánchez*
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal. Glucose Transport in Goldfish (Carassius auratus)
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal Glucose Transport in Goldfish (Carassius auratus) Ayelén Melisa Blanco 1,2, Juan Ignacio Bertucci 2,3, Naresh Ramesh 2, María Jesús Delgado
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery. Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito
Supplementary Information for: Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito Supplementary Methods Supplementary
pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells
a CD11c Na + K + ATPase Na + K + ATPase CD11c x-y CD11c Na + K + ATPase Na + K + ATPase CD11c x-z c b x-y view BoNT NAPs CD11c BoNT CD11c NAPs BoNT NAPs CD11c 90 x-z view Apical Basolateral Supplementary
Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment
Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment Soheila Sharghi-Namini 1, Evan Tan 1,2, Lee-Ling Sharon Ong 1, Ruowen Ge 2 * and H. Harry Asada 1,3
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes
effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a)
1 Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a) and CD45 (b) in fixed sections of binocular visual cortex
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed
Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Supplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
Supplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
Supplementary Information
Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding
Supplemental Figure 1. Vasoconstrictor responses of renal interlobular arteries to ATP. Responses of interlobular renal arterioles to ATP were
Supplemental Figure 1. Vasoconstrictor responses of renal interlobular arteries to ATP. Responses of interlobular renal arterioles to ATP were compared in SS rats fed 1% salt diet (black circles) and WKY
Longitudinal tracking of single live cancer cells to understand cell cycle effects of the
Longitudinal tracking of single live cancer cells to understand cell cycle effects of the nuclear export inhibitor, selinexor Joshua M. Marcus 1, Russell T. Burke 1, John A. DeSisto 1, Yosef Landesman
TRPA1 channels regulate astrocyte resting calcium. and inhibitory synapse efficacy through GAT-3
TRPA1 channels regulate astrocyte resting calcium and inhibitory synapse efficacy through GAT-3 * 1 Eiji Shigetomi, * 1 Xiaoping Tong 3 Kelvin Y. Kwan, 3 David P. Corey & 1,2 Baljit S. Khakh Ψ 1 Departments
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Visualization of the Self Assembly of Silica Nanochannels reveals growth mechanism Christophe Jung, Peter Schwaderer, Mark Dethlefsen, Ralf Köhn, Jens Michaelis * and Christoph
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/334/rs4/dc1 Supplementary Materials for Rapidly rendering cells phagocytic through a cell surface display technique and concurrent Rac activation Hiroki Onuma,
Intravital Microscopic Interrogation of Peripheral Taste Sensation
Supplementary Information Intravital Microscopic Interrogation of Peripheral Taste Sensation Myunghwan Choi 1, Woei Ming Lee 1,2, and Seok-Hyun Yun 1 * 1 Harvard Medical School and Wellman Center for Photomedicine,