Figure legends of supplementary figures
|
|
|
- Jonas Skinner
- 5 years ago
- Views:
Transcription
1 Figure legends of supplementary figures Figure 1. Phenotypic analysis of rice early flowering1 () plants and enhanced expression of floral identity genes in.. Leaf emergence of,, and plants with complementary expression of EL1 (pel1:el1, lines L1 and L2). Leaf numbers were calculated when a new blade tip is emerged from the sheath of the previous leaf.. Semi-quantitative RT-PCR analysis on the transcripts of selected floral initiation genes indicated the stimulated expressions of OsCK2, Hd1 and OsMDS1 in plants. Total RNs were extracted from rice meristems at the heading stage (4, 45, 5, and 55 days). Rice CTIN gene was amplified and used as an internal positive control. Experiments were repeated twice. Figure 2. Phylogenetic and structural analysis of EL1.. Phylogenetic analysis of plant casein kinase I.. The conserved motifs of casein kinase I in EL1, compared with that of rice OsCKI1. EL1 contains four short conserved peptides: LLGPSLEDLF, HIPXR, EXSRRDD, LPWQGLK. The black box indicates an SV4 T antigen putative nuclear localization sequence. Figure 3. Expression pattern analysis of EL1. Semi-quantitative RT-PCR analysis revealed the constitutive expression of EL1 in stem (St), leaf (Le), flower (Fl), sheath (Sh), glume (Gl), seedling (Se), shoot apical meristem (4 days, SM), and root. Detailed analysis showed that EL1 is mainly expressed at the P2 stage during floral development (lower panel). The rice CTIN gene was amplified and used as an internal positive control. Figure 4. EL1 overexpression in plants. Semi-quantitative RT-PCR analysis revealed the enhanced expression of EL1 in plants. The rice CTIN gene was amplified and used as an internal positive control. Figure 5. has increased response to G.. Measurement of the length of 2 nd leaf sheaths of 7-day-old seedlings in the presence of exogenous G 3 (,.1, 1 or 1 µm). Error bars represent SD (n=15-
2 2). Heteroscedastic t-test analysis showed a significant difference (**, p<.1).. Measurement of the length of 2 nd leaf sheaths of 7-day-old seedlings in the presence of exogenous uniconazole (, 1, 1 or 1 µm). Error bars represent SD (n=15-2). Heteroscedastic t-test analysis showed a significant difference (**, p<.1). C. Measurement of the length of 2 nd leaf sheaths of 7-day-old transgenic seedlings overexpressing EL1 (ps:el1) in the presence of exogenous G 3 (,.1, 1 or 1 µm). Error bars represent SD (n=15). Heteroscedastic t-test analysis showed a significant difference (**, p<.1). ar=1 cm. D. Measurement of the length of 2 nd leaf sheaths of 7-day-old, plants and with complementary expression of EL1 (pel1:el1, lines L1 and L2) in the presence of exogenous G 3 (,.1, 1 or 1 µm). Error bars represent SD (n=15-2). Heteroscedastic t-test analysis revealed a significant difference (**, p<.1). Figure 6. nalysis of α-amylase activities employing starch-containing plates in the presence of G 3 (1 mm) or (1 µm) for 2 days.. The starch was stained with I 2 -KI. Production and secretion of α-amylase from embryo-less half-seeds were observed as cleared zones (plaques).. seeds could secret α-amylase even in the presence of, confirming the enhanced G 3 response of. Figure 7. Prediction of phosphorylation sites in SLR1. Two putative phosphorylation sites in SLR1, S 196 and S 51, were predicted with the help of Figure 8. Overexpression of SLR1 in and seedlings.. Semi-quantitative RT-PCR analysis of the stimulated SLR1 transcripts in or plants transformed with ps:slr1.. Observation of the lengths of 7-day-old seedlings (upper panel) and various internodes of mature plants (lower panel) indicated the negative effects of SLR1 on plant growth were suppressed under EL1 deficiency. ar=1 cm. Figure 9. Suppressed expression of various Hd genes does not delay the flowering time of rice under EL1 deficiency.
3 . Semi-quantitative RT-PCR analysis confirms the suppressed expressions of Hd1, Hd3a, Hd6 in or plants transformed with ps:-hd1, ps:-hd3, or ps:-hd6. The leaves of plants at tilling stage were used for analysis.. Heading date of,, overexpressing SLR1 (ps:slr1), or plants with suppressed expression of HD1 (ps:-hd1), HD3a (ps:-hd3a) or HD6 (ps:-hd6). The heading time was calculated after seed germination and statistically analyzed using a heteroscedastic t-test (*, p<.5, n=15). Figure 1. Recombinant protein expression of EL1, tpip5k9, OsCKI1, SLR1, SLR1-N, and SLR1-C. Coomassie brilliant blue (C) staining indicated the recombinantly expressed EL1, tpip5k9, and OsCKI1. Proteins were extracted from cultures in the presence (lane 2, 4, 6) or absence of 1 mm IPTG (lane 1, 3, 5). The inducement was performed by incubation at o C for 3 h.. C staining revealed the recombinantly expressed SLR1. Proteins were extracted from cultures in the presence (lane 2) or absence of IPTG (lane 1). C. C staining indicated the recombinantly expressed C-terminus of SLR1 (SLR1- C, a position 329 to 626) and N-terminus of SLR1 (SLR1-N, a position 1 to 3). Proteins were extracted from cultures in the presence (lane 2, 3) or absence of IPTG (lane 1).
4 Dai and Xue, Supp Figure f Leaf Number o pel1:el1 L1 pel1:el1 L days CTIN Hd6 Hd1 OsMDS Cycles 3 3 3
5 Dai and Xue, Supp Figure OsCKI 84 Os2g Os4g Os1g Os2g tcki tcki1 CKL11 88 CKL6 98 CKL9a CKL7 84 Os1g136 1 Os2g CKL3 CKL4 85 CKL2 1 CKL1 67 Os1g Os1g3895 Os5g CKIepsilon CKIdelta CKIbeta CKIalpha 7 Hhp1 Hhp2 7 CKIgamma 99 CKI YCK2 EL1 OsCKI1 N 16 a S/T Kinase domain 259 a 24 a I II III IV C LLGPSLEDLF HIPXR EXSRRDD LPWQGLK EL1 N 138 a I II III IV S/T Kinase domain 271 a 298 a C
6 Dai and Xue, Supp Figure 3 CTIN EL1 St Le Fl Sh Gl Se SM Cycles 3 Root P1 P2 P3 P4 P5 Cycles CTIN EL1 3
7
8 Dai and Xue, Supp Figure 5 Length of 2nd l eaf sheath (cm) Length of 2 nd leaf sheath (c cm) C G 3 (μm) G 3 (μm) Uni (μm) Uni (μm) Length of 2 nd leaf sheath (cm) D (cm) Length of 2 nd leaf sheath ( * ps:el1-l8 ps:el1-l ** G 3 (μm) ** ** pel1:el1-l1 pel1:el1-l G 3 (μm) G 3 (μm) ps:el1-l8 ps:el1-l1
9 Dai and Xue, Supp Figure 6 G 3 1 μm 1 μm
10 Dai and Xue, Supp Figure 7 S196 S51
11 Dai and Xue, Supp Figure 8 CTIN SLR1 p:slr1 L1 L2 L3 L4 L5 L6 ps:slr1 L6 L7 L15 Cycles L2 L4 L6 L15 Internode length hs (cm) * * Panicle I II III IV V L1 L7
12 Dai and Xue, Supp Figure 9 CTIN HD1 ps:-hd1 L1 L3 L4 L5 L6 L7 L8 L9 L1 Cycles L5 L4 L3 L2 L1 Cycles CTIN HD1 ps:-hd1 ps:-hd3a L3 L4 L5 L8 L1 L11 L12 L16 L17 Cycles CTIN HD3a ps:-hd6 L1 L2 L3 L6 L8 L1 L11 L12 L14 Cycles CTIN HD6 CTIN HD3a CTIN HD6 ps:-hd3a L5 L4 L3 L2 L1 Cycles ps:-hd6 L5 L4 L3 L1 L2 Cycles Heading time (day) * * * * * * * ps:slr1-yfp ps:-hd1-l8 ps:-hd1-l9 ps:-hd3a-l3 ps:-hd6-l14 ps:-hd1-l2 ps:-hd3a-l3 ps:-hd1-l1
13 Dai and Xue, Supp Figure 1 M * tpip5k9 EL1 OsCKI1 1 2 M SLR1 C M * SLR1-C SLR1-N
Supporting Information
Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement
Supplemental Data. Wu et al. (2010). Plant Cell /tpc
Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
Supplemental Data. Beck et al. (2010). Plant Cell /tpc
Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)
Supplementary Figures
Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis
Supplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Phenotypes of iclf (clf-28 swn-7 CLF pro :CLF-GR) plants. A, Late rescue of iclf plants by renewed DEX treatment; senescent inflorescence with elongated siliques (arrow; 90 DAG,
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Open Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA
PaxDB Root Juvenile leaf Flowerbud Open Flower Carpel Mature Pollen Silique Seed Sec3a Sec3b Sec5a Sec5b Sec6 Sec8 Sec10a/b Sec15a Sec15b Exo84a Exo84b Exo84c Exo70A1 Exo70A2 Exo70A3 49 47 8 75 104 79
Expression constructs
Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression
Testing the ABC floral-organ identity model: expression of A and C function genes
Objectives: Testing the ABC floral-organ identity model: expression of A and C function genes To test the validity of the ABC model for floral organ identity we will: 1. Use the model to make predictions
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
Supplemental Figure S1. The number of hydathodes is reduced in the as2-1 rev-1
Supplemental Data Supplemental Figure S1. The number of hydathodes is reduced in the as2-1 rev-1 and kan1-11 kan2-5 double mutants. A, The numbers of hydathodes in different leaves of Col-0, as2-1 rev-1,
Supplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis
Current Biology, Volume 27 Supplemental Information Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis Chunmei Guan, Binbin Wu, Ting Yu, Qingqing Wang, Naden T. Krogan, Xigang Liu, and Yuling
Type 1 Diabetes 2/23/2015. Endocrine System Hormones. Living with Type 1 Diabetes
Endocrine System Hormones 2007-2008 Living with Type 1 Diabetes Type 1 Diabetes results from the autoimmune destruction of the insulin- producing beta-cells in the pancreas. The lack of insulin leads to
Supplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
Supplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Figure S1 Expression of AHL gene family members in diploid (Ler Col) and triploid (Ler
Supplemental material Supplemental figure legends Figure S Expression of AHL gene family members in diploid (Ler ) and triploid (Ler osd) seeds. AHLs from clade B are labelled with (I), and AHLs from clade
Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
Chapter 38. Plant Reproduction. AP Biology
Chapter 38. Plant Reproduction 1 Animal vs. Plant life cycle Animal multicellular 2n Plant multicellular sporophyte 2n gametes 1n spores 1n unicellular gametes 1n multicellular gametophyte 1n 2 Alternation
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
Regulation of Floral Organ Identity. Dr. Chloe Diamond Mara
Regulation of Floral Organ Identity Dr. Chloe Diamond Mara Flower Development Angiosperms (flowering plants) are the most widespread group of land plants Flowers are the reproductive organs that consist
Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
Chapter 38. Plant Reproduction. AP Biology
Chapter 38. Plant Reproduction 1 Animal vs. Plant life cycle Animal multicellular 2n Plant multicellular sporophyte 2n gametes 1n spores 1n unicellular gametes 1n multicellular gametophyte 1n 2 Alternation
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Supplemental Data. Candat et al. Plant Cell (2014) /tpc Cytosol. Nucleus. Mitochondria. Plastid. Peroxisome. Endomembrane system
Cytosol Nucleus 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 PSORT MultiLoc YLoc SubLoc BaCelLo WoLF PSORT
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
Arabidopsis: Flower Development and Patterning
Arabidopsis: Flower Development and Patterning John L Bowman, University of California, Davis, California, USA The development of flowers and floral organs is directed by genetic programmes likely to be
Potential use of High iron and low phytate GM rice and their Bio-safety Assessment
Potential use of High iron and low phytate GM rice and their Bio-safety Assessment Dr. Karabi Datta University of Calcutta, India Background High iron rice and iron bioavailability Micronutrient deficiency
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Supplementary Figures for
mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
Past Questions on Plant Reproduction
Past Questions on Plant Reproduction Name the parts labelled A, B, C, D in figure 1 State one function for each A and B. Figure 1 Name the parts labelled A, B, C, D,E and F in figure 2 What is the function
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
Generation of reactive oxygen and nitrogen species in pea cultivars under copper exposure
Volume 55(2):273-278, 2011 Acta Biologica Szegediensis http://www.sci.u-szeged.hu/abs ARTICLE Generation of reactive oxygen and nitrogen species in pea cultivars under copper exposure Nóra Lehotai, Andrea
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College
Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Supplemental Data. Di Giorgio et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Synteny analysis of NIP4;1 and NIP4;2. Examination of the NIP4;1-NIP4;2 region in rabidopsis thaliana and equivalent evolutionary regions in other dicot genomes are shown on the
Light triggers PILS-dependent reduction in nuclear auxin signalling for growth transition
In the format provided y the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 217.15 Light triggers PILS-dependent reduction in nuclear auxin signalling for growth transition Chloé
Reproduction and Development in Flowering Plants
Reproduction and Development in Flowering Plants Sexual Reproduction in Flowering Plants The flower functions in sexual reproduction of plants and precedes the development of seeds and fruits. Flowers
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B
No Characters No. of samples Methods Rank or measurement unit Remarks
Plant Rice 428 Primary essential character 1 Culm length 5 plants Measurement cm (integer) Distance from ground level to the base of the longest culm 2 Panicle length 5 plants Measurement cm (round to
Genetic Specification of floral organ identity. Initiating floral development. Deciding when to initiate flowering - induced mutations -in Nature
Genetic Specification of floral organ identity Initiating floral development Deciding when to initiate flowering - induced mutations -in Nature Flower structure of rabidopsis Stamens arpels Petals Sepals
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression
Introduction. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction It has been said that an oak is an acorn s way of making more acorns. In a Darwinian view of life, the fitness of an organism is measured only by its ability to replace itself with healthy,
The Role of Lipids in Flowering Development of Arabidopsis Enhanced pah1pah2 Plants. Toshiro Ito 1 & Lee Lishi 2
The Role of Lipids in Flowering Development of Arabidopsis Enhanced pah1pah2 Plants Toshiro Ito 1 & Lee Lishi 2 Department of Biological Sciences, Faculty of Science, National University of Singapore,
Supplementary Figure 1. Example of gating strategy
Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte
Chapter 38 Angiosperm Reproduction and Biotechnology
Chapter 38 Angiosperm Reproduction and Biotechnology Concept 38.1 Pollination enables gametes to come together within a flower Diploid (2n) sporophytes produce spores by meiosis; these grow into haploid
Kirschner, 2005). Briefly, parallel MEF cultures were isolated from single littermate
SUPPLEMENTAL MATERIALS AND METHODS Generation of MEFs, osteoblasts and cell culture Prkar1a -/- and control MEFs were generated and cultured as described (Nadella and Kirschner, 2005). Briefly, parallel
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary materials
Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds
Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer
AD Award Number: W81XWH-12-1-0322 TITLE: Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer PRINCIPAL INVESTIGATOR: Kufe, Donald W., M.D. CONTRACTING ORGANIZATION: Boston, MA 02215-5450
TITLE: Fast-Track Development of Potato Clones with Pure Amylopectin Starch Used in the Paper, Textile and Food Industries by Using Induced Mutation.
AGRICULTURAL RESEARCH FOUNDATION FINAL REPORT FUNDING CYCLE 2014 2016 TITLE: Fast-Track Development of Potato Clones with Pure Amylopectin Starch Used in the Paper, Textile and Food Industries by Using
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Direct Interaction of Ligand-Receptor Pairs Specifying Stomatal Patterning
Lee_Jin Suk 1 Direct Interaction of Ligand-Receptor Pairs Specifying Stomatal Patterning Jin Suk Lee, Takeshi Kuroha, Marketa Hnilova, Dmitriy Khatayevich, Masahiro M. Kanaoka, Jessica M. McAbee, Mehmet
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
APOLs with low ph dependence can kill all African trypanosomes
SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41564-17-34-1 In the format provided by the authors and unedited. APOLs with low ph dependence can kill all African trypanosomes Frédéric Fontaine 1, Laurence
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3200 Supplementary Figure 1 Expression analysis of stomach markers in gutlike structure. (a) Differentiation scheme of gut-like structure formation from embryonic stem cells. (b) RT-PCR
Flowering Plant Reproduction
Lab Exercise Flowering Plant Reproduction Objectives - To be able to identify the parts of a flower - Be able to distinguish between dicots and monocots based on flower morphology - Become familiar with
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
Introduction. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction It has been said that an oak is an acorn s way of making more acorns. In a Darwinian view of life, the fitness of an organism is measured only by its ability to replace itself with healthy,
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
3/18/2012. Chapter 36. Flower Parts. Flower Parts. Reproduction in Angiosperms
Chapter 36 Reproduction in Angiosperms Bryophytes >450mya 360 mya Fig. 27-4, p. 584 Lily Flower Flower Parts Sepals cover and protect flower parts in bud Collectively calyx Petals Can attract animal pollinators
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
Starch Granules in Tissues of Rice Plants and Their Changes in Relation to Plant Growth
Starch Granules in Tissues of Rice Plants and Their Changes in Relation to Plant Growth By KANOE SATO* Faculty of Agriculture, Tohoku University (Amamiya, Tsutsumi-dori, Sendai, 980 Japan) The rice plant
Effect of Mannose on Callus Induction and Gro wth of Different Explants Derived from Wheat
27,27 (1) :7 11 Journal of Triticeae Crops 3 1, 1, 1,2 (1.,4 ; 2.,4) :, 158 13,,1 g/ L,,15 g/ L 5 g/ L,55 %, 1 15 g/ L 5 g/ L, PMI/,5 1 15 g/ L,,,,, : ; ;;; :S512. 1 ;S336 : A :192141 (27) 12725 Effect
SUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
Supplementary Fig. 1 Blocking shh function at the protein level confirms its role as a guidance cue for postcommissural axons.
Supplementary Fig. 1 Blocking shh function at the protein level confirms its role as a guidance cue for postcommissural axons. As an alternative method to demonstrate the role of shh as a guidance cue
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Biology Class 12 th NCERT Solutions
Chapter.2 Sexual Reproduction in Flowering Plants Class XII Subject Biology 1. Name the parts of an angiosperm flower in which development of male and female gametophyte take place. Answer 1. Pollen grains
Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
Supplementary legends
Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
International Journal of Current Research in Biosciences and Plant Biology ISSN: Volume 2 Number 6 (June-2015) pp
Original Research Article International Journal of Current Research in Biosciences and Plant Biology ISSN: 2349-8080 Volume 2 Number 6 (June-2015) pp. 163-188 www.ijcrbp.com Kinetin - Polyethyleneglycol
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Supplemental Figure 1: Characterization of Toc159 co-suppression lines nts
Supplemental Data. ischof et al. Plant Cell (211)..1/tpc.111.92882 Supplemental Figure 1: Characterization of Toc19 co-suppression lines nts () Phenotype of rabiopsis plants co-suppressing attoc19. Images
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Plants Provision for Life. Chapter 2 7 th Grade
Plants Provision for Life Chapter 2 7 th Grade Lesson 2.1- Structure of Flowers Pistil- female reproductive structure Stigma- sticky top part. Traps pollen. Style- slender tube connecting stigma and ovary.